Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1999;19:611-616

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mallat, Z.
Right arrow Articles by Tedgui, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mallat, Z.
Right arrow Articles by Tedgui, A.
Related Collections
Right arrow Pathophysiology
Right arrow Growth factors/cytokines
Right arrow Endothelium/vascular type/nitric oxide
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1999;19:611-616.)
© 1999 American Heart Association, Inc.


Original Contributions

Expression of Interleukin-10 in Advanced Human Atherosclerotic Plaques

Relation to Inducible Nitric Oxide Synthase Expression and Cell Death

Ziad Mallat; Christophe Heymes; Jeanny Ohan; Elisabetta Faggin; Guy Lesèche; Alain Tedgui

From the Institut National de la Santé et de la Recherche Médicale, IFR "Circulation Lariboisière," INSERM U 141 (Z.M., A.T.) and INSERM U 127 (C.H.), Hôpital Lariboisière, Paris, and the Service de Chirurgie Thoracique et Vasculaire (J.O., G.L.), Hôpital Beaujon, Clichy, France; and the Department of Clinical and Experimental Medicine (E.F.), University of Padova, Padova, Italy.

Correspondence to Alain Tedgui, PhD, INSERM U 141, 41 boulevard de la Chapelle, 75475 Paris Cedex 10, France.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Inflammation is a major feature of human atherosclerosis and is central to development and progression of the disease. A variety of proinflammatory cytokines are expressed in the atherosclerotic plaque and may modulate extracellular matrix remodeling, cell proliferation, and cell death. Little is known, however, about the expression and potential role of anti-inflammatory cytokines in human atherosclerosis. Interleukin-10 (IL-10) is a major anti-inflammatory cytokine whose expression and potential effects in advanced human atherosclerotic plaques have not been evaluated. We studied 21 advanced human atherosclerotic plaques. IL-10 expression was analyzed by use of reverse transcription–polymerase chain reaction and immunohistochemical techniques. Inducible nitric oxide synthase expression was assessed by using immunohistochemistry, and cell death was determined by use of the TUNEL method. Reverse transcription–polymerase chain reaction identified IL-10 mRNA in 12 of 17 atherosclerotic plaques. Immunohistochemical staining of serial sections and double staining identified immunoreactive IL-10 mainly in macrophages, as well as in smooth muscle cells. Consistent with its anti-inflammatory properties, high levels of IL-10 expression were associated with significant decrease in inducible nitric oxide synthase expression (P<0.0001) and cell death (P<0.0001). Hence, IL-10, a potent anti-inflammatory cytokine, is expressed in a substantial number of advanced human atherosclerotic plaques and might contribute to the modulation of the local inflammatory response and protect from excessive cell death in the plaque.


Key Words: interleukin-10 • atherosclerotic plaque • cytokines • inflammation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Avariety of proinflammatory cytokines, including tumor necrosis factor-{alpha}, interleukin (IL)-1ß, IL-6, and interferon-{gamma},1 2 3 4 5 are expressed in the human atherosclerotic plaque. These cytokines alone or in conjunction contribute to the local inflammatory response and may have great impact on plaque formation and progression.6 Indeed, proinflammatory cytokines have the potential to induce excessive extracellular matrix degradation and cell death promoting plaque instability.7 However, the inflammatory response is known to be balanced by anti-inflammatory cytokines, including IL-10.8 We therefore hypothesized that this may occur within the plaque. Hitherto, little is known about the expression and potential role of anti-inflammatory cytokines in human atherosclerosis. Among the anti-inflammatory cytokines, IL-10 is produced by Th2 cells as well as by macrophages8 and has potent deactivating properties on these cells.9 Because macrophages and T-lymphocytes are involved in human atherogenesis, we hypothesized that IL-10 may be produced locally in the plaque and may protect from an excessive proinflammatory response and cell damage in the plaque. To test this hypothesis, we analyzed the expression and localization of IL-10 in advanced human atherosclerotic plaques and examined its relation to inducible nitric oxide synthase (iNOS) expression, a reliable marker of the proinflammatory response, and to cell death.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
Twenty-one human atherosclerotic plaques removed from 18 patients undergoing carotid endarterectomy and 3 patients undergoing resection of an abdominal aortic aneurysm were collected. For controls, 4 carotid arteries free of atherosclerosis (1 with minimal fibromuscular thickening) were obtained at autopsy and 3 internal mammary arteries were obtained during coronary bypass surgery. A segment from the most stenotic area of each arterial specimen was immediately placed for 2 hours in fresh 4% paraformaldehyde, then transferred to a 30% sucrose–PBS solution before being snap-frozen in optimal cutting temperature tissue processing medium (O.C.T. Compound, Miles Inc, Diagnostics Division) with liquid nitrogen and stored at -80°C for cryostat sectioning. Several 5- to 6-µm sections were obtained from each specimen for histological analysis, immunohistochemical studies, and in situ detection of apoptosis. Fresh, unfixed material was used for protein, RNA, and DNA extraction.

