This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Feng, D. Articles by Tofler, G. H. Search for Related Content PubMed PubMed Citation Articles by Feng, D. Articles by Tofler, G. H. Related Collections Acute coronary syndromes Epidemiology Coagulation and fibronolysis Genetics of cardiovascular disease Platelets Risk Factors

(Arteriosclerosis, Thrombosis, and Vascular Biology. 1999;19:1142-1147.)
© 1999 American Heart Association, Inc.

Original Contributions

Increased Platelet Aggregability Associated With Platelet GPIIIa Pl^A2 Polymorphism

The Framingham Offspring Study

DaLi Feng; Klaus Lindpaintner; Martin G. Larson; Valluri S. Rao; Christopher J. O'Donnell; Izabella Lipinska; Christian Schmitz; Patrice A. Sutherland; Halit Silbershatz; Ralph B. D'Agostino; James E. Muller; Richard H. Myers; Daniel Levy; Geoffrey H. Tofler

From the Institute for Prevention of Cardiovascular Disease (D.F., I.L., G.H.T.), Beth Israel Deaconess Medical Center; Cardiovascular Division (K.L., V.S.R., C.S.), Brigham & Women's Hospital; the Department of Cardiology (K.L.), Children's Hospital, Harvard Medical School; National Heart, Lung and Blood Institute's Framingham Heart Study (M.G.L., C.J.O'D., P.A.S., D.L.); Statistics and Consulting Unit (H.S., R.B.D'A.), Department of Mathematics, Boston University; Cardiology Division (J.E.M.), University of Kentucky Medical Center; Department of Neurology (R.H.M.), Boston University.

Correspondence to Geoffrey H. Tofler, MD, Institute for Prevention of Cardiovascular Disease, Beth Israel Deaconess Medical Center, Harvard Medical School, One Autumn St, 5th Floor, Boston, MA 02215. E-mail gtofler{at}bidmc.harvard.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—The platelet glycoprotein IIb/IIIa (GP IIb/IIIa) plays a pivotal role in platelet aggregation. Recent data suggest that the Pl^A2 polymorphism of GPIIIa may be associated with an increased risk for cardiovascular disease. However, it is unknown if there is any association between this polymorphism and platelet reactivity. We determined GP IIIa genotype and platelet reactivity phenotype data in 1422 subjects from the Framingham Offspring Study. Genotyping was performed using PCR-based restriction fragment length polymorphism analysis. Platelet aggregability was evaluated by the Born method. The threshold concentrations of epinephrine and ADP were determined. Allele frequencies of Pl^A1 and Pl^A2 were 0.84 and 0.16, respectively. The presence of 1 or 2 Pl^A2 alleles was associated with increased platelet aggregability as indicated by incrementally lower threshold concentrations for epinephrine and ADP. For epinephrine, the mean concentrations were 0.9 µmol/L (0.9 to 1.0) for homozygous Pl^A1, 0.7 mmol/L (0.7 to 0.9) for the heterozygous Pl^A1/Pl^A2, and 0.6 µmol/L (0.4 to 1.0) for homozygous Pl^A2 individuals, P=0.009. The increase in aggregability induced by epinephrine remained highly significant (P=0.007) after adjustment for covariates. For ADP-induced aggregation, the respective mean concentrations were 3.1 µmol/L (3.0 to 3.2), 3.0 µmol/L (2.9 to 3.2), and 2.8 µmol/L (2.4 to 3.3); P=0.19 after adjustment for covariates. Our findings indicate that molecular variants of the gene encoding GP IIIa play a role in platelet reactivity in vitro. Our observations are compatible with and provide an explanation for the reported association of the Pl^A2 allotype with increased risk for cardiovascular disease.

Key Words: platelets • genetics • glycoprotein • epinephrine

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Myocardial infarction results from the formation of a platelet-rich thrombus at the site of a ruptured coronary atherosclerotic plaque.^{1 2} The platelet surface receptor glycoprotein IIb/IIIa (GP IIb/IIIa) plays a key role in the formation of such a thrombus by binding fibrinogen and von Willebrand factor. The importance of the GP IIb/IIIa receptor has been further supported by recent clinical trials in which GP IIb/IIIa antagonists have been shown to reduce restenosis rate after angioplasty³ and also to reduce the morbidity and mortality associated with unstable angina,⁴ high-risk coronary angioplasty,⁵ and acute myocardial infarction.⁶

Although the Pl^A1 and Pl^A2 variants of GP IIIa have long been recognized as alloantigens and most frequently implicated in syndromes of immune-mediated platelet destruction, until recently little attention has been paid to their role in coronary heart disease. Weiss and colleagues⁷ first reported that patients with acute coronary syndromes were more likely than were controls to carry the Pl^A2 allele. The risk associated with Pl^A2 was especially high for those aged 60 years or younger at the time of infarction. Recently, Walter and colleagues⁸ reported that patients with the Pl^A2 allele had an increased risk of coronary stent thrombosis compared with Pl^A1 homozygous individuals. However, the association between the Pl^A2 allele and cardiovascular disease has not been a consistent finding. Although Carter et al⁹ supported the early findings of Weiss,^] several other studies failed to detect the association,^{10 11 12 13 14 15} including a large prospective study from the Physicians' Health Study.¹⁰

Importantly, the mechanism for the possibly increased risk has not been determined. We hypothesized that the Pl^A2 allele might be associated with an increase in platelet aggregability and tested this hypothesis in the Framingham Offspring Study.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Study Population
The study subjects were members of the Framingham Offspring Study, a long-term, prospective evaluation of risk factors for cardiovascular disease. The design and methodology of the Framingham Offspring Study have been described in detail elsewhere.¹⁶ The participants were natural or adopted children of the original Framingham Heart Study subjects. For this study, we collected data from subjects that were consecutively examined between April 3, 1991 and June 29, 1995, during the fifth Offspring Study examination cycle.

