This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Houston, P. Articles by Braddock, M. Search for Related Content PubMed PubMed Citation Articles by Houston, P. Articles by Braddock, M. Related Collections Animal models of human disease Gene expression Growth factors/cytokines Endothelium/vascular type/nitric oxide Mechanism of atherosclerosis/growth factors

(Arteriosclerosis, Thrombosis, and Vascular Biology. 1999;19:281-289.)
© 1999 American Heart Association, Inc.

Original Contributions

Fluid Shear Stress Induction of the Tissue Factor Promoter In Vitro and In Vivo Is Mediated by Egr-1

Parul Houston; Marion C. Dickson; Valerie Ludbrook; Brian White; Jean-Luc Schwachtgen; John H. McVey; Nigel Mackman; Jason M. Reese; Daniel G. Gorman; Callum Campbell; Martin Braddock

From the Endothelial Cell Gene Expression Group, Vascular Disease Unit, Glaxo-Wellcome Medicines Research Centre, Stevenage (P.H., M.C.D., V.L., B.W., J.-L.S., C.C., M.B.), and the Haemostasis Research Group, MRC Clinical Sciences Centre, London (J.H.M.), UK; the Department of Immunology, The Scripps Research Institute, La Jolla, California (N.M.); and the Department of Engineering, University of Aberdeen, Scotland (J.M.R., D.G.G.).

Correspondence to Martin Braddock, Endothelial Cell Gene Expression Group, Vascular Disease Unit, Glaxo-Wellcome Medicines Research Centre, Gunnels Wood Road, Stevenage, Herts SG1 2NY, England. E-mail MB4554{at}ggr.co.uk

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Hemodynamic forces such as fluid shear stress have been shown to modulate the activity of an expanding family of genes involved in vessel wall homeostasis and the pathogenesis of vascular disease. We have investigated the effect of shear stress on tissue factor (TF) gene expression in human endothelial cells (ECs) and in a rat arterial model of occlusion. As measured by reverse transcriptase polymerase chain reaction, exposure of ECs to 1.5 N/m² shear stress resulted in a time-dependent induction of endogenous TF transcripts of over 5-fold. Transient transfection of TF promoter mutants into cultured ECs suggests the involvement of the transcription factor Egr-1 in mediating the response of the TF promoter to shear stress. To address the importance of flow induction of Egr-1 in vivo, we have established a flow-restricted rat arterial model and determined the level of expressed Egr-1 and TF at the site of restricted flow using immunohistochemistry. We report an increase in the level of Egr-1 and TF protein in ECs expressed at the site of restricted flow. Elevated expression of Egr-1 and TF is restricted to a highly localized area, as evidenced by the fact that no significant increase in level can be detected at arterial sites distal to the site of occlusion. These findings suggest a direct role for Egr-1 in flow-mediated induction of TF and further substantiate the importance of shear stress as a modulator of vascular endothelial gene function in vivo.

Key Words: fluid shear stress • tissue factor promoter • Egr-1 transcription factor • vascular endothelial cells

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Endothelial cells (ECs) lining the inner surface of blood vessels are constantly exposed to blood flow. Locally disturbed flow at arterial curvatures or bifurcations is characterized by both low and high oscillatory wall shear stresses that are conveyed to the cell as both a change in pressure and a change in the stretch capacity of the EC lining.^{1 2 3} As a consequence of the local perturbation in laminar shear stress, a number of genes have been identified whose promoter activity is positively or negatively regulated by shear stress (reviewed in References 4⁴ to 8). Several cis-acting elements have been implicated in mediating shear modulation of gene expression, and the term shear stress responsive element (SSRE) was first proposed after the identification of the sequence GAGACC.⁹ This SSRE was demonstrated to confer shear stress responsiveness on the platelet-derived growth factor (PDGF) B promoter,⁹ a heterologous SV40 promoter,¹⁰ and has since been located in a number of other promoters that have been shown to be shear stress responsive in ECs.¹¹ The GAGACC sequence binds nuclear factor B (NF-B) p50–p65 heterodimers, and consistent with this observation, the wild-type HIV-1 LTR, but not an LTR lacking the NF-B binding site, was also shown to be responsive to shear stress.⁵ Other transcription factors that have been shown to mediate shear stress activation of a promoter are AP1,^{12 13} Sp1,¹⁴ and Egr-1.¹⁵

Recently, the transcription factor Egr-1 has been suggested to play a role as a common factor in vascular injury¹⁶ trans-activating the expression of a number of genes in the vascular endothelium.¹⁷ Fluid shear stress has been shown to stimulate the production of Egr-1 RNA¹⁵ and protein,¹⁸ and upregulation of the PDGF A proximal promoter by shear stress involves displacement of prebound Sp1 by Egr-1.¹⁵ Previous studies have reported increased activity of tissue factor (TF) under flow conditions, as measured by the conversion of factor X to factor Xa.^{19 20 21} We now report the identification of a minimal TF promoter that is shear stress responsive and relies on the cellular transcription factor Egr-1 for shear stress–mediated trans-activation. We show that Egr-1 and TF are both upregulated at the site of arterial stenosis in vivo. Thus, TF is a further gene to be modified in this manner by biomechanical forces, adding more evidence for the importance of Egr-1 as a fluid shear stress–responsive transcription factor.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
EC Culture
Human aortic ECs (HAECs) and human umbilical vein ECs (HUVECs) were purchased from Clonetics, frozen in liquid nitrogen. Cells were thawed and maintained in endothelial growth medium (EGM-2) supplemented with 2% fetal calf serum, vascular endothelial growth factor (2 ng/mL), recombinant insulin-like growth factor-1 (5 ng/mL), ascorbic acid (75 µg/mL), human epidermal growth factor (10 ng/mL), gentamycin (50 µg/mL), amphotericin B (50 µg/mL), heparin (0.5 ng/mL), human fibroblast growth factor (2 ng/mL), and hydrocortisone (500 ng/mL). The cells were passaged using trypsin/EDTA (Life Sciences) and maintained in a humidified atmosphere of 5% CO₂ at 37°C.

