© 1999 American Heart Association, Inc.
Original Contributions |
Expression of Interleukin-10 in Advanced Human Atherosclerotic Plaques
Relation to Inducible Nitric Oxide Synthase Expression and Cell Death
From the Institut National de la Santé et de la Recherche Médicale, IFR "Circulation Lariboisière," INSERM U 141 (Z.M., A.T.) and INSERM U 127 (C.H.), Hôpital Lariboisière, Paris, and the Service de Chirurgie Thoracique et Vasculaire (J.O., G.L.), Hôpital Beaujon, Clichy, France; and the Department of Clinical and Experimental Medicine (E.F.), University of Padova, Padova, Italy.
Correspondence to Alain Tedgui, PhD, INSERM U 141, 41 boulevard de la Chapelle, 75475 Paris Cedex 10, France.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Inflammation is a major feature of human atherosclerosis and is central to development and progression of the disease. A variety of proinflammatory cytokines are expressed in the atherosclerotic plaque and may modulate extracellular matrix remodeling, cell proliferation, and cell death. Little is known, however, about the expression and potential role of anti-inflammatory cytokines in human atherosclerosis. Interleukin-10 (IL-10) is a major anti-inflammatory cytokine whose expression and potential effects in advanced human atherosclerotic plaques have not been evaluated. We studied 21 advanced human atherosclerotic plaques. IL-10 expression was analyzed by use of reverse transcription–polymerase chain reaction and immunohistochemical techniques. Inducible nitric oxide synthase expression was assessed by using immunohistochemistry, and cell death was determined by use of the TUNEL method. Reverse transcription–polymerase chain reaction identified IL-10 mRNA in 12 of 17 atherosclerotic plaques. Immunohistochemical staining of serial sections and double staining identified immunoreactive IL-10 mainly in macrophages, as well as in smooth muscle cells. Consistent with its anti-inflammatory properties, high levels of IL-10 expression were associated with significant decrease in inducible nitric oxide synthase expression (P<0.0001) and cell death (P<0.0001). Hence, IL-10, a potent anti-inflammatory cytokine, is expressed in a substantial number of advanced human atherosclerotic plaques and might contribute to the modulation of the local inflammatory response and protect from excessive cell death in the plaque.
Key Words: interleukin-10 • atherosclerotic plaque • cytokines • inflammation
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Avariety of proinflammatory cytokines, including tumor necrosis factor-
, interleukin (IL)-1ß, IL-6, and
interferon-
,1 2 3 4 5 are expressed in the human
atherosclerotic plaque. These cytokines alone or in conjunction
contribute to the local inflammatory response and may have great impact
on plaque formation and progression.6 Indeed,
proinflammatory cytokines have the potential to induce
excessive extracellular matrix degradation and cell death promoting
plaque instability.7 However, the inflammatory response is
known to be balanced by anti-inflammatory cytokines, including
IL-10.8 We therefore hypothesized that this may occur
within the plaque. Hitherto, little is known about the expression and
potential role of anti-inflammatory cytokines in human
atherosclerosis. Among the anti-inflammatory
cytokines, IL-10 is produced by Th2 cells as well as by
macrophages8 and has potent deactivating
properties on these cells.9 Because macrophages
and T-lymphocytes are involved in human atherogenesis, we hypothesized
that IL-10 may be produced locally in the plaque and may protect from
an excessive proinflammatory response and cell damage in the plaque. To
test this hypothesis, we analyzed the expression and
localization of IL-10 in advanced human atherosclerotic plaques and
examined its relation to inducible nitric oxide synthase (iNOS)
expression, a reliable marker of the proinflammatory response, and to
cell death. |
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Materials
Twenty-one human atherosclerotic plaques removed from 18 patients undergoing carotid endarterectomy and 3 patients undergoing resection of an abdominal aortic aneurysm were collected. For controls, 4 carotid arteries free of atherosclerosis (1 with minimal fibromuscular thickening) were obtained at autopsy and 3 internal mammary arteries were obtained during coronary bypass surgery. A segment from the most stenotic area of each arterial specimen was immediately placed for 2 hours in fresh 4% paraformaldehyde, then transferred to a 30% sucrose–PBS solution before being snap-frozen in optimal cutting temperature tissue processing medium (O.C.T. Compound, Miles Inc, Diagnostics Division) with liquid nitrogen and stored at -80°C for cryostat sectioning. Several 5- to 6-µm sections were obtained from each specimen for histological analysis, immunohistochemical studies, and in situ detection of apoptosis. Fresh, unfixed material was used for protein, RNA, and DNA extraction.