Total RNA Extraction and Reverse Transcription–Polymerase Chain Reaction to Detect IL-10 mRNA
Total RNA was extracted from 17 atherosclerotic plaques by use of TriZOL reagent according to the manufacturer's instructions (Life Technologies, Inc). The purified RNA was dissolved in water and the concentration measured by absorbance at 260 nm. The antisense primer for reverse transcription–polymerase chain reaction (RT-PCR) was 5'AAGCTGAGAACCAAGACCCAGACATCAAGGCG3' (nucleotides 615 to 647 of the coding sequence) and the sense primer was 5'AGCTATCCCAGAGCCCCAGATCCGATTTTGG3' (nucleotides 320 to 351 of the coding sequence), resulting in a 328-bp amplification product. The oligonucleotides were obtained from Clontech Laboratories. For RT reaction, 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc) was used to synthesize (39°C, 90 minutes) single-stranded DNA from 1 µg of total RNA. The reaction was performed in 20 µL of a mixture containing 1 µmol/L of the reverse primer, 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl2, 0.5 mmol/L dNTP, 3 mmol/L DTT, and 50 U RNase inhibitor (Promega). The reaction was stopped by heating samples for 10 minutes at 70°C. PCR amplification of the resulting cDNA was performed in a total volume of 100 µL containing 0.2 µmol/L of the sense primer, 1x PCR buffer (10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2, and 50 mmol/L KCl), 0.3 mmol/L dNTP, 2 mmol/L DTT, and 2.5 U Taq DNA polymerase (Boehringer Mannheim). The mixture was overlaid with 1 drop of mineral oil and the amplification was performed as follows: denaturation at 95°C for 45 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 2 minutes for 30 cycles. Twenty microliters of the RT-PCR mixtures was electrophoresed in 2% agarose gel.

Western Blot Analysis
Proteins were extracted from 6 atherosclerotic plaques. Frozen plaques were pulverized under liquid nitrogen. The powders were resuspended in ice-cold lysis buffer [20 mmol/L Tris-HCl, pH 7.5, 5 mmol/L EGTA, 150 mmol/L NaCl, 20 mmol/L glycerophosphate, 10 mmol/L NaF, 1 mmol/L sodium orthovanadate, 1% Triton X-100, 0.1% Tween 20, 1 µg/mL aprotinin, 1 mmol/L PMSF, 0.5 mmol/L N-tosyl-L-phenylalanine chloromethyl ketone (TPCK), 0.5 mmol/L N(a)-p-tosyl-L-lysine chloromethyl ketone (TLCK)] at a ratio of 0.3 mL/10 mg of wet weight. Extracts were incubated on ice for 15 minutes and then centrifuged (12 000g, 15 minutes, 4°C). The detergent-soluble supernatant fractions were retained, and protein concentrations in samples were equalized by using a Bio-Rad protein assay; 70 µL of Laemmli sample buffer was added to 100-µL aliquots, samples were boiled for 3 minutes and loaded on a 12% SDS-polyacrylamide gel. Proteins were electrophoretically transferred from polyacrylamide gels onto nitrocellulose. Nitrocellulose membranes were saturated for 2 hours at room temperature in TBST [50 mmol/L Tris-HCl (pH 7.5), 250 mmol/L NaCl, and 0.1% Tween saline] containing 5% of fat-free dry milk. Goat polyclonal antibodies to human IL-10 (R & D Systems Europe Ltd) were used at a concentration of 1 µg/mL. Following incubation with anti-goat HRP conjugated antibodies (Sigma), chemiluminescence substrates (ECL, Western blotting; Amersham Corp) were used to reveal positive bands according to the manufacturer's instructions, and bands were visualized after exposure to Hyperfilm ECL (Amersham Corp).

Immunohistochemistry
Frozen sections were incubated with 1:10 normal horse serum or 1:10 normal goat serum for 30 minutes at room temperature, washed once in PBS, then incubated with either a primary mouse monoclonal antibody against CD68 for macrophage identification (DAKO-CD68, KP1), or a primary mouse monoclonal antibody against human smooth muscle {alpha}-actin (HHF35, DAKO) for identification of smooth muscle cells. These antibodies were used at a dilution of 1:200. To identify IL-10 within atherosclerotic plaques, a specific goat polyclonal antibody (R & D Systems Europe Ltd) was used at a dilution of 10 µg/mL. iNOS was detected by using a specific rabbit polyclonal antibody (Biomol) at a dilution of 1:500. After washing in PBS, the slides were incubated with the following secondary biotinylated antibodies: a biotinylated horse anti-mouse IgG (Vector Laboratories, Inc) at a dilution of 1:200 for detection of stains with antibodies against CD68 and smooth muscle {alpha}-actin, a biotinylated horse anti-goat IgG (Vector) at a dilution of 1:200 for detection of anti-IL-10 antibody, and a biotinylated goat anti-rabbit IgG (Vector) at a dilution of 1:200 for detection of anti-iNOS antibody. Immunostains were visualized with the use of avidin–biotin HRP (brown staining) or alkaline phosphatase (red color) visualization systems (Vectastain ABC kit PK-6100 and AK-5000 Vector). For negative controls, adjacent sections were stained with isotype-matched irrelevant antibodies instead of the primary antibodies.

In Situ Detection of Apoptotic Cell Death
In situ detection of apoptotic cells, using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) method of fragmented DNA was performed on cryostat sections as previously described.10 It is noteworthy that prefixation time was abrogated and treatment of sections with proteinase K was omitted and that has recently been shown to enhance the specificity of the staining.11 Negative controls for TUNEL labeling were obtained after omission of the enzyme TdT.

Relation Between IL-10 Expression, iNOS Expression, and TUNEL Labeling
Twenty-one plaques were analyzed. From each plaque, at least 10 adjacent serial sections were examined after staining for IL-10, iNOS, or TUNEL. To evaluate the relation between IL-10 expression, iNOS expression, and TUNEL labeling, we performed semiquantitative and quantitative analyses.