Cell Transfection and Shear Stress Conditions
Cells were transfected by electroporation using an EasyJect electroporator (Flowgen). Cells were used up to a maximum of passage 5 for all transfection experiments. Briefly, cells were grown to confluence, passaged, and electroporated using 2x10⁶ cells/mL per data point. DNA was prepared by standard alkaline lysis and column purification (Qiagen). Reporter DNA (10 µg) was transfected, together with 1 µg of human cytomegalovirus (CMV) promoter-ß (Promega), which functioned as a normalizing plasmid for transfection efficiency. Protein extracts containing an equal number of ß-galactosidase units were assayed for chloramphenicol acetyltransferase (CAT) or luciferase activity. For all transfections, 30 µg of pBluescript (Stratagene) was used as an inert carrier DNA. In trans-activation experiments, the total amount of DNA for all experiments was constant and made up to a total of 30 µg DNA with pBluescript. Cells were electroporated at 350 V as described,²² with the modification that the cells were not synchronized. After electroporation, 5 mL of complete EGM-2 medium was added and cells were plated out into slide flaskettes (Nunc) in duplicate. Laminar shear stress was applied to transfected cells at 1.5 N/m² for 1 or 3 hours using parallel-plate flow chambers as described,⁴ set in series in a closed circulating system gassed with 5% CO₂ and maintained at 37°C. Parallel-plate flow chambers were custom made at the Glaxo-Wellcome Department of Bioengineering. The wall shear stress T_w, expressed in newtons per square meter was calculated using the standard equation T_w=3yQ/2a²b,²³ where y is the viscosity at 37°C in newton seconds per square meter, Q is the volumetric flow rate in milliliters per second, a is the half-channel height in centimeters, and b is the channel width in centimeters. Laminar shear stress was generated by the use of a Masterflex 7518–60 peristaltic pump and was shown to be linear within the range of 0.4 to 12.0 N/m².

CAT, Luciferase, and ß-Galactosidase Assays
Qualitatively identical results were obtained in both HAECs and HUVECs. After shear stress stimulation, cells were washed in PBS and lysed in reporter lysis buffer (Promega) for assay of luciferase and ß-galactosidase activity. For CAT assay, cells were disrupted in TEN buffer (10 mmol/L Tris-HCl, pH8; 1 mmol/L EDTA; 100 mmol/L NaCl) using a sonicator (MSE). CAT activity was measured using the Quan-T-CAT system as described²⁴ (Amersham). Luciferase activity was measured using a luminometer (Wallac) and ß-galactosidase activity assayed spectrophotometrically in the presence of the appropriate substrate (Promega). CAT and luciferase values were normalized to ß-galactosidase levels, and each data point represents the average of at least 3 separate experiments.

Semiquantitative Polymerase Chain Reaction of Endogenous TF
RNA was extracted, using a total RNeasy extraction kit (Qiagen), from 2x10⁵ cells, which were either static controls or subjected to 1 or 3 hours of laminar flow at 1.5 N/m². Semiquantitative reverse transcriptase polymerase chain reacton (RT-PCR) was performed as described.²⁵ cDNA was synthesized from 500 ng total RNA by reverse transcription. The reaction was carried out using MgCl₂ (5 mmol/L), 5x RT buffer (Promega), dNTPs (1 mmol/L; Promega), RNase inhibitor (20 U; Promega), oligo dT (500 ng; Boehringer Mannheim), and 12 U AMV reverse transcriptase (Promega) in a total volume of 20 µL. The reaction was incubated at 42°C for 30 minutes and the enzymes were denatured for 10 minutes at 95°C. The cDNA reaction product (3 µL) was added to the following: MgCl₂ (1.5 mmol/L), 10x buffer (Perkin-Elmer), dNTPs (200 µmol/L), Taq polymerase (2.5 U; Perkin-Elmer) with 20 pmol of TF primers (forward 5' TTA CCT GGA GAC AAA CCT CGG 3'; from nucleotide (nt) 501 to 521 [relative to the TF ATG at +1] and reverse 5' ATG ACC ACA AAT ACC ACA GCT 3'; from nt 890 to 870) and GAPDH primers (Clontech; forward 5' TGA GTA CGT CGT GGA GTC CAC 3'; from nt 71 to 96 [relative to the RNA start site at +1] and reverse 5' ACC AGG AAA TGA GCT TGA CA 3'; from nt 1030 to 1053). The reaction products were denatured for 5 minutes at 95°C followed by 26 cycles of 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute and a final elongation at 72°C for 10 minutes. The PCR products were detected by staining a 1.8% agarose gel with SYBR green (Molecular Probes). Quantitation was carried out using a Storm system and ImageQuant software (Molecular Dynamics).

Plasmid Constructions
TF promoter constructs have been described previously.^{26 27} Results are expressed as shear stress activation above the basal activity of the promoter construct. Plasmids expressing Egr-1 as wild type (p930) or mutant (1.5 zinc fingers deleted, p858) driven by the CMV promoter were a gift from Dr Vikas Sukhatme, Harvard Medical School, Boston, Mass. Plasmid pSP13, harboring an Egr-1 binding site and a TATA box, was constructed using an oligonucleotide with the sequence 5' GATCTGAATTCGCCCTAGCTCGCGGGGG- CGTCGCACTCTCTATAAAGGCCGGAACAGCTGAAAGA 3', which was cloned into BglII/HindIII–digested pGL3 basic luciferase reporter vector (Promega).

Electrophoretic Mobility Shift Assay and Immunoblotting
Electrophoretic mobility shift assays (EMSAs) were carried out using purified proteins commercially available (Promega and Santa Cruz) with an EMSA gel-shift kit (Promega). The oligonucleotide used for EMSA experiments represents positions -52 nt to -89 nt in the TF promoter and has the sequence 5' GGAGCGGCGGGGGCGGGCGCCGGGGGCGGGCAGAGG 3'. The Egr-1 site extends from -74 nt to -66 nt and the Sp1 site from -70 nt to -61 nt. ³²P-labeled DNA probes were generated using T4 polynucleotide kinase, and unincorporated radiolabeled nucleotide was removed as recommended by the manufacturer (Qiagen). Binding reactions were carried out at 20°C for 10 minutes using labeled probe (10⁵ cpm per reaction, 10⁸ cpm/µg) in the presence or absence of Egr-1 and/or Sp1 binding activity (30 ng per reaction) at the ratios described. The products of the binding reactions were separated on 6% acrylamide retardation gels (Novex) and run in 0.5x Tris-borate–EDTA buffer at 100 V for 90 minutes. Dried-down gels were exposed to autoradiography using Hyperfilm (Amersham).

The specificity of the TF antibody was determined using cell extracts of peripheral blood mononuclear cells (10⁶ cells), which were either unstimulated or stimulated with lipopolysaccharide (LPS; 100 ng/mL) for 6 hours (a kind gift from K. Buchan). Cells were disrupted by sonication, and protein extracts were run out on an 8% SDS-PAGE gel against MultiMark protein standards (Novex) and transferred to nitrocellulose by immunoblotting. Protein bands were detected using a horseradish peroxidase–conjugated second antibody and enhanced chemiluminescense detection (ECL; Amersham).