Total RNA Extraction and Reverse Transcription–Polymerase Chain
Reaction to Detect IL-10 mRNA
Total RNA was extracted from 17 atherosclerotic plaques by use
of TriZOL reagent according to the manufacturer's instructions (Life
Technologies, Inc). The purified RNA was dissolved in water and the
concentration measured by absorbance at 260 nm. The antisense primer
for reverse transcription–polymerase chain reaction (RT-PCR) was
5'AAGCTGAGAACCAAGACCCAGACATCAAGGCG3' (nucleotides
615 to 647 of the coding sequence) and the sense primer was
5'AGCTATCCCAGAGCCCCAGATCCGATTTTGG3' (nucleotides 320 to 351
of the coding sequence), resulting in a 328-bp amplification
product. The oligonucleotides were obtained from
Clontech Laboratories. For RT reaction, 200 U of Moloney murine
leukemia virus reverse transcriptase (Life Technologies, Inc) was used
to synthesize (39°C, 90 minutes) single-stranded DNA from 1 µg of
total RNA. The reaction was performed in 20 µL of a mixture
containing 1 µmol/L of the reverse primer, 50 mmol/L
Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L
MgCl2, 0.5 mmol/L dNTP, 3 mmol/L DTT,
and 50 U RNase inhibitor (Promega). The reaction was
stopped by heating samples for 10 minutes at 70°C. PCR amplification
of the resulting cDNA was performed in a total volume of 100 µL
containing 0.2 µmol/L of the sense primer, 1x PCR buffer
(10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2,
and 50 mmol/L KCl), 0.3 mmol/L dNTP, 2 mmol/L DTT, and
2.5 U Taq DNA polymerase (Boehringer Mannheim). The mixture was
overlaid with 1 drop of mineral oil and the amplification was performed
as follows: denaturation at 95°C for 45 seconds, annealing at 60°C
for 45 seconds, and extension at 72°C for 2 minutes for 30 cycles.
Twenty microliters of the RT-PCR mixtures was electrophoresed in 2%
agarose gel.
Western Blot Analysis
Proteins were extracted from 6 atherosclerotic plaques.
Frozen plaques were pulverized under liquid nitrogen. The powders were
resuspended in ice-cold lysis buffer [20 mmol/L Tris-HCl, pH 7.5,
5 mmol/L EGTA, 150 mmol/L NaCl, 20 mmol/L
glycerophosphate, 10 mmol/L NaF, 1 mmol/L sodium
orthovanadate, 1% Triton X-100, 0.1% Tween 20, 1 µg/mL aprotinin,
1 mmol/L PMSF, 0.5 mmol/L
N-tosyl-L-phenylalanine chloromethyl
ketone (TPCK), 0.5 mmol/L
N(a)-p-tosyl-L-lysine
chloromethyl ketone (TLCK)] at a ratio of 0.3 mL/10 mg of wet weight.
Extracts were incubated on ice for 15 minutes and then
centrifuged (12 000g, 15 minutes, 4°C). The
detergent-soluble supernatant fractions were retained, and protein
concentrations in samples were equalized by using a Bio-Rad protein
assay; 70 µL of Laemmli sample buffer was added to 100-µL aliquots,
samples were boiled for 3 minutes and loaded on a 12%
SDS-polyacrylamide gel. Proteins were electrophoretically
transferred from polyacrylamide gels onto nitrocellulose.
Nitrocellulose membranes were saturated for 2 hours at room temperature
in TBST [50 mmol/L Tris-HCl (pH 7.5), 250 mmol/L NaCl, and
0.1% Tween saline] containing 5% of fat-free dry milk. Goat
polyclonal antibodies to human IL-10 (R & D Systems Europe Ltd) were
used at a concentration of 1 µg/mL. Following incubation with
anti-goat HRP conjugated antibodies (Sigma), chemiluminescence
substrates (ECL, Western blotting; Amersham Corp) were used to
reveal positive bands according to the manufacturer's instructions,
and bands were visualized after exposure to Hyperfilm ECL (Amersham
Corp).
Immunohistochemistry
Frozen sections were incubated with 1:10 normal horse serum or
1:10 normal goat serum for 30 minutes at room temperature, washed once
in PBS, then incubated with either a primary mouse monoclonal antibody
against CD68 for macrophage identification (DAKO-CD68, KP1), or
a primary mouse monoclonal antibody against human smooth muscle
-actin (HHF35, DAKO) for identification of smooth muscle cells.
These antibodies were used at a dilution of 1:200. To identify IL-10
within atherosclerotic plaques, a specific goat polyclonal antibody (R
& D Systems Europe Ltd) was used at a dilution of 10 µg/mL. iNOS was
detected by using a specific rabbit polyclonal antibody (Biomol) at a
dilution of 1:500. After washing in PBS, the slides were incubated with
the following secondary biotinylated antibodies: a biotinylated horse
anti-mouse IgG (Vector Laboratories, Inc) at a dilution of 1:200 for
detection of stains with antibodies against CD68 and smooth muscle
-actin, a biotinylated horse anti-goat IgG (Vector) at a dilution of
1:200 for detection of anti-IL-10 antibody, and a biotinylated goat
anti-rabbit IgG (Vector) at a dilution of 1:200 for detection of
anti-iNOS antibody. Immunostains were visualized with the
use of avidin–biotin HRP (brown staining) or alkaline phosphatase (red
color) visualization systems (Vectastain ABC kit PK-6100 and
AK-5000 Vector). For negative controls, adjacent sections were stained
with isotype-matched irrelevant antibodies instead of the primary
antibodies.