Of the 3799 subjects who attended examination cycle 5, blood samples were collected from 3286 subjects for platelet aggregation analysis. For the present analysis, we excluded subjects who were not members of a sibship (n=1298) because linkage analysis was also performed. We also excluded subjects in whom platelet aggregation data would not be determinable because of treatment with anticoagulant or antiplatelet drugs (n=536). Finally, we excluded subjects in whom genotyping could not be successfully accomplished (n=30). A total of 1422 subjects fulfilled all inclusion criteria.

Determination of Platelet Aggregability
Blood samples were always obtained in the morning to avoid the circadian change of platelet aggregability. Blood was drawn in 3.8% sodium citrate solution (9:1). Platelet-rich plasma was separated by centrifugation for 10 minutes at 160g. Platelet aggregation was measured on a 4-channel aggregometer according to the method of Born.¹⁷ The aggregation agents tested were epinephrine and ADP in varying concentrations (0.01 to 30 µmol/L), and a fixed concentration of arachidonic acid (1.6 µmol/L). The lowest concentrations of ADP and epinephrine required to produce a biphasic response with >50% aggregation (threshold concentration) were determined. A decreased threshold concentration indicates an increase in platelet aggregability. In addition, the presence or absence of an aggregation in response to arachidonic acid was determined.

Genotyping
To detect the substitution of cytosine for thymidine at position 1565 in exon 2 of the glycoprotein IIIa gene that is responsible for the Pl^A2 polymorphism, we used a modified PCR-based restriction fragment length polymorphism (RFLP) analysis.¹⁸ Genomic DNA was isolated from whole blood. Genomic DNA (10 to 20 ng in 5 mL volume) was incubated at 96°C for 3 minutes, followed by addition of master-mix (10 µL) to yield a final reagent concentration of 333 nmol/L for sense and antisense primer, 167 nmol/L of each of dATP, dTTP, dCTP, and dGTP, 2.5 mmol/L magnesium chloride, 50 mmol/L potassium chloride, 10 mmol/L Tris-HCl (pH 8.4 at 25°C), 0.1%Triton X-100, 0.02 mmol/L cresol red, and 83 mmol/L sucrose, as well as 0.15 U of Taq polymerase. The sequences of the sense and antisense primers were 5'tgggacttctctttgggctcctgacttac3' and 5'ccttcagcagattctccttcaggtcac3', respectively. DNA was amplified by 39 cycles of denaturing at 96°C for 20 seconds, annealing at 56°C for 40 seconds, and extension at 72°C for 30 seconds.

Restriction buffer (10 µL) was added to yield a final concentration of 10 mmol/L Tris-HCl, 5.5 mmol/L magnesium chloride, 12.5 mmol/L sodium chloride, 30 mmol/L potassium chloride, 0.4 mmol/L dithiothreitol, and 0.1% Triton X-100. The samples were incubated at 37°C with 4 U of restriction endonuclease MspI overnight. This step was then repeated for complete digestion. In the presence of the Pl^A2 allele, but not the Pl^A1 allele, the 82 base pair (bp) amplification product was cleaved into fragments of 39 bp and 43 bp.

MspI digested amplification product (8 µL) was loaded onto 2% agarose gel slabs containing 40 mmol/L Tris acetate and 2 mmol/L EDTA. Samples were size-fractionated at 6 V/cm for 30 minutes. Bands were visualized after staining with ethidium bromide by 300 nm UV transillumination. PCR results were scored without knowledge of platelet aggregability results. When there was any ambiguity, genotyping was repeated. Ninety-eight percent of the subjects were successfully genotyped.

Statistical Analysis
Demographic and clinical characteristics were compared among genotype groups by one-way ANOVA or by ² test. The ² test was also used to compare the observed allele and genotype frequencies against Hardy–Weinberg equilibrium prediction. Data on epinephrine and ADP threshold concentrations were log-transformed and compared among genotype groups by one-way ANOVA¹⁹ as well as the nonparametric Kruskall–Wallis test. Post hoc pairwise comparisons among genotypes were performed using Scheffe's adjustment. Multiple regression was used to adjust for age, sex, body mass index (BMI), diabetes, triglyceride, total cholesterol and HDL cholesterol, the presence of cardiovascular disease (CVD), menopausal status, and estrogen replacement status.^{19 20} Separate models for recessive, dominant, and additive genetic effects were evaluated with use of appropriate dummy variables. Generalized estimating equation algorithms were used to correct for intrafamily correlations.²¹ Data on platelet aggregation were expressed as geometric mean±95% confidence interval. A value of P<0.05 was regarded as statistically significant.