Rat Arterial Occlusion and Determination of Flow
Male Han Wistar rats (300 to 400 g) were anesthetized with inactin (120 mg/kg IP). After anesthesia, the trachea was cannulated and the animals were spontaneously allowed to respire room air. Body temperature was monitored by a rectal probe and was maintained at 37°C by the homeothermic blanket system (Harvard). The left jugular vein and left carotid artery were exposed by blunt dissection, and the left jugular vein was cannulated for intravenous administration of supplementary anesthetic. The left carotid artery was instrumented from proximal to distal with an ultrasonic flow probe (Transonic Systems Inc; 0.5 mm) and an adjustable mechanical occluder. The mechanical occluder was constructed by the Glaxo-Wellcome Department of Bioengineering following the description of a wire occluder.²⁸ The flow probe was connected to a flowmeter (Transonic model T206) for continuous display of phasic carotid artery blood flow. Blood flow was displayed on a thermal array recorder (Gould TA4000) linked to an MI² data acquisition system (Modular Instruments Inc.) After an equilibration period of at least 15 minutes to establish stable carotid artery blood flow, a stenosis was applied by gradually adjusting the mechanical occluder. The degree of occlusion was regulated, and the final stenosis resulted in approximately a 25%, 50%, or >75% reduction in mean carotid blood flow. Data were collected from occlusion experiments that generated approximately a 50% stenosis in 7 animals. The stenosis was maintained for 60 minutes, and the carotid artery was excised and placed in formalin ready for immunohistochemical analysis. The diameter of the left carotid artery was determined before and after the application of stenosis and expressed as percentage stenosis. The degree of stenosis in terms of decreased carotid blood flow was determined from the mean blood flow data and expressed as percentage decrease from the preocclusion mean value, together with the shear stress value over the stenosis for each of 7 separate experiments. Confirmation that flow regimes administered in vitro and in vivo represented laminar and not turbulent shear stress was obtained using standard computational fluid dynamics equations.²⁹ The Reynolds number Re_D, was calculated by the equation Re_D=4pQ/µD, where p is the fluid density (in kilograms per cubic meter), Q is the volumetric flow rate (in cubic meters per second), µ is the fluid dynamic viscosity (in newton seconds per square meter), and D is the hydraulic diameter of the vessel²⁹ (in meters). For the arterial experiments, D is simply the diameter of the artery. The flow chamber used for in vitro flow experiments has a rectangular cross-section, so the appropriate hydraulic diameter D is 2ab/(a+b), where a and b are the width and height of the channel, respectively (in meters). Applying these equations to the two cases under consideration, the minimum Reynolds number obtained was 16 for the arterial occlusion experiments and 1240 for the in vitro flow experiments. Both values for Re_D are within the critical Reynolds number for flow in vessels of 2300, which indicates the onset of turbulent flow conditions, assuming that the maximal wall shear stress occurs in the throat of the stenosis. The shear stress was calculated at the stenosis, assuming that as the blood flow passes over the stenosis, the momentum boundary does not separate from the wall, a reasonable assumption for a smooth stenosis such as generated by our occluder. In addition, we assume that the flow is fully developed within the occluded artery. Given these assumptions, for laminar flow in an artery, the average wall shear stress T_w in the artery is T_w=0.5pU²f, where U is the mean velocity in the arterial occlusion, f is the friction factor, and p is the fluid density (in kilograms/cubic meter).²⁹

Immunohistochemistry
Arterial sections were embedded in paraffin and dewaxed as described.³⁰ Sections were blocked for 20 minutes in 1% hydrogen peroxide and then rinsed in PBS. Anti–Egr-1 antibody (100 µL; Santa Cruz), rabbit anti-human TF₁₄₃ antibody (J. McVey; 143 refers to amino acids 1 through 143), or rabbit anti-human von Willebrand factor (vWF) antibody (Dako) was diluted 1:100 in 0.5% BSA/PBS, applied to the slides, and left for 45 minutes. Slides were washed in 0.5% Tween 80/PBS and then in PBS. Biotinylated anti-rabbit secondary antibody (Vector) diluted in 0.5% BSA, 0.8% NaCl/PBS was applied to slides for 30 minutes. Avidin-biotin complex (ABC; Vector laboratories) was diluted in 0.5% BSA with a 1:100 dilution of avidin and biotin and 0.8% NaCl. This mix was left to stand for 30 minutes, and 100 µL was then added to each slide and incubated for 30 minutes. Slides were washed in 0.5% Tween 80/PBS and then rinsed with PBS. Detection of antigen-antibody complexes was carried out with the diaminobenzidine detection system (Sigma) using a 5-minute detection time. Slides were then counterstained in Meyer's hematoxylin for 10 seconds, dehydrated, cleared, and mounted for microscopy.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Endogenous TF Expression is Upregulated by Shear Stress
Laminar shear stress has been shown to activate the expression of a number of genes involved in vessel wall homeostasis and vascular injury.^{4 5 6 7 8} We reasoned that a change in shear stress may activate the expression of TF. To address this, we subjected HAECs to shear stress of 1.5 N/m² for 1 and 3 hours and compared the level of TF mRNA transcripts produced in comparison to ECs that had not received shear stress stimulation. The level of TF mRNA transcripts was measured using RT-PCR²³ and compared with the level of GAPDH mRNA, which served as an internal control. As shown in Figure 1, endogenous TF mRNA levels increased after only 1 hour to 3.6-fold that of the static control and further increased to 5.2-fold that of the static control after 3 hours of shear stress. The basal level of TF mRNA was barely detectable under zero flow conditions, in agreement with previous observations.^{19 20 21}

View larger version (40K): [in this window] [in a new window]   Figure 1. Shear stress activation of transcription of the endogenous TF gene in HAECs. RT-PCR showing shear stress upregulation of TF transcription with time at 1.5 N/m.2 GAPDH standards were used as an internal control. Data shown are representative of at least 3 independent experiments. M represents molecular weight markers shown in base pairs.

Identification of a Novel SSRE in the TF Promoter
TF promoter deletion constructs are described in Figure 2A. For transfection experiments, 10 µg of promoter reporter construct was transfected into HAECs by electroporation and cells were seeded into slide flaskettes and subjected to zero flow or flow for 3 hours at 1.5 N/m² at 18 hours posttransfection (Figure 2B). Previous studies have shown that NF-B and AP1 are required for response of the TF promoter to LPS stimulation in monocytic cells and ECs.³¹ Plasmid p526, which contains 1.373 kb of promoter sequence, including NF-B and AP1 binding sites, was transfected in HAECs and reporter assays were carried out on cell lysates from cultures harvested in the absence or presence of flow. We observed a stimulation of promoter activity by flow of approximately 8-fold (Figure 2B). Plasmid p529, which contains 383 nt of promoter sequence, showed similar activation in response to flow. Plasmid construct p543 contains 111 nt of promoter sequence and harbors binding sites for Sp1 and Egr-1 transcription factors but does not contain a functional NF-B or AP1 binding site. This promoter fragment was also shear responsive to the same extent as plasmids p526 and p529. This result suggests that the response of the TF promoter resides within a 111-bp fragment and may be functioning via the Sp1 and Egr-1 transcription factors.