In Situ Detection of Apoptotic Cell Death
In situ detection of apoptotic cells, using the terminal
deoxynucleotidyl transferase (TdT)-mediated dUTP
nick end-labeling (TUNEL) method of fragmented DNA was performed on
cryostat sections as previously described.10 It is
noteworthy that prefixation time was abrogated and treatment of
sections with proteinase K was omitted and that has recently been shown
to enhance the specificity of the staining.11 Negative
controls for TUNEL labeling were obtained after omission of the enzyme
TdT.
Relation Between IL-10 Expression, iNOS Expression, and TUNEL
Labeling
Twenty-one plaques were analyzed. From each plaque, at
least 10 adjacent serial sections were examined after staining for
IL-10, iNOS, or TUNEL. To evaluate the relation between IL-10
expression, iNOS expression, and TUNEL labeling, we performed
semiquantitative and quantitative analyses.
For semiquantitative analysis, areas with positivity for IL-10, iNOS, or TUNEL were first identified at low magnification (x100 and x200) over all the sections. We then analyzed 500 microscopic fields (x400) that showed positivity for at least 1 of the 3 stainings (IL-10, iNOS, or TUNEL) (almost 90% of the positive fields) and discarded those fields that were acellular or negative for all 3 stainings (748 fields). Cell counting was performed by 2 investigators (Z.M. and A.T.) who obtained similar results. The level of IL-10 expression in these fields was graded as follows: 0 (no staining), + (<10% staining), ++ (10% to 50% staining), or +++ (>50% staining). We then determined the distribution of iNOS expression and TUNEL labeling in the corresponding serial fields. Fields were considered positive for iNOS or TUNEL when at least 5 cells per field stained positive.
For quantitative analysis, double staining was performed on 52 sections from 9 of the 21 plaques. Percentages of IL-10–positive, iNOS-positive, or TUNEL-positive cells were first determined (the total number of cells counted in each section varied between 800 and 5000 cells). Then, the percentages of iNOS-positive or TUNEL-positive cells among IL-10–positive cells were calculated.
Statistical Analysis
Results are expressed as mean±SEM values. Semiquantitative
analysis of the effect of IL-10 on iNOS expression and TUNEL
labeling was performed by using a 
2 test.
Quantitative analysis of the effect of IL-10 on iNOS expression
and TUNEL labeling was performed by comparing the conditional
probability of iNOS expression or TUNEL labeling given that cells were
positive for IL-10, with the probability of iNOS expression or TUNEL
labeling in all cells by use of a t test.
P<0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Detection of IL-10 in Human Atherosclerotic Plaques
We detected IL-10 mRNA in 12 of 17 atherosclerotic plaques analyzed by using RT-PCR, whereas IL-10 mRNA was not found in control carotid arteries (Figure 1
).
IL-10 protein expression was detected in 16 of 21 plaques examined by
using immunohistochemical techniques (Figure 2). There was no staining for IL-10 in
the media of control carotid and internal mammary arteries.
Analysis of adjacent serial sections and double-stained
sections revealed that most IL-10–positive cells were
macrophages (72±3% of IL-10–positive cells) (Figure 2A), identified by staining with anti-CD68 antibody. It is
noteworthy that smooth muscle cells, identified by their morphological
features and by positive staining for -actin, also showed cytosolic
positive staining for IL-10 (18±3% of IL-10–positive cells) (Figure 2B). IL-10 staining was also detected extracellularly. No or
very rare T lymphocytes stained for IL-10. The specificity of the
immunostaining was confirmed by Western blot
analysis of plaques showing a single band at 36 kDa (Figure 3) corresponding to the noncovalently
linked IL-10 homodimer.12
|
|
|
Relation Between IL-10 Expression, iNOS Expression, and TUNEL
Labeling
As previously reported,10 13 14 15 16 17 18 iNOS expression and
cell death were detected in the plaques by using immunohistochemistry
and TUNEL labeling, respectively (see below). There was no staining for
iNOS or TUNEL in the control carotid arteries.
As shown in Table 1, most microscopic
fields with positive iNOS expression (
75%) showed low or no IL-10
expression (Figure 4A and 4C).
Conversely, most fields with no iNOS expression (72%) showed moderate
to high levels of IL-10 expression. The effect of the level of IL-10
expression in the plaques on iNOS expression was highly significant
(2=130.5, P<0.0001).