Finally, a test of genetic linkage based on excess allele sharing for the quantitative traits (epinephrine and ADP threshold concentrations) with GP IIIa genotype was carried out, using SIBPAL version 2.7 of S.A.G.E. (1996).^{22 23} This program provides an estimate of the proportion of alleles identically shared by descent at the GP IIIa locus using the sibpairs under study. Under this algorithm, linkage between marker and phenotype results in a negative value for the slope of the regression of the squared trait difference on the estimated proportion of alleles.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Subject Characteristics (Table 1)
There were no significant differences among individuals within each genotype group for age, sex, BMI, diabetes mellitus, smoking, CVD, hypertension, triglyceride level, total and HDL cholesterol levels, or alcohol consumption. The allele frequencies of Pl^A1 and Pl^A2 were 0.84 and 0.16, respectively, and are in accord with those predicted by the Hardy–Weinberg equilibrium (P=0.44).

View this table: [in this window] [in a new window]   Table 1. Demographic Characteristics1

The genotype frequencies were similar between subjects excluded from the present analysis in whom genotyping was performed and those included in the present analysis. The frequencies of Pl^A1 homozygous, heterozygous and Pl^A2 homozygous were 72.9%, 24.3%, and 2.8% among subjects excluded, and 71.5%, 26.0%, and 2.5%, respectively, among subjects included in the present analysis (P=0.74).

Pl^A Polymorphism and Platelet Aggregability: Association Analysis (Table 2)
Epinephrine-Induced Platelet Aggregation
The presence of 1 or 2 Pl^A2 alleles was associated with an incrementally lower threshold concentration for epinephrine-induced aggregation (unadjusted ANOVA P=0.009 and Kruskall–Wallis P=0.0008). This increase in platelet aggregability associated with the Pl^A2 allele remained significant (ANOVA, P=0.007) after adjustment for age, sex, BMI, diabetes, triglyceride, total and HDL cholesterol, presence of CVD, menopausal status, and estrogen replacement therapy. There was no difference in results of analyses which included or excluded subjects with CVD.

View this table: [in this window] [in a new window]   Table 2. Platelet Aggregability Induced by Epinephrine and ADP

Post hoc analysis (Scheffe's test) was performed to compare genotype group pairwisely. The difference in epinephrine threshold concentration between Pl^A1 homozygous and Pl^A1/Pl^A2 heterozygous subjects was significant, P=0.02. Because of a small sample size in the Pl^A2 homozygous group (n=36), the difference between Pl^A2 homozygous and Pl^A1 homozygous or Pl^A1/Pl^A2 heterozygous subjects were statistically insignificant (P=0.18 and 0.69, respectively).

Regression models with dummy variables were used to test different modes of genetic transmission, in each case accounting for the above-mentioned possible confounds. The additive model (ie, a gene-dose model) yielded the best fit with P=0.002, followed by the dominant model (P=0.003). But in the recessive model, no statistically significant effect was seen (P=0.16). The threshold concentration of epinephrine decreased by 19% per "dose" of Pl^A2 allele (by 35% for Pl^A2 homozygous) relative to the Pl^A1 homozygote.

ADP-Induced Platelet Aggregation
There was a trend toward the Pl^A2 allele being associated with a decreased threshold concentration for ADP, which was directionally consistent with the results seen with epinephrine-induced aggregation. However, the differences observed were not statistically significant (ANOVA, P=0.48; Kruskall–Wallis test, P=0.23); after adjustment for covariates, P=0.19 (ANOVA).

Pl^A Polymorphism and Platelet Aggregability: Linkage Analyses Result
A negative regression coefficient (–0.1926), consistent with genetic linkage but not statistically significant (P=0.35), was observed for epinephrine-induced platelet aggregation. The regression coefficient for ADP threshold concentration was 0.2777 (P=0.60). The heterozygosity index of this dimorphic marker was 0.27.

Contribution of Genetic and Traditional Risk Factors to Platelet Aggregation (Table 3)
In the model for epinephrine-induced aggregation, sex accounted for 2.7% of the variance (P<0.0001), triglyceride 1.1% (P<0.0001), GP IIIa genotype 0.7% (P=0.007), and age 0.5% (P=0.08). The remaining variables contributed <0.2% each.

View this table: [in this window] [in a new window]   Table 3. Contribution of Genetic and Traditional Risk Factors to Platelet Aggregation

In the model for ADP-induced aggregation, sex accounted for 3.1% of the variance (P<0.0001), age 0.9% (P=0.003), triglyceride 0.8% (P=0.0006), HDL-cholesterol 0.5% (P=0.006), hormone replacement therapy 0.3% (P=0.03), and GP IIIa genotype 0.2% (P=0.21). The remaining variables contributed <0.2% each.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In the Framingham Offspring Study, the presence of 1 or 2 Pl^A2 alleles of the platelet GP IIIa receptor was associated with an incrementally lower platelet threshold concentration in response to epinephrine and a trend toward lower threshold concentration in response to ADP. The increase in aggregability induced by epinephrine remained highly significant after adjustment for covariates. For epinephrine-induced aggregation, GPIIIa genotype explained 0.7% of the variance, while age, sex, and triglyceride accounted for an additional 4.3% of the variance.

GP IIIa Polymorphism and CVD
The familial clustering of coronary heart disease and the presence of a higher concordance in mortality among monozygotic twins compared with dizygotic twins suggest an important pathogenic role for genetic factors.²⁴ Although a small proportion of coronary heart disease can be attributed to single gene defects (eg, familial hypercholesterolemia or homocystinuria), the nature of additional contributing genetic factors remains largely unknown. Because platelets play a central role in the pathogenesis of acute CVD, it is possible that inherited platelet variants may contribute to CVD risk. Knowledge of such variants and their phenotypic expression may lead to progress in coronary disease risk assessment and therapeutic intervention.