View larger version (15K): [in this window] [in a new window]   Figure 2. A, Diagram of 5' deletion mutants of the TF promoter. Promoter coordinates are indicated relative to the transcription start site at +1. Transcription factor binding sites within the TF promoter are indicated. Constructs p526, p529, p533, and p543 have been described.27 B, Response of 5' deletion mutants of the TF promoter to shear stress. HAECs were transfected with promoter reporter plasmids, as indicated in Methods, and cells flowed at 1.5 N/m2 for 3 hours. The basal level of promoter activities is shown, together with the activated levels. The shear activation ratio is derived after normalization of reporter gene activity by cotransfection with a CMV ß-galactosidase plasmid. Results shown are the average of at least 3 separate experiments.

Previous studies have identified several classes of shear stress–responsive genes whose response to shear is either rapid and transient, rapid and longer lived, or slow and sustained.^{4 5 6 7 8} To characterize the response of the TF promoter, we sought to determine the minimum time of exposure to shear that would result in the largest increase in promoter activity. To do this, we transfected HAECs with plasmid p526 and 18 hours after transfection applied shear stress for time intervals of up to 24 hours, removing samples at the time points indicated. The results shown in Figure 3 show a peak of promoter activity at 4 hours after the application of stimulus, with activity gradually declining to basal levels at 24 hours, in good agreement with a previous study.¹⁴ We then asked whether this activity was correlated with the level of Egr-1 protein produced under shear. We have recently shown a rapid induction of Egr-1 protein after only 15 minutes' exposure to shear, which was sustained over a 7-hour period and rapidly declined to a low but significant level after 18 hours under flow conditions.¹⁸ These data suggest that the response of the TF promoter to shear stress is rapid and transient and parallels the shear induction of Egr-1, which is likewise rapidly induced by shear stress.

View larger version (11K): [in this window] [in a new window]   Figure 3. Time course of the activation of the TF promoter by shear stress. Plasmid p526 was transfected into HAECs as described in Figure 4. Reporter gene activity was determined at the time points indicated in the figure.

The sequence of the minimal shear-responsive element in the TF promoter contains overlapping Sp1/Egr-1 transcription factor binding sites distinct from 2 upstream Sp1 binding sites. We reasoned that shear stress activation of this TF promoter construct may be mediated via this Sp1/Egr-1 interaction and carried out EMSAs and mutational analysis of this region to determine the role of these factors. Deletion of the two distal Sp1 sites (compare p529 with p543; Figure 2B.) had little effect on the ability of p543 to be activated by shear stress, presumably because the basal level of transcription could be maintained by binding of Sp1 to its proximal cognate binding sites, as has been reported.³² Using EMSA, we asked whether Sp1 and Egr-1 could bind together or whether the binding of one transcription factor could displace the binding of the other factor at an overlapping Sp1/Egr-1 binding site. We prepared a ³²P-labeled oligonucleotide probe spanning the overlapping Sp1/Egr-1 binding site and incubated the probe with either Sp1 or Egr-1. Next, we attempted to compete off Sp1 with Egr-1 and Egr-1 with Sp1 over a range excess of proteins (Figure 4). Prebound Sp1 was readily displaced by an equimolar quantity of Egr-1, whereas prebound Egr-1 required a 30-fold excess of Sp1 for complete displacement. Under no conditions did we detect binding of both transcription factors to the same site, arguing that there may be circumstances in ECs that favor the binding of one factor over the other. These results are consistent with previous findings^{16 26} and suggest that TF trans-activation by shear stress involves displacement of Sp1 by Egr-1.

View larger version (28K): [in this window] [in a new window]   Figure 4. EMSA demonstrating binding of Sp1 and Egr-1 to an oligonucleotide spanning positions -89 to -52 of the TF promoter. Prebound Egr-1 is competed off fully by a 30-fold molar excess of Sp1, whereas prebound Sp1 is competed off by an equimolar amount of Egr-1.

A Mutation in the Egr-1 Binding Site in the TF Promoter Abolishes the Response to Shear Stress
To define more precisely the role of Sp1 and Egr-1 in shear stress trans-activation of the TF promoter, we analyzed the effect of mutations in the overlapping Sp1/Egr-1 binding site that were known to abolish binding of Sp1 and Egr-1 in vitro.²⁶ Mutations were in either Egr-1: pTF (Egr-1_m) or Sp1: pTF (Sp1_m) or in both Egr-1 and Sp1 binding sites: pTF (Egr-1_m/Sp1_m) and are shown in Figure 5A. HUVECs were transfected and subjected to shear stress. Extracts were prepared and reporter gene assays carried out. As shown in Figure 5B, a mutation in the Egr-1 binding site abolished the response of the TF promoter to shear stress, with a mutation in the Sp1 binding site having no significant effect. As expected, mutations in both Egr-1 and Sp1 binding sites abolished the response of this promoter to shear stress.

View larger version (15K): [in this window] [in a new window]   Figure 5. A, TF promoter mutants. Plasmid pTFWT is the wild-type minimal TF promoter from -111 to +14; pTF (Sp1m), pTF (Egr-1m), and pTF (Egr-1m/Sp1m) have been described.26 The hatched boxes represent Egr-1 binding sites and the filled boxes Sp1 binding sites. B, Effect of shear stress on Sp1, Egr-1, and Sp1/Egr-1 mutations in the minimal TF promoter. HUVECs were transfected and subjected to shear stress as described in Figure 4. Results show the average of at least 3 experiments.

Superactivation of the TF Promoter in HUVECs Transfected With Egr-1 and Subjected to Flow
We reasoned that it should be possible to superactivate the TF promoter by a combination of flow induction of endogenous Egr-1 and supplementation of Egr-1 added exogenously via transfection. It has recently been reported that in HeLa cells, a truncated TF promoter identical to that used in this study can be trans-activated by Egr-1 transfection²⁶ and that trans-activation mediated via Egr-1 proceeds via its cognate binding site. The construct pTF(EGR-1_m), which lacks a functional Egr-1 binding site, was not responsive to Egr-1 stimulation.²⁶ We titrated the pTFWT promoter such that a low but significant level of shear stress–mediated trans-activation could be detected but could be further increased by transfection with the pCMV–Egr-1 (p930) construct but not the CMV–Egr-1 (p838) construct harboring a 1.5–zinc finger deletion in the Egr-1 protein (data not shown). This procedure corresponded to 5 µg of promoter reporter construct and 5 ng of trans-activator plasmid per transfection experiment. Using this quantity of DNA, we transfected HUVECs and subjected them to shear stress at 1.5 N/m² for 3 hours. After this time, cells were harvested and reporter gene assays carried out (Figure 6A). The results show a clear superactivation of the TF minimal promoter under both transfection and flow conditions with 5 ng of p930 DNA. In the static control, 5 ng of p930 DNA failed to trans-activate pTFWT. Interestingly, transfection with 10 ng or 50 ng of p930 DNA reduced the level of superactivation. These data further suggest that trans-activation of the TF promoter may be mediated by Egr-1 and that under limiting concentrations of Egr-1, shear induction of endogenous Egr-1 may augment the response of the TF promoter to this transcription factor.