|
|
As shown in Table 1
, cell death revealed by TUNEL labeling was
detected in only 2.5% of fields with moderate to high levels of IL-10
expression. Conversely, cell death was much more frequently observed in
fields with low or no IL-10 expression (28% of these fields) (Figure 4A and 4B). These findings indicate that there is a strong
association between high levels of IL-10 expression and reduced cell
death in the plaque (2=70.7,
P<0.0001). These results were confirmed by analysis
of double-stained sections as shown in Table 2. Quantitative analysis of these
sections revealed that the probability of iNOS protein expression or
TUNEL positivity was 3-fold lower in IL-10–positive cells than in
total cells (Table 2). This is illustrated in part in Figure 5. The results were similar regardless of
the region of the plaque analyzed (fibrous cap, shoulder, or
lipid core).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Recently, Uyemura et al19 found IL-10 mRNA expression in 2 of 7 noncomplicated atherosclerotic plaques, but no information was reported about the cellular expression and localization of the corresponding protein, and it is still unknown whether IL-10 is expressed in advanced atherosclerosis. In the present study, we analyzed advanced atherosclerotic plaques and found IL-10 mRNA expression in 12 of 17 plaques examined. We also performed immunohistochemical studies and detected IL-10 protein in 16 of 21 plaques. As expected, immunoreactive IL-10 was detected in the extracellular matrix, and it was expressed mainly by macrophages. It is noteworthy that staining of serial adjacent sections as well as double staining showed that IL-10 also localized to the cytoplasm of several smooth muscle cells. Although not definitive proof, this finding strongly suggests that these smooth muscle cells were producing IL-10. However, we were not able to detect either IL-10 mRNA or IL-10 protein in human aortic smooth muscle cells in culture, whether unstimulated or stimulated by minimally modified LDLs, oxidized LDLs, or a mixture of tumor necrosis factor-
, IL-1ß, and
interferon- (unpublished data). That very specific environmental
conditions or cell phenotype are required for smooth muscle
cells to produce IL-10 cannot be ruled out. Expression of IL-10 in human atherosclerotic plaques may have several potential effects. Because IL-10 is a potent antiinflammatory cytokine with deactivating properties in macrophages,8 9 20 it is likely that its expression by plaque macrophages would limit the inflammatory response and promote plaque healing. It has recently been shown that endogenous production of IL-10 by human monocytes in response to LDL stimulation inhibits IL-12 production,19 indicating a cross-regulatory action of IL-10 that may counterbalance the proinflammatory response. In our study, IL-10 expression in advanced human atheroma was associated with a 3-fold decrease in the probability of iNOS expression. Because iNOS is a major mediator of the inflammatory reaction, our results strongly suggest a local antiinflammatory role for IL-10 in human atherosclerosis.
Apoptosis is known to occur in the atherosclerotic plaque.10 14 15 16 17 18 The TUNEL method may, in some instances, reveal other processes than apoptosis,11 essentially because of delayed prefixation times and misuse of proteinase K. In the present study, tissues were immediately fixed in 4% paraformaldehyde after carotid endarterectomy and digestion with proteinase K before TUNEL labeling was omitted. Such material processing greatly enhances the specificity of TUNEL for apoptosis.11 Moreover, we have previously shown that TUNEL staining in the plaque is highly associated with caspase-3 expression10 and it is well accepted that caspases are specific features of apoptosis.21 Several potential inducers of apoptosis in the plaque have been identified including oxidized LDLs and proinflammatory cytokines.22 23 However, little is known about the expression of antiapoptotic factors in human atherosclerosis. Our study supports that the counterregulatory effect induced by anti-inflammatory cytokines, especially IL-10, on the inflammatory response may protect from excessive cell damage and death in the plaque. Our results are in agreement with previous studies showing antiapoptotic properties for IL-10 in cultured macrophages24 and in T lymphocytes.25 In addition, the strong association between iNOS expression and TUNEL labeling in the plaque might be explained by the reported apoptotic effects of inflammatory NO.23 26 In the presence of the superoxide anion, NO might lead to local peroxynitrite formation,11 27 which is also a potent inducer of cell death.28
In conclusion, we show that IL-10 is expressed in advanced human atherosclerosis and is associated with low iNOS expression and low levels of cell death. Therefore, IL-10 may play a critical role in atherosclerotic plaque formation and progression.
|
Acknowledgments |
|---|
This work was supported in part by grant CNAMTS/INSERM no. 4API12 and Projet Hospitalier de Recherche Clinique.
Received August 7, 1998; accepted August 19, 1998.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Barath P, Fishlein MC, Cao J, Berenson J, Helfant RH, Forrester JS. Detection and localization of tumor necrosis factor in human atheroma. Am J Cardiol. 1990;65:297–302.[Medline] [Order article via Infotrieve]
2. Clinton SK, Fleet JC, Loppnow H, Salomon RN, Clark BD, Cannon JG, Shaw AR, Dinarello CA, Libby P. Interleukin-1 gene expression in rabbit vascular tissue in vivo. Am J Pathol. 1991;138:1005–1014.[Abstract]
3. Seino Y, Ikeda U, Ikeda M, Hasegawa T, Misawa Y, Yamamoto K, Kano S, Shimada K. Interleukin 6 gene transcripts are expressed in human atherosclerotic lesions. Cytokine. 1994;6:87–91.[Medline] [Order article via Infotrieve]
4. Hansson GK, Holm J, Jonasson L. Detection of activated T lymphocytes in the human atherosclerotic plaque. Am J Pathol. 1989;135:169–175.[Abstract]
5. Kishikawa H, Shimokama T, Watanabe T. Localization of T lymphocytes and macrophages expressing IL-1, IL-2 receptor, IL-6 and TNF in human aortic intima. Role of cell-mediated immunity in human atherogenesis. Virchows Arch. 1993;423:433–442.