For semiquantitative analysis, areas with positivity for IL-10, iNOS, or TUNEL were first identified at low magnification (x100 and x200) over all the sections. We then analyzed 500 microscopic fields (x400) that showed positivity for at least 1 of the 3 stainings (IL-10, iNOS, or TUNEL) (almost 90% of the positive fields) and discarded those fields that were acellular or negative for all 3 stainings (748 fields). Cell counting was performed by 2 investigators (Z.M. and A.T.) who obtained similar results. The level of IL-10 expression in these fields was graded as follows: 0 (no staining), + (<10% staining), ++ (10% to 50% staining), or +++ (>50% staining). We then determined the distribution of iNOS expression and TUNEL labeling in the corresponding serial fields. Fields were considered positive for iNOS or TUNEL when at least 5 cells per field stained positive.

For quantitative analysis, double staining was performed on 52 sections from 9 of the 21 plaques. Percentages of IL-10–positive, iNOS-positive, or TUNEL-positive cells were first determined (the total number of cells counted in each section varied between 800 and 5000 cells). Then, the percentages of iNOS-positive or TUNEL-positive cells among IL-10–positive cells were calculated.

Statistical Analysis
Results are expressed as mean±SEM values. Semiquantitative analysis of the effect of IL-10 on iNOS expression and TUNEL labeling was performed by using a {chi}2 test. Quantitative analysis of the effect of IL-10 on iNOS expression and TUNEL labeling was performed by comparing the conditional probability of iNOS expression or TUNEL labeling given that cells were positive for IL-10, with the probability of iNOS expression or TUNEL labeling in all cells by use of a t test. P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Detection of IL-10 in Human Atherosclerotic Plaques
We detected IL-10 mRNA in 12 of 17 atherosclerotic plaques analyzed by using RT-PCR, whereas IL-10 mRNA was not found in control carotid arteries (Figure 1Down). IL-10 protein expression was detected in 16 of 21 plaques examined by using immunohistochemical techniques (Figure 2Down). There was no staining for IL-10 in the media of control carotid and internal mammary arteries. Analysis of adjacent serial sections and double-stained sections revealed that most IL-10–positive cells were macrophages (72±3% of IL-10–positive cells) (Figure 2ADown), identified by staining with anti-CD68 antibody. It is noteworthy that smooth muscle cells, identified by their morphological features and by positive staining for {alpha}-actin, also showed cytosolic positive staining for IL-10 (18±3% of IL-10–positive cells) (Figure 2BDown). IL-10 staining was also detected extracellularly. No or very rare T lymphocytes stained for IL-10. The specificity of the immunostaining was confirmed by Western blot analysis of plaques showing a single band at 36 kDa (Figure 3Down) corresponding to the noncovalently linked IL-10 homodimer.12



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. Expression of IL-10 mRNA in human atherosclerosis. One microgram of total RNA was used in each case. After RT, the cDNA was amplified by 30-cycle PCR with IL-10 primers (see Methods). The 328-bp product was visualized under UV light after electrophoresis of the PCR products in agarose gels containing ethidium bromide. IL-10 mRNA was expressed in most atherosclerotic plaques examined (results from 10 plaques are shown) but not in control carotid arteries. MW indicates DNA size markers. Positive control was purchased from Clontech.



View larger version (106K):
[in this window]
[in a new window]
 
Figure 2. Intense staining for IL-10 (red) in macrophages (A) and smooth muscle cells (B, arrowheads) of human atherosclerotic plaques. Original magnifications x630 (A) and x600 (B).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. IL-10 expression in human atherosclerotic plaques. Western blot analysis with antibodies against human IL-10 revealed a single band of the appropriate size of 36 kDa corresponding to IL-10 homodimer. Plaques used for Western blotting were different from those used for RT-PCR analysis in Figure 1Up.

Relation Between IL-10 Expression, iNOS Expression, and TUNEL Labeling
As previously reported,10 13 14 15 16 17 18 iNOS expression and cell death were detected in the plaques by using immunohistochemistry and TUNEL labeling, respectively (see below). There was no staining for iNOS or TUNEL in the control carotid arteries.

As shown in Table 1Down, most microscopic fields with positive iNOS expression ({approx}75%) showed low or no IL-10 expression (Figure 4ADown and 4CDown). Conversely, most fields with no iNOS expression (72%) showed moderate to high levels of IL-10 expression. The effect of the level of IL-10 expression in the plaques on iNOS expression was highly significant ({chi}2=130.5, P<0.0001).


View this table:
[in this window]
[in a new window]
 
Table 1. Distribution of iNOS Expression According to the Level of IL-10 Expression



View larger version (71K):
[in this window]
[in a new window]
 
Figure 4. Three serial adjacent sections stained with anti-iNOS antibody (A), TUNEL (B), or anti-IL-10 antibody (C). Counterstaining was performed by using hematoxylin. Intense staining for iNOS (brown staining) in this region of plaques was associated with positive staining for TUNEL, as shown in a magnified zone from the center of this area (brown staining, arrowheads) (B) but no staining for IL-10 (C). Original magnifications x250 (A) and x800 (B and C).