View larger version (14K): [in this window] [in a new window]   Figure 6. A, Superactivation of the minimal TF promoter (pTFWT) by Egr-1 transfection and shear stress. After promoter reporter gene and trans-activator plasmid titration (data not shown), 5 µg of minimal TF promoter was transfected into HUVECs in the absence or presence of an increasing amount of p930 trans-activator plasmid. Cells were exposed to shear stress of 1.5 N/m2 for 3 hours. Results show the average of 3 experiments. B, Shear stress–activated minimal synthetic promoter harboring an Egr-1 binding site and a TATA box. Bg indicates BglII and H, HindIII restriction enzyme sites. The arrow denotes the transcription start site in pGL3 basic luciferase reporter vector. The Egr-1 binding site is shown in a filled box and the TATA in a hatched box. HUVECs were transfected with 5 µg of plasmid pSP13 and the cells exposed to shear stress as described above. Results show the average of 3 experiments compared with cells transfected with pSP13 but not exposed to shear stress.

An Egr-1 Binding Site is a Novel SSRE
To further substantiate our findings that Egr-1 is implicated in the shear stress response of the TF promoter, we constructed a minimal synthetic promoter with an Egr-1 binding site driving expression of a luciferase reporter gene. Plasmid pSP13 was transfected into HUVECs, which were then exposed to a laminar shear stress of 1.5 N/m² for 3 hours. Promoter activity was compared with cells not exposed to laminar shear stress, and the results are shown in Figure 6B. A promoter comprising an Egr-1 binding site placed 20 nt upstream of a TATA box could be activated 3.3-fold by shear stress. Thus, the nonameric sequence 5' GCGGGGGCG 3' may act as an SSRE.

Flow Induces Egr-1 and TF Proteins in a Rat Arterial Model of Stenosis
Taken together, our experiments in vitro suggest a model whereby TF upregulation by shear stress is mediated by Egr-1 displacement of prebound Sp1. For these data to have greater physiological relevance, we wanted to know whether a transient increase in blood velocity and hence wall shear stress could upregulate Egr-1 and TF in vivo. To answer this question, we established a model of arterial stenosis in the rat in which we induced a graded stenosis by means of a mechanical occluder.²⁸ This experiment was carried out on 7 different animals, achieving a mean degree of stenosis of 47±2.6% and a mean shear stress of 5.34±1.65 N/m² compared with a mean shear stress of 0.86±0.13 N/m² in unoccluded arteries. A typical experiment is shown in Figure 7. After the animals were killed, both the test and control carotid arteries were fixed, sectioned, and probed with Egr-1, TF, and vWF antibodies. (Figure 7A through 7C). There were no detectable levels of Egr-1 and TF proteins in the endothelial lining of the control artery, but they were substantially increased in the test artery under conditions of 47% stenosis, as indicated by the brown staining. The antibody was specific for TF as assayed by immunoblotting of TF in LPS-induced peripheral blood mononuclear cellular extracts (Figure 7D, and an intact endothelium in the control and test arteries was confirmed by immunodetection of vWF, as shown in Figure 7C.) Under conditions in which either a 22% or an 85% stenosis was delivered to the vessel, sections stained for both Egr-1 and TF proteins showed a similar increase in the production of Egr-1 (data not shown).

View larger version (78K): [in this window] [in a new window]   Figure 7. Egr-1 (A), TF (B), and vWF (C) immunological analysis in arterial sections after occlusion. Positive staining is indicated by brown coloration. The instrumented but unoccluded right carotid artery acted as the control. Histological analysis showed that no physical damage to the arterial wall was detectable. Scale bars=10 µm, magnification x400. D, Immunoblot analysis of TF from peripheral blood mononuclear cells stimulated (S) or unstimulated (U) with LPS (100 ng/mL) for 6 hours. TF, migrating at 42 kD is arrowed. Protein molecular-weight markers are shown in kilodaltons.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
This study identifies a novel SSRE in the promoter of the TF gene. This SSRE constitutes an overlapping Sp1/Egr-1 site that is capable of binding either Sp1 or Egr-1 protein in vitro.¹⁴ The TF promoter is a complex promoter, capable of responding to a number of stimuli that act through signaling pathways, some of which are well characterized and some poorly understood (reviewed in Reference 31³¹ ). Chemical stimuli; for example, 12-O-decanoyl-13-phorbol acetate, interleukin-1ß, tumor necrosis factor-, and bacterial endotoxin LPS, all induce transcription of TF mRNA via trans-acting factors.^{31 32 33 34 35 36 37} Regulation by the dietary pigment curcumin is more complex, exerting an effect through both NF-B and AP1 sites.³⁸ However, with respect to shear stress induction of TF expression, the situation appears to be a little more clear. In this report, deletion analysis has shown that shear stress induction of the TF promoter requires a promoter element comprising nt -111 to +14. This range excludes the binding sites for AP1 and NF-B in the distal enhancer (at nt -227 to -172). Thus, shear stress induction of the TF promoter requires only functional Sp1 and Egr-1 binding sites and a TATA box. Evidence for the involvement of Egr-1 is derived from a number of additional experiments. First, our in vitro EMSA data support previous findings¹⁶ that prebound Sp1 is competed off an oligonucleotide spanning the overlapping Sp1/Egr-1 binding site by Egr-1 protein at a far lower excess of competitor protein than the prebound Egr-1 in competition with Sp1. Second, we show that a mutation in the Egr-1 binding site, but not in the Sp1 binding site, reduces the response of the TF promoter to shear stress. Third, we show that under conditions of titrated reporter and Egr-1 trans-activator plasmids, it is possible to superactivate the wild-type minimal TF promoter by shear stress. Our data showing reduced superactivation of the minimal TF promoter with an increasing quantity of p930 DNA are intriguing. One possible explanation for this is that overproduction of Egr-1 may act in an inhibitory fashion, suppressing egr-1 promoter activity and ultimately its own production.¹⁸ Finally, data obtained from a rat model of arterial stenosis support the observation that arterial occlusion, and hence an increase in laminar shear stress, induces the synthesis of both Egr-1 and TF proteins in the vascular endothelium.