Weiss and colleagues⁷ showed that patients with acute coronary syndromes were more likely than were controls to carry the Pl^A2 allele. In their study, the prevalence of the Pl^A2 allele was 2.1 times higher in the patients than among the controls. These findings, coupled with an anecdotal report about the sudden death of a 28-year-old Olympic skater who had severe coronary artery disease and carried the Pl^A2 allele, but no other traditional risk factors, resulted in the Pl^A1/Pl^A2 dimorphism receiving widespread attention.²⁵ Further studies of this genetic marker are warranted because, although there has been some support for the findings of Weiss et al,^{9 26} results from several other groups found no association between the Pl^A2 allele and CVD, including an analysis by Ridker et al of the Physicians' Health Study.^{10 11 12 13 14 15}

GP IIIa Polymorphism and Platelet Aggregability
Platelet GP IIb/IIIa is the most abundant platelet receptor, with an estimated 50 000 copies per cell.²⁷ It is present in the platelet membrane as a heterodimeric complex whose formation requires the presence of divalent cations. The receptor is highly polymorphic and has long been recognized as having alloantigens.²⁸ Pl^A alloantigens have been most frequently considered for their role in syndromes of immune-mediated platelet destruction, such as post-transfusion purpura and neonatal alloimmune thrombocytopenic purpura.²⁸ Newman and colleagues¹⁸ identified the molecular basis of this polymorphism. The Pl^A1-allotype carries a leucine at position 33 of glycoprotein IIIa whereas the Pl^A2-allotype has a proline at position 33, because of a thymidine to cytosine substitution at 1565 in exon 2 of the glycoprotein IIIa gene.

The functional influence of the GP IIIa polymorphism on platelet reactivity is largely unknown. Using epinephrine as a platelet agonist, we found that the presence of the Pl^A2 allele was associated with heightened platelet aggregability. Furthermore, the Pl^A2-associated increase in aggregability remained significant after adjustment for traditional risk factors that could influence platelet aggregability. The effect of the GP IIIa polymorphism on epinephrine-induced aggregation is in accordance with an additive model, with threshold concentration decreased by 19% per "dose" of Pl^A2 allele (35% for Pl^A2 homozygous) as compared with the Pl^A1 homozygote. Using multiple regression analysis, we found that the polymorphism explained a small, but significant, percentage of variance of aggregability induced by epinephrine.

The platelet Pl^A antigen system is not in the 2 putative RGD sequence binding regions of GP IIIa, which are located within residues 107 to 179 and 211 to 222 from the amino terminal, respectively.^{29 30} However, according to Calvete,³¹ the Leu33/Pro33 polymorphism is enclosed within a small 13–amino acid loop formed by the pairing of Cys26 with Cys38. In addition, a long-range disulfide bond linking Cys5 and Cys435 has been identified which could bring the amino-terminal region of IIIa, including the small loop that contains the Pl^A polymorphic residue, into immediate proximity with the binding regions of IIIa.^{29 30} Because of proline's unique structure, proline substitutions are well recognized for their propensity to induce conformational changes. Such changes can create alloantigenic determinants recognizable by T cells and B cells and induce the production of antibody.³² The conformational changes could also influence activation of the GP IIb/IIIa receptor and alter platelet aggregability. Equally possible, the Pl^A polymorphism may be in linkage disequilibrium with other as yet undefined molecular variants of the gene that influence platelet reactivity.

Goldschmidt-Clermont and colleagues³³ quantitated fibrinogen binding to platelets of different allotypes. The investigators found that platelets with the Pl^A2 allele bound significantly less fibrinogen than did platelets that were homozygous for Pl^A1. Differences in methodology used to evaluate platelet reactivity in the study make it difficult to compare with our data. Additional larger and more comprehensive investigations will be required to resolve the issue. In a recent study, Cooke et al³⁴ found that platelets with the Pl^A2 allele were more sensitive to aspirin inhibition.

Finally, we studied the relationship between the Pl^A polymorphism and an intermediate phenotype (ie, platelet aggregability), rather than coronary heart disease. Although it has not been demonstrated that epinephrine-induced platelet aggregation is an independent risk factor for coronary heart disease, there is considerable evidence linking platelet reactivity to CVD.^{35 36 37} In the Framingham Heart Study, we will prospectively follow the population to determine whether epinephrine-induced platelet aggregability and the Pl^A2 allele are risk factors for CVD.

Limitations of the study
First, our analysis was based on a single measurement of platelet aggregation. However, any random variation or misclassification would introduce bias that favors the null hypothesis and an underestimation of the genetic contribution to platelet aggregability. Additional measures of platelet function should be evaluated in future studies. Second, our analysis was based on the subset of Framingham subjects in whom both genotype and phenotype data were available. However, the genotype distribution was similar between subjects excluded from analysis and those included in the present analysis. Third, a dimorphic marker was used for linkage analysis. Although not statistically significant, the results of the linkage analysis are consistent with the findings for the association studies as indicated by the negative slope of the regression line. The failure to reach statistical significance is not surprising. Because of the limited informativity of the marker used (heterozygosity index=0.27), and the limited extent to which parental (ie, identity by descent) information was available, we had limited power to detect a statistically significant linkage. In future studies, a more informative marker should be used for linkage analysis. Finally, we used platelet aggregability to evaluate the relation between the Pl^A polymorphism and platelet function. Although platelet aggregation studies in platelet-rich plasma can assess the effect of platelet inhibitors such as aspirin, the in vivo correlates and clinical significance of changes in platelet aggregation need to be defined more fully.