6. Libby P, Hansson GK. Involvement of the immune system in human atherogenesis: current knowledge and unanswered questions. Lab Invest. 1991;64:5–15.[Medline] [Order article via Infotrieve]
7.
Lee RT, Libby P. The unstable atheroma.
Arterioscler Thromb Vasc Biol. 1997;17:1859–1867.
8. de Vries JE. Immunosuppressive and anti-inflammatory properties of interleukin 10. Ann Med. 1995;27:537–541.[Medline] [Order article via Infotrieve]
9.
de Waal Malefyt R, Abrams RJ, Bennett B, Figdor CG, de
Vries JE. Interleukin-10 (IL-10) inhibits cytokine synthesis by
human monocytes—an autoregulatory role of IL-10 produced by monocytes.
J Exp Med. 1991;174:1209–1220.
10.
Mallat Z, Ohan J, Lesèche G, Tedgui A.
Colocalization of CPP-32 with apoptotic cells in human
atherosclerotic plaques. Circulation. 1997;96:424–428.
11. Kockx MM, Muhring J, Knaapen MW, de Meyer GR. RNA synthesis and splicing interferes with DNA in situ end labeling techniques used to detect apoptosis. Am J Pathol. 1998;152:885–888.[Abstract]
12.
Vieira P, de Waal-Malefyt R, Dang MN, Johnson KE,
Kastelein R, Fiorentino DF, deVries JE, Roncarolo MG, Mosmann TR, Moore
KW. Isolation and expression of human cytokine synthesis
inhibitory factor cDNA clones: homology to Epstein-Barr
virus open reading frame BCRFI. Proc Natl Acad Sci U S A. 1991;88:1172–1176.
13. Buttery LD, Springall DR, Chester AH, Evans TJ, Standfield EN, Parums DV, Yacoub MH, Polak JM. Inducible nitric oxide synthase is present within human atherosclerotic lesions and promotes the formation and activity of peroxynitrite. Lab Invest. 1996;75:77–85.[Medline] [Order article via Infotrieve]
14. Geng Y-J, Libby P. Evidence for apoptosis in advanced human atheroma. Colocalization with interleukin-1ß-converting enzyme. Am J Pathol. 1995;147:251–266.[Abstract]
15.
Isner JM, Kearney M, Bortman S, Passeri J.
Apoptosis in human atherosclerosis and
restenosis. Circulation. 1995;91:2703–2711.
16. Han DKM, Haudenschild CC, Hong MK, Tinkle BT, Leon MB, Liau G. Evidence for apoptosis in human atherogenesis and in a rat vascular injury model. Am J Pathol. 1995;147:267–277.[Abstract]
17. Björkerud S, Björkerud B. Apoptosis is abundant in human atherosclerotic lesions, especially in inflammatory cells (macrophages and T cells), and may contribute to the accumulation of gruel and plaque instability. Am J Pathol. 1996;149:367–380.[Abstract]
18. Cai W, Devaux B, Schaper W, Schaper J. The role of Fas/APO 1 and apoptosis in the development of human atherosclerotic lesions. Atherosclerosis. 1997;131:177–186.[Medline] [Order article via Infotrieve]
19. Uyemura K, Demer LL, Castle SC, Jullien D, Berliner JA, Gately MK, Warrier RR, Pham N, Fogelman AM, Modlin RL. Cross-regulatory roles of interleukin (IL)-12 and IL-10 in atherosclerosis. J Clin Invest. 1996;97:2130–2138.[Medline] [Order article via Infotrieve]
20.
Gérard C, Bruyns C, Marchant A, Abramowicz D,
Vandebeele P, Delvaux A, Fiers W, Goldman M, Velu T. Interleukin-10
reduces the release of tumor necrosis factor and prevents lethality in
experimental endotoxemia. J Exp Med. 1993;177:547–550.
21. Dong Z, Saikumar P, Weinberg JM, Venkatachalam MA. Internucleosomal DNA cleavage triggered by plasma membrane damage during necrotic cell death. Involvement of serine but not cysteine proteases. Am J Pathol. 1997;151:1205–1213.[Abstract]
22. Mitchinson MJ, Hardwick SJ, Bennett MR. Cell death in atherosclerotic plaques. Curr Opin Lipidol. 1996;7:324–329.[Medline] [Order article via Infotrieve]
23.
Geng YJ, Wu Q, Muszynski M, Hansson GK, Libby P.
Apoptosis of vascular smooth muscle cells induced by in vitro
stimulation with interferon-gamma, tumor necrosis factor-alpha, and
interleukin-1 beta. Arterioscler Thromb Vasc Biol. 1996;16:19–27.
24. Arai T, Hiromatsu K, Nishimura H, Kimura Y, Kobayashi N, Ishida H, Nimura Y, Yoshikai Y. Endogenous interleukin 10 prevents apoptosis in macrophages during salmonella infection. Biochem Biophys Res Commun. 1995;213:600–607.[Medline] [Order article via Infotrieve]
25. Cohen SB, Crawley JB, Kahan MC, Feldmann M, Foxwell BM. Interleukin-10 rescues T cells from apoptotic cell death: association with an upregulation of Bcl-2. Immunology. 1997;92:1–5.[Medline] [Order article via Infotrieve]
26. Albina JE, Cui SJ, Mateo RB, Reichner JS. Nitric-oxide-mediated apoptosis in murine peritoneal macrophages. J Immunol. 1993;150:5080–5085.[Abstract]
27.