Our data would appear to be at odds with a recently published study suggesting that Sp1 and not Egr-1 mediates shear response of the TF promoter in bovine aortic ECs.¹⁴ Although our data do not rule out a minor involvement of Sp1 in the shear response of the TF promoter (Figure 5B), we conclude that Egr-1 is the most significant transcription factor in shear stress trans-activation in human ECs. It is possible that the requirement for Sp1 is to set the basal level of the promoter and that Egr-1 allows maximal activation of the TF promoter under shear stress stimulation. There are 3 Egr-1 binding sites within the TF promoter²⁶ ; 2 constitute low-affinity binding sites and 1 a high-affinity binding site. These sites overlap with binding sites for Sp1. Under shear stress stimulation, Sp1 may occupy all the Sp1/Egr-1 sites, whereas Egr-1 may displace Sp1 at the high-affinity site studied in our report. In addition, there may be subtle differences between the signaling cascades that confer shear stress activation in both bovine and human ECs that dictate the use of disparate sets of transcription factors. Interestingly, the SV40 promoter is a classical Sp1-dependent promoter,³⁹ which was not shear responsive but whose response to shear was augmented by the addition of a functional GAGACC (NF-B binding) sequence upstream of the promoter.¹⁰ In addition to the data showing clear shear stress response of a minimal promoter containing an Egr-1 binding site, recent data from our group suggest that Egr-1 constitutes a powerful SSRE when located downstream of a number of core transcription factor binding sites (P.H. et al, unpublished data, 1999).

The findings from this study demonstrate that an acute change in shear stress may confer a procoagulant phenotype on the vascular endothelium. However, it has been suggested that chronic shear stress may confer an antiatherogenic phenotype on the endothelium,⁴⁰ and indeed it has been demonstrated that chronic shear stress may protect the endothelium from apoptosis.⁴¹ We propose that an acute change in shear stress rather than exposure to a constant chronic shear stress may be an initiating factor for the stimulation of, for example, immediate early gene expression via ERK1/2 signaling.

This early growth response gene product has been shown to be a key player in regulating target genes of the immune system.⁴² In addition, its role in regulating both PDGF A and PDGF B,⁴³ and now TF, suggests that Egr-1 is a significant factor in modulating vascular EC biology. An investigation into the molecular events surrounding Egr-1 upregulation by shear stress and the signaling cascades surrounding Egr-1 production will enhance our understanding of the role of this pluripotent transcription factor in shear stress–mediated events in vascular biology.

	Acknowledgments

 
We are grateful to our colleagues in vascular diseases for their constructive criticisms and to Dr Philip Green for establishing the laminar flow system.

Received March 26, 1998; accepted June 23, 1998.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Davies PF, Tripathi SC. Mechanical stress mechanisms and the cell: an endothelial paradigm. Circ Res. 1993;72:239–245.[Abstract/Free Full Text]

2. Nerem RM, Harrison DG, Taylor WR, Alexander RW. Hemodynamics and vascular endothelial biology. J Cardiovasc Pharmacol. 1993;21:S6–S10.

3. Gimbrone MA Jr, Cybulsky MI, Kume N, Collins T, Resnick N. Vascular endothelium: an integrator of pathophysiologic stimuli in atherosclerosis. Ann N Y Acad Sci.. 1995;748:122–131.[Medline] [Order article via Infotrieve]

4. Patrick CW Jr, McIntire LV. Shear stress and cyclic strain modulation of gene expression in vascular endothelial cells. Blood Purif. 1995;13:112–124.[Medline] [Order article via Infotrieve]

5. Shyy JY-J, Li Y-S, Lin M-C, Chen W, Yuan S, Usami S, Chien S. Multiple cis-elements mediate shear-stress induced gene expression. J Biomechanics. 1995;28:1451–1457.[Medline] [Order article via Infotrieve]

6. Ando J, Kamiya A. Flow-dependent regulation of gene expression in vascular endothelial cells. Jpn Heart J. 1996;37:19–32.[Medline] [Order article via Infotrieve]

7. Malek AM, Izumo S. Control of endothelial gene expression by flow. J Biomech.. 1995;28:1515–1528.[Medline] [Order article via Infotrieve]

8. Braddock M, Schwachtgen J-L, Houston P, Dickson MC, Lee MJ, Campbell CJ. Fluid shear stress modulation of gene expression in endothelial cells. News Physiol Sci.. 1998;13:241–246.[Abstract/Free Full Text]

9. Resnick N, Collins T, Atkinson W, Bonthron DT, Dewey CF Jr, Gimbrone MA Jr. Platelet-derived growth factor B chain promoter contains a cis-acting shear-stress-responsive element. Proc Natl Acad Sci U S A. 1993;90:4591–4595.[Abstract/Free Full Text]

10. Khachigian LM, Resnick N, Gimbrone MA Jr, Collins T. Nuclear factor-B interacts functionally with the platelet-derived growth factor B-chain shear-stress response element in vascular endothelial cells exposed to fluid shear stress. J Clin Invest. 1995;96:1169–1175.

11. Ohno M, Cooke JP, Dzau VJ, Gibbons GH. Fluid shear stress induces endothelial transforming growth factor beta-1 transcription and production: modulation by potassium channel blockade. J Clin Invest. 1995;95:1363–1369.

12. Lan Q, Mercurius KO, Davies PF. Stimulation of transcription factors NF-B and AP1 in endothelial cells subjected to shear stress. Biochem Biophys Res Commun. 1994;201:950–956.[Medline] [Order article via Infotrieve]

13. Shyy JY-J, Lin M-C, Han JH, Lu YJ, Petrime M, Chien S. The cis-acting phorbol ester 12-O-tetradecanoylphorbol-13-acetate-responsive element is involved in shear stress-induced monocyte chemotactic protein 1 gene expression. Proc Natl Acad Sci U S A. 1995;92:8069–8073.[Abstract/Free Full Text]

14. Lin M-C, Almus-Jacobs F, Chen H-H, Parry GCN, Mackman N, Shyy JY-J, Chien S. Shear stress induction of the tissue factor gene. J Clin Invest. 1997;99:737–744.[Medline] [Order article via Infotrieve]

15. Khachigian LM, Anderson KR, Halnon NJ, Gimbrone MA Jr, Resnick N, Collins T. Egr-1 is activated in endothelial cells exposed to fluid shear stress and interacts with a novel shear stress response element in the PDGF A-chain promoter. Arterioscler Thromb Vasc Biol. 1997;17:2280–2286.[Abstract/Free Full Text]

16. Khachigian LM, Lindner V, Williams AJ, Collins T. Egr-1-induced endothelial gene expression: a common theme in vascular injury. Science. 1996;271:1427–1431.[Abstract]

17. Khachigian LM, Collins T. Inducible expression of Egr-1 dependent genes: a paradigm of transcriptional activation in vascular endothelium. Circ Res. 1997;81:457–461.[Free Full Text]

18. Schwachtgen J-L, Houston P, Campbell CJ, Sukhatme VP, Braddock M. Fluid shear stress activation of egr-1 transcription in cultured human endothelial and epithelial cells is mediated via the ERK1/2 MAP kinase pathway. J Clin Invest. 1998;101:2540–2549.[Medline] [Order article via Infotrieve]

19. Grabowski EF, Zuckerman DB, Nemerson Y. The functional expression of tissue factor by fibroblasts and endothelial cells under flow conditions. Blood. 1993;12:3265–3270.

