Vascular Biology |
From the Department of Pathology, University of Washington, Seattle, Wash.
Correspondence to Lawrence D. Adams, PhD, University of Washington, Department of Pathology, Vascular Biology/Box 357335, 1959 NE Pacific Street, Seattle WA 98195-7335. E-mail ladams{at}u.washington.edu
| Abstract |
|---|
|
|
|---|
(PPAR
); secreted protein, acidic and rich in cysteine (SPARC);
1(I)collagen; and A2, an uncharacterized gene. We examined
these 5 clones during carotid artery injury and an
inconsistently differentially expressed clone Krox-24 because,
as an early response transcription factor, it could be involved in the
injury response. PPAR
, A2, and Krox-24 mRNAs were upregulated during
the day after injury. ZO-2 and
1(I)collagen messages were modulated
for up to a month, whereas SPARC message showed no consistent
change. An analysis of ZO-2 and other tight junction genes
indicates that tight junctions may play a role in smooth muscle
biology. These data suggest that a systematic analysis of these
libraries is likely to identify a very large number of differentially
expressed genes. ZO-2 is particularly intriguing both because of this
tight junction genes pattern of prolonged over-expression after
injury and because of its potential role in determining the distinctive
epithelioid phenotype of smooth muscle cells identified in rat
and other species.
Key Words: vascular smooth muscle neointima tight junction zonula occludens 2
| Introduction |
|---|
|
|
|---|
In this study, we systematically examined the expression of a random set of 40 genes chosen from a pup and an adult cDNA library. Genes were first identified by single pass sequencing. Next we examined differential patterns of expression between the pup and adult SMCs using dot blot and Northern analysis to identify candidates for further study. If a gene did not have more than 1.5-fold expression difference between culture types by Northern analysis, it was discarded from further examination (with the exception of Krox-24). To determine expression consistency, we examined the expression of those selected genes in 3 additional culture sets, 1 being a set at 3 different culture growth states. Those genes with consistent differential expression in vitro were tested for modulation during balloon injury to the carotid arteries as an assay for involvement in vessel injury response.
Five genes were consistently differentially expressed in vitro, including the tight junction gene ZO-2. Four of these genes were modulated after balloon injury, as well as Krox-24. Of these genes, ZO-2 was particularly intriguing because it is tight junction specific and is a member of the family of membrane associated guanylate kinase homologues (MAGUKs),17 a class involved in organizing the presentation of transmembrane proteins18 19 20 21 22 and possibly involved in cell signaling,23 that has not previously been found in smooth muscle. Further analysis of other tight junction genes in the injured wall as well as in the culture systems suggests that these proteins may have profound implications in the different morphologies and growth patterns of the SMCs analyzed and in the morphogenesis of the intima.
| Methods |
|---|
|
|
|---|
cDNA Clone Isolation and DNA Sequence Analysis
cDNA libraries were constructed in
ZAP (pup) and
ZAP II
(adult) and manipulated as specified (Stratagene). Plasmid cultures and
purifications were performed using Qiagen kits and protocols. Plasmids
were sequenced using either the fmole cycle sequencing kit (Promega) or
the ABI Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin
Elmer) with primers designed from Bluescript:
5'AGCGGATAACAATTTCACACAGGA 3' (reverse) and 5' CGCCAGGGTTTTCCCAGTCACGAC
3' (forward). Clones A2, A4, and A13 were sequenced further with
primers designed from first pass sequences. Clone identities were
analyzed using Basic Local Alignment Tool
(BLAST).24 All clone sequences were deposited into
the National Center for Biotechnology Information GenBank database.
Dot Blot Analysis
Fifty ng of each plasmid was applied to Zeta-probe GT nylon
membranes (Biorad). cDNA probes were generated by reverse transcription
and random priming as follows: 5 µg total RNA was mixed with 0.5 µL
of 50 µmol/L dT15 (Operon) to a total volume of 9.5 µL. This sample
was heated to 65°C for 10 minutes, chilled on ice for 3 minutes, and
a reaction of 18 µL was set up in the tube with the following
additional final composition: 5 U/µL Superscript II reverse
transcriptase (Life Technologies Gibco-BRL), 55.5 mmol/L Tris-HCl
pH 8.3, 61 mmol/L KCl, 3.3 mmol/L MgCl2, 9 mmol/L DTT,
11 µmol/L dNTPs, and 0.18 µCi/µL of 3000 Ci/mmol
[
-32P] dCTP/µL (Dupont-NEN). Reverse transcription
proceeded at 37°C for 1 hour. Samples were incubated in NaOH at a
final concentration of 0.2 N for 30 minutes, ethanol precipitated,
washed in 70% ethanol, and resuspended in 10-µL
H2O. 32P labeled second strand cDNA
was synthesized from first strand cDNA with the Multiprime reaction kit
(Amersham).
Prehybridization proceeded for 2 hours at 42°C in the following solution: 50% deionized formamide, 0.75 mol/L NaCl, 50 mmol/L Tris pH 7.4, 1X Denhardts Reagent, 1% sodium dodecyl sulfate (SDS), 10% dextran sulfate, and 200 µg/mL salmon sperm DNA. Hybridization proceeded overnight at 42°C with a probe concentration of 1.0x106 cpm/mL. The blots were washed 3 times for 5 minutes at room temperature in 2X SSC, 0.1% SDS and 2 times for 20 minutes in 0.3X SSC, 0.1% SDS at 65°C. Dot blots were scanned and analyzed with a Molecular Dynamics PhosphorImager and software.