As shown in Table 1Up, cell death revealed by TUNEL labeling was detected in only 2.5% of fields with moderate to high levels of IL-10 expression. Conversely, cell death was much more frequently observed in fields with low or no IL-10 expression (28% of these fields) (Figure 4AUp and 4BUp). These findings indicate that there is a strong association between high levels of IL-10 expression and reduced cell death in the plaque ({chi}2=70.7, P<0.0001). These results were confirmed by analysis of double-stained sections as shown in Table 2Down. Quantitative analysis of these sections revealed that the probability of iNOS protein expression or TUNEL positivity was {approx}3-fold lower in IL-10–positive cells than in total cells (Table 2Down). This is illustrated in part in Figure 5Down. The results were similar regardless of the region of the plaque analyzed (fibrous cap, shoulder, or lipid core).


View this table:
[in this window]
[in a new window]
 
Table 2. Quantitative Analysis of the Percentages of Cells Positive for iNOS or TUNEL in IL-10–Positive Cells or in Total Cells



View larger version (62K):
[in this window]
[in a new window]
 
Figure 5. Double staining for TUNEL (brown staining) and IL-10 protein (red staining) by use of immunohistochemical techniques (see Methods). Counterstaining was performed, using hematoxylin yielding blue nuclei. A, Representative photomicrograph from a region of a human atherosclerotic plaque showing intense staining for IL-10 (red staining) but no staining for TUNEL. B, Representative photomicrograph from a region of a human atherosclerotic plaque showing staining for TUNEL (brown nuclei, arrowheads) but no or very little staining for IL-10. C, Immunoreactive IL-10 (red staining, arrows) preferentially localized to nonapoptotic cells in TUNEL+/IL-10+ areas. Arrowhead shows an apoptotic cell with no IL-10 staining. Original magnifications x200 (A), x350 (B), and x900 (C).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Recently, Uyemura et al19 found IL-10 mRNA expression in 2 of 7 noncomplicated atherosclerotic plaques, but no information was reported about the cellular expression and localization of the corresponding protein, and it is still unknown whether IL-10 is expressed in advanced atherosclerosis. In the present study, we analyzed advanced atherosclerotic plaques and found IL-10 mRNA expression in 12 of 17 plaques examined. We also performed immunohistochemical studies and detected IL-10 protein in 16 of 21 plaques. As expected, immunoreactive IL-10 was detected in the extracellular matrix, and it was expressed mainly by macrophages. It is noteworthy that staining of serial adjacent sections as well as double staining showed that IL-10 also localized to the cytoplasm of several smooth muscle cells. Although not definitive proof, this finding strongly suggests that these smooth muscle cells were producing IL-10. However, we were not able to detect either IL-10 mRNA or IL-10 protein in human aortic smooth muscle cells in culture, whether unstimulated or stimulated by minimally modified LDLs, oxidized LDLs, or a mixture of tumor necrosis factor-{alpha}, IL-1ß, and interferon-{gamma} (unpublished data). That very specific environmental conditions or cell phenotype are required for smooth muscle cells to produce IL-10 cannot be ruled out.

Expression of IL-10 in human atherosclerotic plaques may have several potential effects. Because IL-10 is a potent antiinflammatory cytokine with deactivating properties in macrophages,8 9 20 it is likely that its expression by plaque macrophages would limit the inflammatory response and promote plaque healing. It has recently been shown that endogenous production of IL-10 by human monocytes in response to LDL stimulation inhibits IL-12 production,19 indicating a cross-regulatory action of IL-10 that may counterbalance the proinflammatory response. In our study, IL-10 expression in advanced human atheroma was associated with a 3-fold decrease in the probability of iNOS expression. Because iNOS is a major mediator of the inflammatory reaction, our results strongly suggest a local antiinflammatory role for IL-10 in human atherosclerosis.

Apoptosis is known to occur in the atherosclerotic plaque.10 14 15 16 17 18 The TUNEL method may, in some instances, reveal other processes than apoptosis,11 essentially because of delayed prefixation times and misuse of proteinase K. In the present study, tissues were immediately fixed in 4% paraformaldehyde after carotid endarterectomy and digestion with proteinase K before TUNEL labeling was omitted. Such material processing greatly enhances the specificity of TUNEL for apoptosis.11 Moreover, we have previously shown that TUNEL staining in the plaque is highly associated with caspase-3 expression10 and it is well accepted that caspases are specific features of apoptosis.21 Several potential inducers of apoptosis in the plaque have been identified including oxidized LDLs and proinflammatory cytokines.22 23 However, little is known about the expression of antiapoptotic factors in human atherosclerosis. Our study supports that the counterregulatory effect induced by anti-inflammatory cytokines, especially IL-10, on the inflammatory response may protect from excessive cell damage and death in the plaque. Our results are in agreement with previous studies showing antiapoptotic properties for IL-10 in cultured macrophages24 and in T lymphocytes.25 In addition, the strong association between iNOS expression and TUNEL labeling in the plaque might be explained by the reported apoptotic effects of inflammatory NO.23 26 In the presence of the superoxide anion, NO might lead to local peroxynitrite formation,11 27 which is also a potent inducer of cell death.28

In conclusion, we show that IL-10 is expressed in advanced human atherosclerosis and is associated with low iNOS expression and low levels of cell death. Therefore, IL-10 may play a critical role in atherosclerotic plaque formation and progression.


*    Acknowledgments
 
This work was supported in part by grant CNAMTS/INSERM no. 4API12 and Projet Hospitalier de Recherche Clinique.