Implications of the Study
We found that the Pl^A2 allele was associated with increased platelet aggregability in the Framingham Offspring Study. Our results support the hypothesis that Pl^A2 might be a genetic risk factor for CVD,^{7 8 9} and provide a mechanism for the link. Because epinephrine-induced aggregation was increased with the Pl^A2 allele, and because increased aggregability has been described after assumption of an upright posture³⁵ and strenuous exercise,³⁸ it would be of interest to determine whether subjects with different Pl^A alleles react differently to strenuous exercise. Such a study may not only provide additional insights into the mechanism by which strenuous exercise triggers the onset of cardiovascular events,³⁹ but may also help in selecting individuals for appropriate preventive therapy. In addition, further prospective studies are needed to test if this genetic marker is an independent risk factor for CVD. If individuals with the Pl^A2 allele have a higher incidence of CVD, they may benefit from more aggressive measures for prevention and treatment of CVD, including therapy with antiplatelet agents such as GP IIb/IIIa receptor antagonists.

	Acknowledgments

 
This study was supported by NIH/NHLBI No1-38038 to Dr. Tofler and by Research Development Award K04-HL-03138-01 from the National Heart, Lung, and Blood Institute to Dr. Lindpaintner. Linkage analysis was performed using S.A.G.E., which is supported by a USPHS Resource Grant (1P41 RR03655) from the National Center for Research Resources.