Luoma JS, Stralin P, Marklund SL, Hiltunen TP,
Sarkioja T, Yla-Herttuala S. Expression of extracellular SOD and iNOS
in macrophages and smooth muscle cells in human and rabbit
atherosclerotic lesions: colocalization with epitopes characteristic of
oxidized LDL and peroxynitrite-modified proteins. Arterioscler
Thromb Vasc Biol. 1998;18:157–167.
28. Szabo C. DNA strand breakage and activation of poly-ADP ribosyltransferase: a cytotoxic pathway triggered by peroxynitrite. Free Radic Biol Med. 1996;21:855–869.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  X. Han, S. Kitamoto, Q. Lian, and W. A. Boisvert Interleukin-10 Facilitates Both Cholesterol Uptake and Efflux in Macrophages J. Biol. Chem., November 20, 2009; 284(47): 32950 - 32958. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Boyle, H. A. Harrington, E. Piper, K. Elderfield, J. Stark, R. C. Landis, and D. O. Haskard Coronary Intraplaque Hemorrhage Evokes a Novel Atheroprotective Macrophage Phenotype Am. J. Pathol., March 1, 2009; 174(3): 1097 - 1108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Edwards, X. Zhang, and D. M. Mosser The Expression of Heparin-Binding Epidermal Growth Factor-Like Growth Factor by Regulatory Macrophages J. Immunol., February 15, 2009; 182(4): 1929 - 1939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Stumpf, K. Seybold, S. Petzi, G. Wasmeier, D. Raaz, A. Yilmaz, T. Anger, W. G. Daniel, and C. D. Garlichs Interleukin-10 improves left ventricular function in rats with heart failure subsequent to myocardial infarction Eur J Heart Fail, August 1, 2008; 10(8): 733 - 739. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Schulte, G. K. Sukhova, and P. Libby Genetically Programmed Biases in Th1 and Th2 Immune Responses Modulate Atherogenesis Am. J. Pathol., June 1, 2008; 172(6): 1500 - 1508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-S. Lim, J. M. Timmins, T. A. Seimon, A. Sadler, F. D. Kolodgie, R. Virmani, and I. Tabas Signal Transducer and Activator of Transcription-1 Is Critical for Apoptosis in Macrophages Subjected to Endoplasmic Reticulum Stress In Vitro and in Advanced Atherosclerotic Lesions In Vivo Circulation, February 19, 2008; 117(7): 940 - 951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.R.S. Girn, N.M. Orsi, and S. Homer-Vanniasinkam An overview of cytokine interactions in atherosclerosis and implications for peripheral arterial disease Vascular Medicine, November 1, 2007; 12(4): 299 - 309. [Abstract] [PDF]
|
|
|
|
 |
|
 S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor CD36 and macrophages in atherosclerosis Cardiovasc Res, August 1, 2007; 75(3): 468 - 477. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Levy, J. E. Levy, S. Kalet-Litman, R. Miller-Lotan, N. S. Levy, R. Asaf, J. Guetta, C. Yang, K. R. Purushothaman, V. Fuster, et al. Haptoglobin Genotype Is a Determinant of Iron, Lipid Peroxidation, and Macrophage Accumulation in the Atherosclerotic Plaque Arterioscler Thromb Vasc Biol, January 1, 2007; 27(1): 134 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. N. Tziakas, G. K. Chalikias, C. O. Antonoglou, S. Veletza, I. K. Tentes, A. X. Kortsaris, D. I. Hatseras, and J. C. Kaski Apolipoprotein E Genotype and Circulating Interleukin-10 Levels in Patients With Stable and Unstable Coronary Artery Disease J. Am. Coll. Cardiol., December 19, 2006; 48(12): 2471 - 2481. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Singh, S. Devaraj, M. R. Dasu, D. Ciobanu, J. Reusch, and I. Jialal C-Reactive Protein Decreases Interleukin-10 Secretion in Activated Human Monocyte-Derived Macrophages via Inhibition of Cyclic AMP Production Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2469 - 2475. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T Kilic, D Ural, E Ural, Z Yumuk, A Agacdiken, T Sahin, G Kahraman, G Kozdag, A Vural, and B Komsuoglu Relation between proinflammatory to anti-inflammatory cytokine ratios and long-term prognosis in patients with non-ST elevation acute coronary syndrome Heart, August 1, 2006; 92(8): 1041 - 1046. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Nishihira, T. Imamura, A. Yamashita, K. Hatakeyama, Y. Shibata, Y. Nagatomo, H. Date, T. Kita, T. Eto, and Y. Asada Increased expression of interleukin-10 in unstable plaque obtained by directional coronary atherectomy Eur. Heart J., July 2, 2006; 27(14): 1685 - 1689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kaur, A. K. Sharma, and P. K. Singal Significance of changes in TNF-{alpha} and IL-10 levels in the progression of heart failure subsequent to myocardial infarction Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H106 - H113. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. B. Holven, B. Halvorsen, V. Bjerkeli, J. K. Damas, K. Retterstol, L. Morkrid, L. Ose, P. Aukrust, and M. S. Nenseter Impaired Inhibitory Effect of Interleukin-10 on the Balance Between Matrix Metalloproteinase-9 and Its Inhibitor in Mononuclear Cells From Hyperhomocysteinemic Subjects Stroke, July 1, 2006; 37(7): 1731 - 1736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Stoll and M. Bendszus Inflammation and Atherosclerosis: Novel Insights Into Plaque Formation and Destabilization Stroke, July 1, 2006; 37(7): 1923 - 1932. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zernecke, E. A. Liehn, J.-L. Gao, W. A. Kuziel, P. M. Murphy, and C. Weber Deficiency in CCR5 but not CCR1 protects against neointima formation in atherosclerosis-prone mice: involvement of IL-10 Blood, June 1, 2006; 107(11): 4240 - 4243. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Tedgui and Z. Mallat Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways Physiol Rev, April 1, 2006; 86(2): 515 - 581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Gunnett, D. D. Lund, F. M. Faraci, and D. D. Heistad Vascular interleukin-10 protects against LPS-induced vasomotor dysfunction Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H624 - H630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Halvorsen, T. Waehre, H. Scholz, O. P. Clausen, J. H. von der Thusen, F. Muller, H. Heimli, S. Tonstad, C. Hall, S. S. Froland, et al. Interleukin-10 enhances the oxidized LDL-induced foam cell formation of macrophages by antiapoptotic mechanisms J. Lipid Res., February 1, 2005; 46(2): 211 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Huang, T. Li, D. C. Sane, and L. Li IRAK1 Serves as a Novel Regulator Essential for Lipopolysaccharide-induced Interleukin-10 Gene Expression J. Biol. Chem., December 3, 2004; 279(49): 51697 - 51703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Schieffer, T. Selle, A. Hilfiker, D. Hilfiker-Kleiner, K. Grote, U. J.F. Tietge, C. Trautwein, M. Luchtefeld, C. Schmittkamp, S. Heeneman, et al. Impact of Interleukin-6 on Plaque Development and Morphology in Experimental Atherosclerosis Circulation, November 30, 2004; 110(22): 3493 - 3500. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Rossi, N. Marziliano, P. A. Merlini, E. Bramucci, U. Canosi, G. Belli, D. Z. Parenti, P. M. Mannucci, and D. Ardissino Different Quantitative Apoptotic Traits in Coronary Atherosclerotic Plaques From Patients With Stable Angina Pectoris and Acute Coronary Syndromes Circulation, September 28, 2004; 110(13): 1767 - 1773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gojova, V. Brun, B. Esposito, F. Cottrez, P. Gourdy, P. Ardouin, A. Tedgui, Z. Mallat, and H. Groux Specific abrogation of transforming growth factor-{beta} signaling in T cells alters atherosclerotic lesion size and composition in mice Blood, December 1, 2003; 102(12): 4052 - 4058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Girndt and H. Kohler Interleukin-10 (IL-10): an update on its relevance for cardiovascular risk Nephrol. Dial. Transplant., October 1, 2003; 18(10): 1976 - 1979. [Full Text] [PDF]
|
|
|
|
|
|
B. OSTERUD and E. BJORKLID Role of Monocytes in Atherogenesis Physiol Rev, October 1, 2003; 83(4): 1069 - 1112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Heeschen, S. Dimmeler, C. W. Hamm, S. Fichtlscherer, E. Boersma, M. L. Simoons, A. M. Zeiher, and for the CAPTURE Study Investigators Serum Level of the Antiinflammatory Cytokine Interleukin-10 Is an Important Prognostic Determinant in Patients With Acute Coronary Syndromes Circulation, April 29, 2003; 107(16): 2109 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Esposito, A. Pontillo, F. Giugliano, G. Giugliano, R. Marfella, G. Nicoletti, and D. Giugliano Association of Low Interleukin-10 Levels with the Metabolic Syndrome in Obese Women J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1055 - 1058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Von der Thusen, J. Kuiper, T. J. C. Van Berkel, and E. A. L. Biessen Interleukins in Atherosclerosis: Molecular Pathways and Therapeutic Potential Pharmacol. Rev., March 1, 2003; 55(1): 133 - 166. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Maron, G. Sukhova, A.