Received August 7, 1998; accepted August 19, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Barath P, Fishlein MC, Cao J, Berenson J, Helfant RH, Forrester JS. Detection and localization of tumor necrosis factor in human atheroma. Am J Cardiol. 1990;65:297–302.[Medline] [Order article via Infotrieve]

2. Clinton SK, Fleet JC, Loppnow H, Salomon RN, Clark BD, Cannon JG, Shaw AR, Dinarello CA, Libby P. Interleukin-1 gene expression in rabbit vascular tissue in vivo. Am J Pathol. 1991;138:1005–1014.[Abstract]

3. Seino Y, Ikeda U, Ikeda M, Hasegawa T, Misawa Y, Yamamoto K, Kano S, Shimada K. Interleukin 6 gene transcripts are expressed in human atherosclerotic lesions. Cytokine. 1994;6:87–91.[Medline] [Order article via Infotrieve]

4. Hansson GK, Holm J, Jonasson L. Detection of activated T lymphocytes in the human atherosclerotic plaque. Am J Pathol. 1989;135:169–175.[Abstract]

5. Kishikawa H, Shimokama T, Watanabe T. Localization of T lymphocytes and macrophages expressing IL-1, IL-2 receptor, IL-6 and TNF in human aortic intima. Role of cell-mediated immunity in human atherogenesis. Virchows Arch. 1993;423:433–442.

6. Libby P, Hansson GK. Involvement of the immune system in human atherogenesis: current knowledge and unanswered questions. Lab Invest. 1991;64:5–15.[Medline] [Order article via Infotrieve]

7. Lee RT, Libby P. The unstable atheroma. Arterioscler Thromb Vasc Biol. 1997;17:1859–1867.[Free Full Text]

8. de Vries JE. Immunosuppressive and anti-inflammatory properties of interleukin 10. Ann Med. 1995;27:537–541.[Medline] [Order article via Infotrieve]

9. de Waal Malefyt R, Abrams RJ, Bennett B, Figdor CG, de Vries JE. Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes—an autoregulatory role of IL-10 produced by monocytes. J Exp Med. 1991;174:1209–1220.[Abstract/Free Full Text]

10. Mallat Z, Ohan J, Lesèche G, Tedgui A. Colocalization of CPP-32 with apoptotic cells in human atherosclerotic plaques. Circulation. 1997;96:424–428.[Abstract/Free Full Text]

11. Kockx MM, Muhring J, Knaapen MW, de Meyer GR. RNA synthesis and splicing interferes with DNA in situ end labeling techniques used to detect apoptosis. Am J Pathol. 1998;152:885–888.[Abstract]

12. Vieira P, de Waal-Malefyt R, Dang MN, Johnson KE, Kastelein R, Fiorentino DF, deVries JE, Roncarolo MG, Mosmann TR, Moore KW. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: homology to Epstein-Barr virus open reading frame BCRFI. Proc Natl Acad Sci U S A. 1991;88:1172–1176.[Abstract/Free Full Text]

13. Buttery LD, Springall DR, Chester AH, Evans TJ, Standfield EN, Parums DV, Yacoub MH, Polak JM. Inducible nitric oxide synthase is present within human atherosclerotic lesions and promotes the formation and activity of peroxynitrite. Lab Invest. 1996;75:77–85.[Medline] [Order article via Infotrieve]

14. Geng Y-J, Libby P. Evidence for apoptosis in advanced human atheroma. Colocalization with interleukin-1ß-converting enzyme. Am J Pathol. 1995;147:251–266.[Abstract]

15. Isner JM, Kearney M, Bortman S, Passeri J. Apoptosis in human atherosclerosis and restenosis. Circulation. 1995;91:2703–2711.[Abstract/Free Full Text]

16. Han DKM, Haudenschild CC, Hong MK, Tinkle BT, Leon MB, Liau G. Evidence for apoptosis in human atherogenesis and in a rat vascular injury model. Am J Pathol. 1995;147:267–277.[Abstract]

17. Björkerud S, Björkerud B. Apoptosis is abundant in human atherosclerotic lesions, especially in inflammatory cells (macrophages and T cells), and may contribute to the accumulation of gruel and plaque instability. Am J Pathol. 1996;149:367–380.[Abstract]

18. Cai W, Devaux B, Schaper W, Schaper J. The role of Fas/APO 1 and apoptosis in the development of human atherosclerotic lesions. Atherosclerosis. 1997;131:177–186.[Medline] [Order article via Infotrieve]

19. Uyemura K, Demer LL, Castle SC, Jullien D, Berliner JA, Gately MK, Warrier RR, Pham N, Fogelman AM, Modlin RL. Cross-regulatory roles of interleukin (IL)-12 and IL-10 in atherosclerosis. J Clin Invest. 1996;97:2130–2138.[Medline] [Order article via Infotrieve]

20. Gérard C, Bruyns C, Marchant A, Abramowicz D, Vandebeele P, Delvaux A, Fiers W, Goldman M, Velu T. Interleukin-10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J Exp Med. 1993;177:547–550.[Abstract/Free Full Text]

21. Dong Z, Saikumar P, Weinberg JM, Venkatachalam MA. Internucleosomal DNA cleavage triggered by plasma membrane damage during necrotic cell death. Involvement of serine but not cysteine proteases. Am J Pathol. 1997;151:1205–1213.[Abstract]

22. Mitchinson MJ, Hardwick SJ, Bennett MR. Cell death in atherosclerotic plaques. Curr Opin Lipidol. 1996;7:324–329.[Medline] [Order article via Infotrieve]

23. Geng YJ, Wu Q, Muszynski M, Hansson GK, Libby P. Apoptosis of vascular smooth muscle cells induced by in vitro stimulation with interferon-gamma, tumor necrosis factor-alpha, and interleukin-1 beta. Arterioscler Thromb Vasc Biol. 1996;16:19–27.[Abstract/Free Full Text]