Received September 18, 1998; accepted November 3, 1998.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Davies MJ, Richardson PD, Woolf N, Katz DR, Mann J. Risk of thrombosis in human atherosclerotic plaques: role of extracellular lipid, macrophage, and smooth muscle cell content. Br Heart J. 1993;69:377–381.[Abstract/Free Full Text]
2. DeWood MA, Spores J, Notske R, Mouser LT, Burroughs R, Golden MS, Lang HT. Prevalence of total coronary occlusion during the early hours of transmural myocardial infarction. N Engl J Med. 1980;303:897–902.[Abstract]
3. Topol EJ, Califf RM, Weisman HF, Ellis SG, Tcheng JE, Worley S, Ivanhoe R, George BS, Fintel D, Weston M, Sigmon K, Anderson KL, Lee KL, Willerson TJ. Randomized trial of coronary intervention with antibody against platelet IIb/IIIa integrin for reduction of clinical restenosis: results at six months. The EPIC Investigators. Lancet. 1994;343:881–886.[Medline] [Order article via Infotrieve]
4. Simoons ML, de Boer MJ, van den Brand MJ, van Miltenburg AJ, Hoorntje JC, Heyndrickx GR, van der Wieken LR, de Bono D, Rutsch W, Schaible TF, Weisman HF, Klootwijk P, Nijssen KM, Stibbe J, de Feyter PJ. Randomized trial of a GPIIb/IIIa platelet receptor blocker in refractory unstable angina. European Cooperative Study Group. Circulation. 1994;89:596–603.[Abstract/Free Full Text]
5. Tcheng JE, Harrington RA, Kottke-Marchant K, Kleiman NS, Ellis SG, Kereiakes DJ, Mick MJ, Navetta FI, Smith JE, Worley SJ, Miller JA, Joseph DM, Sigmon KN, Kitt MM, du Mee CP, Califf RM, Topol EJ. Multicenter, randomized, double-blind, placebo-controlled trial of the platelet integrin glycoprotein IIb/IIIa blocker Integrelin in elective coronary intervention. IMPACT Investigators. Circulation. 1995;91:2151–2157.[Abstract/Free Full Text]
6. Kleiman NS, Ohman EM, Califf RM, George BS, Kereiakes D, Aguirre FV, Weisman H, Schaible T, Topol EJ. Profound inhibition of platelet aggregation with monoclonal antibody 7E3 Fab after thrombolytic therapy. Results of the Thrombolysis and Angioplasty in Myocardial Infarction (TAMI) 8 Pilot Study. J Am Coll Cardiol. 1993;22:381–389.[Abstract]
7. Weiss EJ, Bray PF, Tayback M, Schulman SP, Kickler TS, Becker LC, Weiss JL, Gerstenblith G, Goldschmidt-Clermont PJ. A polymorphism of a platelet glycoprotein receptor as an inherited risk factor for coronary thrombosis. N Engl J Med. 1996;334:1090–1094.[Abstract/Free Full Text]
8. Walter D, Schachinger V, Elsner M, Dimmeler S, Zeiher A. Platelet glycoprotein IIIa polymorphisms and risk of coronary stent thrombosis. Lancet. 1997;350:1217–1219.[Medline] [Order article via Infotrieve]
9. Carter AM, Ossei-Gerning N, Wilson IJ, Grant P, J. Association of the Platelet PlA Polymorphism of Glycoprotein IIb/IIIa and the Fibrinogen Bb 448 Polymorphism with Myocardial Infarction and Extent of Coronary Artery Disease. Circulation. 1997;96:1424–1431.[Abstract/Free Full Text]
10. Ridker PM, Hennekens CH, Schmitz C, Stampfer MJ, Lindpaintner K. PIA1/A2 polymorphism of platelet glycoprotein IIIa and risks of myocardial infarction, stroke, and venous thrombosis. Lancet. 1997;349:385–388.[Medline] [Order article via Infotrieve]
11. Marian AJ, Brugada R, Kleiman NS. Platelet glycoprotein IIIa PlA polymorphism and myocardial infarction. N Engl J Med. 1996;335:1071–1072.[Free Full Text]
12. Osborn SV, Hampton KK, Smillie D, Channer KS, Daly ME. Platelet glycoprotein IIIa gene polymorphism and myocardial infarction. Lancet. 1996;348:1309–1310.[Medline] [Order article via Infotrieve]
13. Herrmann SM, Poirier O, Marques-Vidal P, Evans A, Arveiler D, Luc G, Emmerich J, Cambien F. The Leu33/Pro polymorphism (PlA1/PlA2) of the glycoprotein IIIa (GPIIIa) receptor is not related to myocardial infarction in the ECTIM Study. Etude Cas-Temoins de l'Infarctus du Myocarde. Thromb Haemost. 1997;77:1179–1181.[Medline] [Order article via Infotrieve]
14. Carlsson LE, Greinacher A, Spitzer C, Walther R, Kessler C. Polymorphisms of the human platelet antigens HPA-1, HPA-2, HPA-3, and HPA-5 on the platelet receptors for fibrinogen (GPIIb/IIIa), von Willebrand factor (GPIb/IX), and collagen (GPIa/IIa) are not correlated with an increased risk for stroke. Stroke. 1997;28:1392–1395.[Abstract/Free Full Text]
15. Samani NJ, Lodwick D. Glycoprotein IIIa polymorphism and risk of myocardial infarction. Cardiovasc Res. 1997;33:693–697.[Abstract/Free Full Text]
16. Kannel W, Feinleib M, McNamara J, Garrison R, Castelli W. An investigation of coronary heart disease in families: the Framingham Offspring Study. Am J Epidemiol. 1979;110:281–290.[Abstract/Free Full Text]
17. Born G. Aggregation of platelet by adenosine diphosphate and its reversal. Nature. 1964;194:927–929.
18. Newman PJ, Derbes RS, Aster RH. The human platelet alloantigens, PlA1 and PlA2, are associated with a leucine33/proline33 amino acid polymorphism in membrane glycoprotein IIIa, and are distinguishable by DNA typing. J Clin Invest. 1989;83:1778–1781.
19. Kleinbaum DG, Kupper LL, Muller KE. Applied Regression Analysis and Other Multivariable Methods. Second ed. Boston, MA: PWS-Kent Publishing Company; 1988:102–340.
20. SAS Institute Inc. GLM Procedure, and REG Procedure. In: SAS/STAT Software: Changes and Enhancements through Release 6.11. Cary, NC: SAS Institute, Inc; 1996:317–324.
21. Liang KY, Zeger SL. Longitudinal data analysis using generalized estimating linear models. Biometrika. 1986;73:12–22.
22. Bishop D, Williamson J. The power of identity-by-state methods for linkage analysis. Am J Hum Genet. 1990;46:254–265.[Medline] [Order article via Infotrieve]
23. The Case Western Reserve University, Cleveland, OH. S. A. G. E. Statistical Analysis for Genetic Epidemiology. Release 2.2. 1996.
24. Marenberg ME, Risch N, Berkman LF, Floderus B, de Faire U. Genetic susceptibility to death from coronary heart disease in a study of twins. N Engl J Med. 1994;330:1041–1046.[Abstract/Free Full Text]
25. Goldschmidt-Clermont PJ, Shear WS, Schwartzberg J, Varga CF, Bray PF. Clues to the death of an Olympic champion. Lancet. 1996;347:1833.
26. Carter AM, Ossei-Gerning N, Grant PJ. Platelet glycoprotein IIIa PlA polymorphism and myocardial infarction. N Engl J Med. 1996;335:1072–1073.
27. Isenberg W, McEver R, Phillips D, Shuman M, Bainton D. The platelet fibrinogen receptor: an immunogold-surface replica study of agonist-induced ligand binding and receptor clustering. J Cell Biol. 1987;104:1655–1663.[Abstract/Free Full Text]
28. Kunicki T, Newman P. The molecular immunology of human platelet proteins. Blood. 1992;80:1386–1404.[Free Full Text]
29. D'Souza SE, Ginsberg MH, Burke TA, Lam SC, Plow EF. Localization of an Arg-Gly-Asp recognition site within an integrin adhesion receptor. Science. 1988;242:91–93.[Abstract/Free Full Text]
30. Charo IF, Nannizzi L, Phillips DR, Hsu MA, Scarborough RM. Inhibition of fibrinogen binding to GP IIb-IIIa by a GP IIIa peptide. J Biol Chem. 1991;266:1415–1421.[Abstract/Free Full Text]
31. Calvete JJ, Henschen A, Gonzalez-Rodriguez J. Assignment of disulphide bonds in human platelet GPIIIa: a disulphide pattern for the beta-subunits of the integrin family. Biochem J. 1991;274:63–71.
32. Maslanka K, Yassai M, Gorski J. Molecular identification of T cell that respond in a primary bulk culture to a peptide derived from a platelet glycoprotein implicated in neonatal alloimmune thrombocytopenia. J Clin Invest. 1996;98:1802–1808.[Medline] [Order article via Infotrieve]
33. Goldschmidt-Clermont P, Weiss E, Shear W, Kennedy S, Kickler T, Becker L, Bray D. Platelets from PLA2 (-) individuals bind more exogenous fibrinogen than platelet from PLA2 (+) individuals. Blood. 1996;88:26a.
34. Cooke GE, Bray PF, Hamlington JD, Pham DM, Goldschmidt-Clermont PJ. PLA2 polymorphism and efficacy of aspirin. Lancet. 1998;351:1253.[Medline] [Order article via Infotrieve]
35. Tofler GH, Brezinski D, Schafer AI, Czeisler CA, Rutherford JD, Willich SN, Gleason RE, Williams GH, Muller JE. Concurrent morning increase in platelet aggregability and the risk of myocardial infarction and sudden cardiac death. N Engl J Med. 1987;316:1514–1518.[Abstract]
36. The RISC Group. Risk of myocardial infarction and death during treatment with low dose aspirin and intravenous heparin in men with unstable coronary artery disease. Lancet. 1990;336:827–830.[Medline] [Order article via Infotrieve]
37. Trip MD, Manger Cats V, van Capelle FJL, Vreeken J. Platelet hyperreactivity and prognosis in survivors of myocardial infarction. N Engl J Med. 1990;322:1549–1554.[Abstract]
38. Winther K, Hillegass W, Tofler GH, Jimenez A, Brezinski DA, Schafer AI, Loscalzo J, Williams GH, Muller JE. Effects on platelet aggregation and fibrinolytic activity during upright posture and exercise in healthy men. Am J Cardiol. 1992;70:1051–1055.[Medline] [Order article via Infotrieve]
39. Mittleman MA, Maclure M, Tofler GH, Sherwood JB, Goldberg RJ, Muller JE. Triggering of acute myocardial infarction by heavy physical exertion. Protection against triggering by regular exertion. Determinants of Myocardial Infarction Onset Study Investigators. N Engl J Med. 1993;329:1677–1683.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. E. Herrera-Galeano, D. M. Becker, A. F. Wilson, L. R. Yanek, P. Bray, D. Vaidya, N. Faraday, and L. C. Becker A Novel Variant in the Platelet Endothelial Aggregation Receptor-1 Gene Is Associated With Increased Platelet Aggregability Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1484 - 1490. [Abstract] [Full Text] [PDF]