20. Van't Veer C, Hackeng TM, Delahaye C, Sixma JJ, Bouma BN. Activated factor X and thrombin formation triggered by tissue factor on endothelial cell matrix in a flow model: effect of the tissue factor pathway inhibitor. Blood. 1994;84:1132–1142.[Abstract/Free Full Text]

21. Grabowski EF, Lam FP. Endothelial cell function, including tissue factor expression under flow conditions. Thromb Haemost. 1995;74:123–128.[Medline] [Order article via Infotrieve]

22. Schwachtgen JL, Ferreira V, Meyer D, Kebiriou-Nabias D. Optimization of the transfection of human endothelial cells by electroporation. Biotechniques. 1994;17:882–885.[Medline] [Order article via Infotrieve]

23. Lawrence MB, Smith CW, Eskin SG, McIntire LV. Effect of venous shear stress on CD-18 mediated neutrophil adhesion to cultured endothelium. Blood. 1990;75:227–237.[Abstract/Free Full Text]

24. Nightingale J, Brophy G, Braddock M. Quan-T-CAT: A New and Rapid Method for the Enhanced Detection of CAT Reporter Gene Expression. Arlington Heights, Ill: Amersham Life Sciences; 1994.

25. Su S, Vivier RG, Dickson MC, Thomas N, Kendrick MK, Williamson NM, Anson JG, Houston JG, Craig FF. High through-put RT-PCR analysis of multiple transcripts using a microplate RNA isolation procedure. Biotechniques. 1997;22:1107–1113.[Medline] [Order article via Infotrieve]

26. Cui M-Z, Parry GCN, Oeth P, Larson H, Smith M, Huang R-P, Adamson ED, Mackman NJ. Transcriptional regulation of the tissue factor gene in human endothelial cells is mediated by Sp1 and Egr-1. J Biol Chem. 1996;271:2731–2739.[Abstract/Free Full Text]

27. Nathwani AC, Gale KM, Pemberton KD, Crossman DC, Tuddenham EGD, McVey J. Efficient gene transfer into human umbilical vein endothelial cells allows functional analysis of the human tissue factor gene promoter. Br J Haematol. 1994;88:122–128.[Medline] [Order article via Infotrieve]

28. Igawa T, Nagamura Y, Ozeki Y, Itoh H, Unemi F. Stenosis enhances role of platelets in growth of regional thrombus and intimal wall thickening in rat carotid arteries. Circ Res. 1995;77:310–316.[Abstract/Free Full Text]

29. Ward-Smith AJ. Internal Fluid Flow: The Fluid Dynamics of Flow in Pipes and Ducts. Oxford, UK: Clavendon Press; 1980.

30. Matsuki Y, Yamamoto T, Hara K. Detection of inflammatory cytokine messenger RNA (mRNA)-expressing cells in human inflamed gingiva by combined in situ hybridization and immunohistochemistry. Immunology. 1992;76:42–47.[Medline] [Order article via Infotrieve]

31. Mackman N. Regulation of the tissue factor gene. FASEB J. 1995;9:883–889.[Abstract]

32. Oeth PA, Parry GCN, Mackman N. Role of AP1, NF-kB/Rel, and Sp1 proteins in uninduced and lipopolysaccharide-induced expression. Arterioscler Thromb Vasc Biol. 1997;17:365–374.[Abstract/Free Full Text]

33. Oeth PA, Parry GCN, Kunsch C, Nantermet P, Rosen CA, Mackman N. Lipopolysaccharide induction of tissue factor gene expression in monocytic cells is mediated by binding of c-Rel/p65 heterodimers to a kappa B-like site. Mol Cell Biol. 1994;14:3772–3781.[Abstract/Free Full Text]

34. Parry GCN, Mackman N. A set of inducible genes expressed by activated human monocytic and endothelial cells contain kappa B-like sites that specifically bind c-Rel-65 heterodimers. J Biol Chem. 1994;269:20823–20825.[Abstract/Free Full Text]

35. Mackman N. Regulation of the tissue factor gene. Thromb Haemost. 1997;78:747–754.[Medline] [Order article via Infotrieve]

36. Mackman N, Fowler BJ, Edgington TS, Morrissey JH. Functional analysis of the human tissue factor promoter and induction by serum. Proc Natl Acad Sci U S A. 1990;87:2254–2258.[Abstract/Free Full Text]

37. Parry GCN, Mackman N. Transcriptional regulation of tissue factor expression in human endothelial cells. Arterioscler Thromb Vasc Biol. 1995;15:612–621.[Abstract/Free Full Text]

38. Bierhaus A, Zhang Y, Quehenberger P, Luther T, Haase M, Muller M, Mackman N, Ziegler R, Nawroth PP. The dietary pigment curcumin reduces endothelial tissue factor gene expression by inhibiting binding of AP-1 to the DNA and activation of NF-B. Thromb Haemost. 1997;77:772–782.[Medline] [Order article via Infotrieve]

39. Takahashi K, Vigneron M, Mathes H, Wildeman A, Zenke M, Chambon P. Requirements of stereospecific alignments for initiation from the simian virus 40 early promoter. Nature. 1986;319:121–126.[Medline] [Order article via Infotrieve]

40. Gimbrone MA Jr, Nagel T, Topper JN. Biomechanical activation: an emerging paradigm in endothelial adhesion biology. J Clin Invest. 1997;99:1809–1813.[Medline] [Order article via Infotrieve]

41. Kaiser D, Freyberg M-A, Friedl P. Lack of haemodynamic forces triggers apoptosis in vascular endothelial cells. Biochem Biophys Res Commun. 1997;231:586–590.[Medline] [Order article via Infotrieve]

42. McMahon SB, Monroe JG. The role of early growth response gene (egr-1) in regulation of the immune response. J Leukoc Biol. 1996;60:159–166.[Abstract]

43. Khachigian LM, Collins T. Inducible expression of Egr-1–dependent genes: a paradigm of transcriptional activation in vascular endothelium. Circ Res. 1997;81:457–461.