24. Arai T, Hiromatsu K, Nishimura H, Kimura Y, Kobayashi N, Ishida H, Nimura Y, Yoshikai Y. Endogenous interleukin 10 prevents apoptosis in macrophages during salmonella infection. Biochem Biophys Res Commun. 1995;213:600–607.[Medline] [Order article via Infotrieve]

25. Cohen SB, Crawley JB, Kahan MC, Feldmann M, Foxwell BM. Interleukin-10 rescues T cells from apoptotic cell death: association with an upregulation of Bcl-2. Immunology. 1997;92:1–5.[Medline] [Order article via Infotrieve]

26. Albina JE, Cui SJ, Mateo RB, Reichner JS. Nitric-oxide-mediated apoptosis in murine peritoneal macrophages. J Immunol. 1993;150:5080–5085.[Abstract]

27. Luoma JS, Stralin P, Marklund SL, Hiltunen TP, Sarkioja T, Yla-Herttuala S. Expression of extracellular SOD and iNOS in macrophages and smooth muscle cells in human and rabbit atherosclerotic lesions: colocalization with epitopes characteristic of oxidized LDL and peroxynitrite-modified proteins. Arterioscler Thromb Vasc Biol. 1998;18:157–167.[Abstract/Free Full Text]

28. Szabo C. DNA strand breakage and activation of poly-ADP ribosyltransferase: a cytotoxic pathway triggered by peroxynitrite. Free Radic Biol Med. 1996;21:855–869.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
J. J. Boyle, H. A. Harrington, E. Piper, K. Elderfield, J. Stark, R. C. Landis, and D. O. Haskard
Coronary Intraplaque Hemorrhage Evokes a Novel Atheroprotective Macrophage Phenotype
Am. J. Pathol., March 1, 2009; 174(3): 1097 - 1108.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. P. Edwards, X. Zhang, and D. M. Mosser
The Expression of Heparin-Binding Epidermal Growth Factor-Like Growth Factor by Regulatory Macrophages
J. Immunol., February 15, 2009; 182(4): 1929 - 1939.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
C. Stumpf, K. Seybold, S. Petzi, G. Wasmeier, D. Raaz, A. Yilmaz, T. Anger, W. G. Daniel, and C. D. Garlichs
Interleukin-10 improves left ventricular function in rats with heart failure subsequent to myocardial infarction
Eur J Heart Fail, August 1, 2008; 10(8): 733 - 739.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Schulte, G. K. Sukhova, and P. Libby
Genetically Programmed Biases in Th1 and Th2 Immune Responses Modulate Atherogenesis
Am. J. Pathol., June 1, 2008; 172(6): 1500 - 1508.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
W.-S. Lim, J. M. Timmins, T. A. Seimon, A. Sadler, F. D. Kolodgie, R. Virmani, and I. Tabas
Signal Transducer and Activator of Transcription-1 Is Critical for Apoptosis in Macrophages Subjected to Endoplasmic Reticulum Stress In Vitro and in Advanced Atherosclerotic Lesions In Vivo
Circulation, February 19, 2008; 117(7): 940 - 951.
[Abstract] [Full Text] [PDF]


Home page
Vasc MedHome page
H.R.S. Girn, N.M. Orsi, and S. Homer-Vanniasinkam
An overview of cytokine interactions in atherosclerosis and implications for peripheral arterial disease
Vascular Medicine, November 1, 2007; 12(4): 299 - 309.
[Abstract] [PDF]