				J. R. Cerhan, S. M. Ansell, Z. S. Fredericksen, N. E. Kay, M. Liebow, T. G. Call, A. Dogan, J. M. Cunningham, A. H. Wang, W. Liu-Mares, et al. Genetic variation in 1253 immune and inflammation genes and risk of non-Hodgkin lymphoma Blood, December 15, 2007; 110(13): 4455 - 4463. [Abstract] [Full Text] [PDF]

				A. Undas, K. E. Brummel-Ziedins, and K. G. Mann Antithrombotic properties of aspirin and resistance to aspirin: beyond strictly antiplatelet actions Blood, March 15, 2007; 109(6): 2285 - 2292. [Abstract] [Full Text] [PDF]

				P. F. Bray, T. D. Howard, E. Vittinghoff, D. C. Sane, and D. M. Herrington Effect of genetic variations in platelet glycoproteins Ib{alpha} and VI on the risk for coronary heart disease events in postmenopausal women taking hormone therapy Blood, March 1, 2007; 109(5): 1862 - 1869. [Abstract] [Full Text] [PDF]

				E. Lim, S. Carballo, J. Cornelissen, Z. A. Ali, R. Grignani, S. Bellm, and S. Large Dose-Related Efficacy of Aspirin After Coronary Surgery in Patients With PlA2 Polymorphism (NCT00262275) Ann. Thorac. Surg., January 1, 2007; 83(1): 134 - 138. [Abstract] [Full Text] [PDF]

				C. D. Bushnell, P. Hurn, C. Colton, V. M. Miller, G. del Zoppo, M. S.V. Elkind, B. Stern, D. Herrington, G. Ford-Lynch, P. Gorelick, et al. Advancing the Study of Stroke in Women: Summary and Recommendations for Future Research From an NINDS-Sponsored Multidisciplinary Working Group Stroke, September 1, 2006; 37(9): 2387 - 2399. [Abstract] [Full Text] [PDF]

				K. V. Vijayan and P. F. Bray Molecular Mechanisms of Prothrombotic Risk Due to Genetic Variations in Platelet Genes: Enhanced Outside-In Signaling Through the Pro33 Variant of Integrin {beta}3. Experimental Biology and Medicine, May 1, 2006; 231(5): 505 - 513. [Abstract] [Full Text] [PDF]

				P. Kubisz, J. Ivankova, P. Holly, J. Stasko, and J. Musia/l The Glycoprotein IIIa PLA1/A2 Polymorphism--A Defect Responsible for the Sticky Platelet Syndrome? Clinical and Applied Thrombosis/Hemostasis, January 1, 2006; 12(1): 117 - 119. [PDF]