-M. Faria, E. Hoffmann, F. Mach, P. Libby, and H. L. Weiner Mucosal Administration of Heat Shock Protein-65 Decreases Atherosclerosis and Inflammation in Aortic Arch of Low-Density Lipoprotein Receptor-Deficient Mice Circulation, September 24, 2002; 106(13): 1708 - 1715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Tedgui and Z. Mallat Platelets in Atherosclerosis: A New Role for {beta}-Amyloid Peptide Beyond Alzheimer's Disease Circ. Res., June 14, 2002; 90(11): 1145 - 1146. [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Gunnett, D. D. Heistad, and F. M. Faraci Interleukin-10 Protects Nitric Oxide-Dependent Relaxation During Diabetes: Role of Superoxide Diabetes, June 1, 2002; 51(6): 1931 - 1937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Lutgens, M. Gijbels, M. Smook, P. Heeringa, P. Gotwals, V. E. Koteliansky, and M. J.A.P. Daemen Transforming Growth Factor-{beta} Mediates Balance Between Inflammation and Fibrosis During Plaque Progression Arterioscler Thromb Vasc Biol, June 1, 2002; 22(6): 975 - 982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Pinderski, M. P. Fischbein, G. Subbanagounder, M. C. Fishbein, N. Kubo, H. Cheroutre, L. K. Curtiss, J. A. Berliner, and W. A. Boisvert Overexpression of Interleukin-10 by Activated T Lymphocytes Inhibits Atherosclerosis in LDL Receptor-Deficient Mice by Altering Lymphocyte and Macrophage Phenotypes Circ. Res., May 31, 2002; 90(10): 1064 - 1071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-S. Silvestre, R. Tamarat, T. Senbonmatsu, T. Icchiki, T. Ebrahimian, M. Iglarz, S. Besnard, M. Duriez, T. Inagami, and B. I. Levy Antiangiogenic Effect of Angiotensin II Type 2 Receptor in Ischemia-Induced Angiogenesis in Mice Hindlimb Circ. Res., May 31, 2002; 90(10): 1072 - 1079. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Lamblin, C. Bauters, and N. Helbecque Gene polymorphisms of pro- (or anti-) inflammatory cytokines and vascular disease Eur. Heart J., December 2, 2001; 22(24): 2219 - 2220. [PDF]
|
|
|
|
|
|
G. K. Hansson Immune Mechanisms in Atherosclerosis Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 1876 - 1890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Mallat, A. Corbaz, A. Scoazec, P. Graber, S. Alouani, B. Esposito, Y. Humbert, Y. Chvatchko, and A. Tedgui Interleukin-18/Interleukin-18 Binding Protein Signaling Modulates Atherosclerotic Lesion Development and Stability Circ. Res., September 28, 2001; 89 (7): e41 - e45. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Smith, S. D. Irving, J. Sheldon, D. Cole, and J. C. Kaski Serum Levels of the Antiinflammatory Cytokine Interleukin-10 Are Decreased in Patients With Unstable Angina Circulation, August 14, 2001; 104(7): 746 - 749. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.C. Kaski and E.G. Zouridakis Inflammation, infection and acute coronary plaque events Eur. Heart J. Suppl., August 1, 2001; 3(suppl_I): I10 - I15. [Abstract] [PDF]
|
|
|
|
|
|
S. P. Jones, S. D. Trocha, and D. J. Lefer Cardioprotective actions of endogenous IL-10 are independent of iNOS Am J Physiol Heart Circ Physiol, July 1, 2001; 281(1): H48 - H52. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Mallat and A. Tedgui Current Perspective on the Role of Apoptosis in Atherothrombotic Disease Circ. Res., May 25, 2001; 88(10): 998 - 1003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tedgui and Z. Mallat Anti-Inflammatory Mechanisms in the Vascular Wall Circ. Res., May 11, 2001; 88(9): 877 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Mostafa Mtairag, S. Chollet-Martin, M. Oudghiri, N. Laquay, M.-P. Jacob, J.-B. Michel, and L. J. Feldman Effects of interleukin-10 on monocyte/endothelial cell adhesion and MMP-9/TIMP-1 secretion Cardiovasc Res, March 1, 2001; 49(4): 882 - 890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Feldman, L. Aguirre, M. Ziol, J.-P. Bridou, N. Nevo, J.-B. Michel, and P. G. Steg Interleukin-10 Inhibits Intimal Hyperplasia After Angioplasty or Stent Implantation in Hypercholesterolemic Rabbits Circulation, February 29, 2000; 101(8): 908 - 916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Pinderski Oslund, C. C. Hedrick, T. Olvera, A. Hagenbaugh, M. Territo, J. A. Berliner, and A. I. Fyfe Interleukin-10 Blocks Atherosclerotic Events In Vitro and In Vivo Arterioscler Thromb Vasc Biol, December 1, 1999; 19(12): 2847 - 2853. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Mallat, S. Besnard, M. Duriez, V. Deleuze, F. Emmanuel, M. F. Bureau, F. Soubrier, B. Esposito, H. Duez, C. Fievet, et al. Protective Role of Interleukin-10 in Atherosclerosis Circ. Res., October 15, 1999; 85 (8): e17 - e24. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Mallat, A. Gojova, C. Marchiol-Fournigault, B. Esposito, C. Kamate, R. Merval, D. Fradelizi, and A. Tedgui Inhibition of Transforming Growth Factor-{beta} Signaling Accelerates Atherosclerosis and Induces an Unstable Plaque Phenotype in Mice Circ. Res., November 9, 2001; 89(10): 930 - 934. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||