This article has been cited by other articles:

				I.-S. Shin, J.-M. Kim, K. L. Kim, S. Y. Jang, E.-S. Jeon, S. H. Choi, D.-K. Kim, W. Suh, and Y.-W. Kim Early growth response factor-1 is associated with intraluminal thrombus formation in human abdominal aortic aneurysm. J. Am. Coll. Cardiol., March 3, 2009; 53(9): 792 - 799. [Abstract] [Full Text] [PDF]

				S.-F. Yan, E. Harja, M. Andrassy, T. Fujita, and A. M. Schmidt Protein Kinase C {beta}/Early Growth Response-1 Pathway: A Key Player in Ischemia, Atherosclerosis, and Restenosis J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A47 - A55. [Abstract] [Full Text] [PDF]

				C. Iomini, K. Tejada, W. Mo, H. Vaananen, and G. Piperno Primary cilia of human endothelial cells disassemble under laminar shear stress J. Cell Biol., March 15, 2004; 164(6): 811 - 817. [Abstract] [Full Text] [PDF]

				T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird Thrombin and Phenotypic Modulation of the Endothelium Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 41 - 53. [Abstract] [Full Text] [PDF]

				H. Takeya, E. C. Gabazza, S. Aoki, H. Ueno, and K. Suzuki Synergistic effect of sphingosine 1-phosphate on thrombin-induced tissue factor expression in endothelial cells Blood, September 1, 2003; 102(5): 1693 - 1700. [Abstract] [Full Text] [PDF]

				S. Q. Liu, D. Tang, C. Tieche, and P. K. Alkema Pattern formation of vascular smooth muscle cells subject to nonuniform fluid shear stress: mediation by gradient of cell density Am J Physiol Heart Circ Physiol, August 7, 2003; 285(3): H1072 - H1080. [Abstract] [Full Text] [PDF]

				S. Q. Liu, C. Tieche, D. Tang, and P. Alkema Pattern formation of vascular smooth muscle cells subject to nonuniform fluid shear stress: role of PDGF-{beta} receptor and Src Am J Physiol Heart Circ Physiol, August 7, 2003; 285(3): H1081 - H1090. [Abstract] [Full Text] [PDF]

				B. Wojciak-Stothard and A. J. Ridley Shear stress-induced endothelial cell polarization is mediated by Rho and Rac but not Cdc42 or PI 3-kinases J. Cell Biol., April 28, 2003; 161(2): 429 - 439. [Abstract] [Full Text] [PDF]

				M. Voskuil, N. van Royen, I. E. Hoefer, R. Seidler, B. D. Guth, C. Bode, W. Schaper, J. J. Piek, and I. R. Buschmann Modulation of collateral artery growth in a porcine hindlimb ligation model using MCP-1 Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1422 - H1428. [Abstract] [Full Text] [PDF]

				F. Bea, M. H. Puolakkainen, T. McMillen, F. N. Hudson, N. Mackman, C. C. Kuo, L. A. Campbell, and M. E. Rosenfeld Chlamydia pneumoniae Induces Tissue Factor Expression in Mouse Macrophages via Activation of Egr-1 and the MEK-ERK1/2 Pathway Circ. Res., March 7, 2003; 92(4): 394 - 401. [Abstract] [Full Text] [PDF]

				S.-Q. Wu, T. Minami, D. J. Donovan, and W. C. Aird The proximal serum response element in the Egr-1 promoter mediates response to thrombin in primary human endothelial cells Blood, December 15, 2002; 100(13): 4454 - 4461. [Abstract] [Full Text] [PDF]

				M. Osawa, M. Masuda, K.-i. Kusano, and K. Fujiwara Evidence for a role of platelet endothelial cell adhesion molecule-1 in endothelial cell mechanosignal transduction: is it a mechanoresponsive molecule? J. Cell Biol., August 19, 2002; 158(4): 773 - 785. [Abstract] [Full Text] [PDF]

				U. Bavendiek, P. Libby, M. Kilbride, R. Reynolds, N. Mackman, and U. Schonbeck Induction of Tissue Factor Expression in Human Endothelial Cells by CD40 Ligand Is Mediated via Activator Protein 1, Nuclear Factor kappa B, and Egr-1 J. Biol. Chem., July 5, 2002; 277(28): 25032 - 25039. [Abstract] [Full Text] [PDF]

				T. Abumiya, T. Sasaguri, Y. Taba, Y. Miwa, and M. Miyagi Shear Stress Induces Expression of Vascular Endothelial Growth Factor Receptor Flk-1/KDR Through the CT-Rich Sp1 Binding Site Arterioscler Thromb Vasc Biol, June 1, 2002; 22(6): 907 - 913. [Abstract] [Full Text] [PDF]

				M. Guha, M. A. O'Connell, R. Pawlinski, A. Hollis, P. McGovern, S.-F. Yan, D. Stern, and N. Mackman Lipopolysaccharide activation of the MEK-ERK1/2 pathway in human monocytic cells mediates tissue factor and tumor necrosis factor {alpha} expression by inducing Elk-1 phosphorylation and Egr-1 expression Blood, September 1, 2001; 98(5): 1429 - 1439. [Abstract] [Full Text] [PDF]

				T. Nishibe, G. Parry, A. Ishida, S. Aziz, J. Murray, Y. Patel, S. Rahman, K. Strand, K. Saito, Y. Saito, et al. Oncostatin M promotes biphasic tissue factor expression in smooth muscle cells: evidence for Erk-1/2 activation Blood, February 1, 2001; 97(3): 692 - 699. [Abstract] [Full Text] [PDF]

				E. F. Grabowski, A. J. Reininger, P. G. Petteruti, O. Tsukurov, and R. W. Orkin Shear Stress Decreases Endothelial Cell Tissue Factor Activity by Augmenting Secretion of Tissue Factor Pathway Inhibitor Arterioscler Thromb Vasc Biol, January 1, 2001; 21(1): 157 - 162. [Abstract] [Full Text] [PDF]

				M. D. Silverman, C. R. Waters, G. T. Hayman, J. Wigboldus, M. M. Samet, and P. I. Lelkes Tissue factor activity is increased in human endothelial cells cultured under elevated static pressure Am J Physiol Cell Physiol, August 1, 1999; 277(2): C233 - C242. [Abstract] [Full Text] [PDF]

				B. Du, C. Fu, K. C. Kent, H. Bush Jr., A. H. Schulick, K. Kreiger, T. Collins, and T. A. McCaffrey Elevated Egr-1 in Human Atherosclerotic Cells Transcriptionally Represses the Transforming Growth Factor-beta Type II Receptor J. Biol. Chem., December 8, 2000; 275(50): 39039 - 39047. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Houston, P. Articles by Braddock, M. Search for Related Content PubMed PubMed Citation Articles by Houston, P. Articles by Braddock, M. Related Collections Animal models of human disease Gene expression Growth factors/cytokines Endothelium/vascular type/nitric oxide Mechanism of atherosclerosis/growth factors