				S E Bojesen, S K Kjaer, E V S Hogdall, B L Thomsen, C K Hogdall, J Blaakaer, A Tybjaerg-Hansen, and B G Nordestgaard Increased risk of ovarian cancer in integrin {beta}3 Leu33Pro homozygotes Endocr. Relat. Cancer, December 1, 2005; 12(4): 945 - 952. [Abstract] [Full Text] [PDF]

				D. L. Yee, C. W. Sun, A. L. Bergeron, J.-f. Dong, and P. F. Bray Aggregometry detects platelet hyperreactivity in healthy individuals Blood, October 15, 2005; 106(8): 2723 - 2729. [Abstract] [Full Text] [PDF]

				L. A. Weiss, L. A. Lester, J. E. Gern, R. L. Wolf, R. Parry, R. F. Lemanske, J. Solway, and C. Ober Variation in ITGB3 Is Associated with Asthma and Sensitization to Mold Allergen in Four Populations Am. J. Respir. Crit. Care Med., July 1, 2005; 172(1): 67 - 73. [Abstract] [Full Text] [PDF]

				K. V. Vijayan, Y. Liu, W. Sun, M. Ito, and P. F. Bray The Pro33 Isoform of Integrin {beta}3 Enhances Outside-in Signaling in Human Platelets by Regulating the Activation of Serine/Threonine Phosphatases J. Biol. Chem., June 10, 2005; 280(23): 21756 - 21762. [Abstract] [Full Text] [PDF]

				E. Papp, V. Havasi, J. Bene, K. Komlosi, L. Czopf, E. Magyar, C. Feher, G. Feher, B. Horvath, Z. Marton, et al. Glycoprotein IIIA Gene (PlA) Polymorphism and Aspirin Resistance: Is There Any Correlation? Ann. Pharmacother., June 1, 2005; 39(6): 1013 - 1018. [Abstract] [Full Text] [PDF]

				J. Mikkelsson, M. Perola, and P. J. Karhunen Genetics of Platelet Glycoprotein Receptors: Risk of Thrombotic Events and Pharmacogenetic Implications Clinical and Applied Thrombosis/Hemostasis, April 1, 2005; 11(2): 113 - 125. [Abstract] [PDF]

				C. S. Fox, M. G. Larson, D. Corey, D. Feng, K. Lindpaintner, J. F. Polak, P. A. Wolf, R. B. D'Agostino, G. H. Tofler, and C. J. O'Donnell Absence of Association Between Polymorphisms in the Hemostatic Factor Pathway Genes and Carotid Intimal Medial Thickness: The Framingham Heart Study Stroke, March 1, 2004; 35 (3): e65 - e67. [Abstract] [Full Text] [PDF]

				R. D. McBane II Genetically Determined Procoagulant States and Heparin Use Seminars in Cardiothoracic and Vascular Anesthesia, December 1, 2003; 7(4): 427 - 442. [Abstract] [PDF]

				P. Fontana, A. Dupont, S. Gandrille, C. Bachelot-Loza, J.-L. Reny, M. Aiach, and P. Gaussem Adenosine Diphosphate-Induced Platelet Aggregation Is Associated With P2Y12 Gene Sequence Variations in Healthy Subjects Circulation, August 26, 2003; 108(8): 989 - 995. [Abstract] [Full Text] [PDF]

				S. E. Bojesen, K. Juul, P. Schnohr, A. Tybjaerg-Hansen, and B.o. G. Nordestgaard Platelet glycoprotein IIb/IIIa PlA2/PlA2 homozygosity associated with risk of ischemic cardiovascular disease and myocardial infarction in young men: The Copenhagen City Heart Study J. Am. Coll. Cardiol., August 20, 2003; 42(4): 661 - 667. [Abstract] [Full Text] [PDF]

				S. E. Bojesen, A. Tybjaerg-Hansen, and B. G. Nordestgaard Integrin {beta}3 Leu33Pro Homozygosity and Risk of Cancer J Natl Cancer Inst, August 6, 2003; 95(15): 1150 - 1157. [Abstract] [Full Text] [PDF]

				K. V. Vijayan, Y. Liu, J.-F. Dong, and P. F. Bray Enhanced Activation of Mitogen-activated Protein Kinase and Myosin Light Chain Kinase by the Pro33 Polymorphism of Integrin beta 3 J. Biol. Chem., January 31, 2003; 278(6): 3860 - 3867. [Abstract] [Full Text] [PDF]

				M. Sajid, K. V. Vijayan, S. Souza, and P. F. Bray PlA Polymorphism of Integrin {beta}3 Differentially Modulates Cellular Migration on Extracellular Matrix Proteins Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 1984 - 1989. [Abstract] [Full Text] [PDF]

				L. Pontiggia, R. Lassila, S. Pederiva, H.-R. Schmid, M. Burger, and J. H. Beer Increased Platelet-Collagen Interaction Associated With Double Homozygosity for Receptor Polymorphisms of Platelet GPIa and GPIIIa Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2093 - 2098. [Abstract] [Full Text] [PDF]

				J. B. Braunstein, D. W. Kershner, P. Bray, G. Gerstenblith, S. P. Schulman, W. S. Post, and R. S. Blumenthal Interaction of Hemostatic Genetics With Hormone Therapy : New Insights To Explain Arterial Thrombosis in Postmenopausal Women Chest, March 1, 2002; 121(3): 906 - 920. [Abstract] [Full Text] [PDF]