Home page
Cardiovasc ResHome page
S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor
CD36 and macrophages in atherosclerosis
Cardiovasc Res, August 1, 2007; 75(3): 468 - 477.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. P. Levy, J. E. Levy, S. Kalet-Litman, R. Miller-Lotan, N. S. Levy, R. Asaf, J. Guetta, C. Yang, K. R. Purushothaman, V. Fuster, et al.
Haptoglobin Genotype Is a Determinant of Iron, Lipid Peroxidation, and Macrophage Accumulation in the Atherosclerotic Plaque
Arterioscler Thromb Vasc Biol, January 1, 2007; 27(1): 134 - 140.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
D. N. Tziakas, G. K. Chalikias, C. O. Antonoglou, S. Veletza, I. K. Tentes, A. X. Kortsaris, D. I. Hatseras, and J. C. Kaski
Apolipoprotein E Genotype and Circulating Interleukin-10 Levels in Patients With Stable and Unstable Coronary Artery Disease
J. Am. Coll. Cardiol., December 19, 2006; 48(12): 2471 - 2481.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
U. Singh, S. Devaraj, M. R. Dasu, D. Ciobanu, J. Reusch, and I. Jialal
C-Reactive Protein Decreases Interleukin-10 Secretion in Activated Human Monocyte-Derived Macrophages via Inhibition of Cyclic AMP Production
Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2469 - 2475.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
T Kilic, D Ural, E Ural, Z Yumuk, A Agacdiken, T Sahin, G Kahraman, G Kozdag, A Vural, and B Komsuoglu
Relation between proinflammatory to anti-inflammatory cytokine ratios and long-term prognosis in patients with non-ST elevation acute coronary syndrome
Heart, August 1, 2006; 92(8): 1041 - 1046.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K. Nishihira, T. Imamura, A. Yamashita, K. Hatakeyama, Y. Shibata, Y. Nagatomo, H. Date, T. Kita, T. Eto, and Y. Asada
Increased expression of interleukin-10 in unstable plaque obtained by directional coronary atherectomy
Eur. Heart J., July 2, 2006; 27(14): 1685 - 1689.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Kaur, A. K. Sharma, and P. K. Singal
Significance of changes in TNF-{alpha} and IL-10 levels in the progression of heart failure subsequent to myocardial infarction
Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H106 - H113.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
K. B. Holven, B. Halvorsen, V. Bjerkeli, J. K. Damas, K. Retterstol, L. Morkrid, L. Ose, P. Aukrust, and M. S. Nenseter
Impaired Inhibitory Effect of Interleukin-10 on the Balance Between Matrix Metalloproteinase-9 and Its Inhibitor in Mononuclear Cells From Hyperhomocysteinemic Subjects
Stroke, July 1, 2006; 37(7): 1731 - 1736.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
G. Stoll and M. Bendszus
Inflammation and Atherosclerosis: Novel Insights Into Plaque Formation and Destabilization
Stroke, July 1, 2006; 37(7): 1923 - 1932.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Zernecke, E. A. Liehn, J.-L. Gao, W. A. Kuziel, P. M. Murphy, and C. Weber
Deficiency in CCR5 but not CCR1 protects against neointima formation in atherosclerosis-prone mice: involvement of IL-10
Blood, June 1, 2006; 107(11): 4240 - 4243.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. Tedgui and Z. Mallat
Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways
Physiol Rev, April 1, 2006; 86(2): 515 - 581.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. A. Gunnett, D. D. Lund, F. M. Faraci, and D. D. Heistad
Vascular interleukin-10 protects against LPS-induced vasomotor dysfunction
Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H624 - H630.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
B. Halvorsen, T. Waehre, H. Scholz, O. P. Clausen, J. H. von der Thusen, F. Muller, H. Heimli, S. Tonstad, C. Hall, S. S. Froland, et al.
Interleukin-10 enhances the oxidized LDL-induced foam cell formation of macrophages by antiapoptotic mechanisms
J. Lipid Res., February 1, 2005; 46(2): 211 - 219.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Huang, T. Li, D. C. Sane, and L. Li
IRAK1 Serves as a Novel Regulator Essential for Lipopolysaccharide-induced Interleukin-10 Gene Expression
J. Biol. Chem., December 3, 2004; 279(49): 51697 - 51703.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
B. Schieffer, T. Selle, A. Hilfiker, D. Hilfiker-Kleiner, K. Grote, U. J.F. Tietge, C. Trautwein, M. Luchtefeld, C. Schmittkamp, S. Heeneman, et al.
Impact of Interleukin-6 on Plaque Development and Morphology in Experimental Atherosclerosis
Circulation, November 30, 2004; 110(22): 3493 - 3500.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. L. Rossi, N. Marziliano, P. A. Merlini, E. Bramucci, U. Canosi, G. Belli, D. Z. Parenti, P. M. Mannucci, and D. Ardissino
Different Quantitative Apoptotic Traits in Coronary Atherosclerotic Plaques From Patients With Stable Angina Pectoris and Acute Coronary Syndromes
Circulation, September 28, 2004; 110(13): 1767 - 1773.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Gojova, V. Brun, B. Esposito, F. Cottrez, P. Gourdy, P. Ardouin, A. Tedgui, Z. Mallat, and H. Groux
Specific abrogation of transforming growth factor-{beta} signaling in T cells alters atherosclerotic lesion size and composition in mice
Blood, December 1, 2003; 102(12): 4052 - 4058.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. Girndt and H. Kohler
Interleukin-10 (IL-10): an update on its relevance for cardiovascular risk
Nephrol. Dial. Transplant., October 1, 2003; 18(10): 1976 - 1979.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. OSTERUD and E. BJORKLID
Role of Monocytes in Atherogenesis
Physiol Rev, October 1, 2003; 83(4): 1069 - 1112.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Heeschen, S. Dimmeler, C. W. Hamm, S. Fichtlscherer, E. Boersma, M. L. Simoons, A. M. Zeiher, and for the CAPTURE Study Investigators
Serum Level of the Antiinflammatory Cytokine Interleukin-10 Is an Important Prognostic Determinant in Patients With Acute Coronary Syndromes
Circulation, April 29, 2003; 107(16): 2109 - 2114.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Esposito, A. Pontillo, F. Giugliano, G. Giugliano, R. Marfella, G. Nicoletti, and D. Giugliano
Association of Low Interleukin-10 Levels with the Metabolic Syndrome in Obese Women
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1055 - 1058.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
J. H. Von der Thusen, J. Kuiper, T. J. C. Van Berkel, and E. A. L. Biessen
Interleukins in Atherosclerosis: Molecular Pathways and Therapeutic Potential
Pharmacol. Rev., March 1, 2003; 55(1): 133 - 166.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Maron, G. Sukhova, A.-M. Faria, E. Hoffmann, F. Mach, P. Libby, and H. L. Weiner
Mucosal Administration of Heat Shock Protein-65 Decreases Atherosclerosis and Inflammation in Aortic Arch of Low-Density Lipoprotein Receptor-Deficient Mice
Circulation, September 24, 2002; 106(13): 1708 - 1715.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Tedgui and Z. Mallat
Platelets in Atherosclerosis: A New Role for {beta}-Amyloid Peptide Beyond Alzheimer's Disease
Circ. Res., June 14, 2002; 90(11): 1145 - 1146.
[Full Text] [PDF]


Home page
DiabetesHome page
C. A. Gunnett, D. D. Heistad, and F. M. Faraci
Interleukin-10 Protects Nitric Oxide-Dependent Relaxation During Diabetes: Role of Superoxide
Diabetes, June 1, 2002; 51(6): 1931 - 1937.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E. Lutgens, M. Gijbels, M. Smook, P. Heeringa, P. Gotwals, V. E. Koteliansky, and M. J.A.P. Daemen
Transforming Growth Factor-{beta} Mediates Balance Between Inflammation and Fibrosis During Plaque Progression
Arterioscler Thromb Vasc Biol, June 1, 2002; 22(6): 975 - 982.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. J. Pinderski, M. P. Fischbein, G. Subbanagounder, M. C. Fishbein, N. Kubo, H. Cheroutre, L. K. Curtiss, J. A. Berliner, and W. A. Boisvert
Overexpression of Interleukin-10 by Activated T Lymphocytes Inhibits Atherosclerosis in LDL Receptor-Deficient Mice by Altering Lymphocyte and Macrophage Phenotypes
Circ. Res., May 31, 2002; 90(10): 1064 - 1071.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J.-S. Silvestre, R. Tamarat, T. Senbonmatsu, T. Icchiki, T. Ebrahimian, M. Iglarz, S. Besnard, M. Duriez, T. Inagami, and B. I. Levy
Antiangiogenic Effect of Angiotensin II Type 2 Receptor in Ischemia-Induced Angiogenesis in Mice Hindlimb
Circ. Res., May 31, 2002; 90(10): 1072 - 1079.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
N. Lamblin, C. Bauters, and N. Helbecque
Gene polymorphisms of pro- (or anti-) inflammatory cytokines and vascular disease
Eur. Heart J., December 2, 2001; 22(24): 2219 - 2220.
[PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. K. Hansson
Immune Mechanisms in Atherosclerosis
Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 1876 - 1890.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Mallat, A. Corbaz, A. Scoazec, P. Graber, S. Alouani, B. Esposito, Y. Humbert, Y. Chvatchko, and A. Tedgui
Interleukin-18/Interleukin-18 Binding Protein Signaling Modulates Atherosclerotic Lesion Development and Stability
Circ. Res., September 28, 2001; 89 (7): e41 - e45.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. A. Smith, S. D. Irving, J. Sheldon, D. Cole, and J. C. Kaski
Serum Levels of the Antiinflammatory Cytokine Interleukin-10 Are Decreased in Patients With Unstable Angina
Circulation, August 14, 2001; 104(7): 746 - 749.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
J.C. Kaski and E.G. Zouridakis
Inflammation, infection and acute coronary plaque events
Eur. Heart J. Suppl., August 1, 2001; 3(suppl_I): I10 - I15.
[Abstract] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. P. Jones, S. D. Trocha, and D. J. Lefer
Cardioprotective actions of endogenous IL-10 are independent of iNOS
Am J Physiol Heart Circ Physiol, July 1, 2001; 281(1): H48 - H52.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Mallat and A. Tedgui
Current Perspective on the Role of Apoptosis in Atherothrombotic Disease
Circ. Res., May 25, 2001; 88(10): 998 - 1003.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Tedgui and Z. Mallat
Anti-Inflammatory Mechanisms in the Vascular Wall
Circ. Res., May 11, 2001; 88(9): 877 - 887.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
E. Mostafa Mtairag, S. Chollet-Martin, M. Oudghiri, N. Laquay, M.-P. Jacob, J.-B. Michel, and L. J. Feldman
Effects of interleukin-10 on monocyte/endothelial cell adhesion and MMP-9/TIMP-1 secretion
Cardiovasc Res, March 1, 2001; 49(4): 882 - 890.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. J. Feldman, L. Aguirre, M. Ziol, J.-P. Bridou, N. Nevo, J.-B. Michel, and P. G. Steg
Interleukin-10 Inhibits Intimal Hyperplasia After Angioplasty or Stent Implantation in Hypercholesterolemic Rabbits
Circulation, February 29, 2000; 101(8): 908 - 916.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. J. Pinderski Oslund, C. C. Hedrick, T. Olvera, A. Hagenbaugh, M. Territo, J. A. Berliner, and A. I. Fyfe
Interleukin-10 Blocks Atherosclerotic Events In Vitro and In Vivo
Arterioscler Thromb Vasc Biol, December 1, 1999; 19(12): 2847 - 2853.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Mallat, S. Besnard, M. Duriez, V. Deleuze, F. Emmanuel, M. F. Bureau, F. Soubrier, B. Esposito, H. Duez, C. Fievet, et al.
Protective Role of Interleukin-10 in Atherosclerosis
Circ. Res., October 15, 1999; 85 (8): e17 - e24.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Mallat, A. Gojova, C. Marchiol-Fournigault, B. Esposito, C. Kamate, R. Merval, D. Fradelizi, and A. Tedgui
Inhibition of Transforming Growth Factor-{beta} Signaling Accelerates Atherosclerosis and Induces an Unstable Plaque Phenotype in Mice
Circ. Res., November 9, 2001; 89(10): 930 - 934.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mallat, Z.
Right arrow Articles by Tedgui, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mallat, Z.
Right arrow Articles by Tedgui, A.
Related Collections
Right arrow Pathophysiology
Right arrow Growth factors/cytokines
Right arrow Endothelium/vascular type/nitric oxide