Carotid Artery Balloon Injury Model
RNA samples were obtained as previously reported8
from carotid arteries of balloon injured25 3-month-old
adult male Sprague-Dawley rats (Zivic-Miller, Allison Park, PA),
as approved by the Animal Care Committee of the University of
Washington. Specimens were taken from
non-reendothelialized areas of the vessel or, for
control vessels, after ex vivo removal of the
endothelium. Some vessels were separated into
neointimal and medial portions.
Northern Analysis
Northerns were performed as described previously.6
Probes were synthesized using the Multiprime kit with 50 ng of agarose
gel purified cDNA (restriction digested from each cloned plasmid). The
-SM actin primer was used as described.9 SM22
and ß-actin clones were isolated from the pup library and
verified by sequence analysis. Probes for synapse associated
protein (SAP90), SAP97, ZO-1, and occludin were generated by
reverse transcription polymerase chain reaction (rtPCR) using
BRL Superscript II reverse transcriptase and Promega Taq polymerase as
specified on 0.5-µg pup SMC RNA using primers specific to the
published sequences (X66474, U14950, L14837, and U49185, respectively).
Claudin rtPCRs were performed as above for 40 cycles with 0.5-µg pup
and adult SMC RNA with primers designed to claudin 1 (rat clone
AI171286) and claudin 2 (mouse clone AF072128). Amplification
products were gel purified and verified by sequence
analysis. All Northern blots were stripped and reprobed with
antisense 28S rRNA primer 5' GCAAGAGCGCCAGCTATCCTGAGG 3' for equalizing
hybridization values for loading differences between lanes as follows:
10 pmol of 28S rRNA primer was end labeled using 3
µCi[
-32P] ATP at 3000 Ci/mmol (Dupont-New England
Nuclear) and 10 U T4 polynucleotide kinase (Promega) in the
buffer supplied by the manufacturer and purified by filtration through
Microspin G-25 sephadex columns (Pharmacia Biotech). Blots were
prehybridized at 42°C for 2 hours. Labeled 28S rRNA primer was added
at 1x105 cpm/mL final concentration in the presence of 0.2
µg/mL unlabeled 28S rRNA primer. Autoradiography,
PhosphorImager scanning, and analysis were performed as for dot
blots. To equalize for loading message levels were calculated as a
ratio of message specific hybridization divided by the 28S rRNA
specific hybridization value for each lane.
Immunocytochemistry
Primary antibodies to ZO-1, polyclonal Rabbit Anti-ZO-1 61-7300,
and negative control primary antibody, Rabbit Anti-Chicken/Turkey IgG
61-3100 were supplied by Zymed Laboratories Inc. Rabbit Anti-ZO-1
61-7300 and Rabbit Anti-Chicken/Turkey IgG 61-3100 were used at
5 µg/mL. Biotinylated Goat Anti-Rabbit IgG (H+L) BA-1000 secondary
antibody from Vector Laboratories was used at 3.75 µg/mL. Fixation
and staining were as follows: slide cultures were placed on ice, washed
3 times with 1X phosphate-buffered saline (PBS) and fixed in
room temperature Methyl Carnoys without chloroform (3 parts
methanol:1 part glacial acetic acid) for 10 minutes. All further
procedures were at room temperature. Slides were washed 3 times for 3
minutes in 1X PBS, incubated in 0.3% H2
02 in methanol for 20 minutes and washed again 3
times for 3 minutes in 1X PBS. The primary antibody, Rabbit Anti-ZO-1
61-7300, was applied to the slides for 1 hour followed by three
3-minute washes in 1X PBS. The secondary antibody, Goat Anti-Rabbit IgG
(H+L) BA-1000 or Rabbit Anti-Chicken/Turkey IgG 61-3100, was applied to
the slides for 1 hour followed by three 3-minute washes in 1X PBS. The
Vectastain ABC elite kit with peroxidase (Vector Laboratories) was used
with the Vector DAB substrate kit. A dark brown reaction product
accumulated at the site of secondary antibody binding. The Vectastain
ABC Elite reaction was applied to the slides for 30 minutes at a 1/100
dilution. The slides were then washed in 1x Tris buffered
saline 3 times for 3 minutes. DAB (Dako) was applied for
approximately 2 minutes and the slides were washed in water. All slides
were counter stained with Evans blue dye, dehydrated in alcohol and
cover slipped in Permount (Fischer Scientific). All photomicrographs
were taken on an Olympus Vanus microscope at 200X power.
| Results |
|---|
|
|
|---|
Dot Blot Versus Northern Analysis of Cloned Genes
Dot blots containing every random clone and 2 control plasmids
with the pup-specific gene osteopontin and the housekeeping-gene
ß-actin were used to measure message levels. 32P-labeled
second strand cDNA probes for this assay were prepared from RNA of
confluent pup or adult SMCs. A second preparation of RNAs had to be
isolated to make probes because the RNA samples used to synthesize the
libraries (set 1 RNA) were exhausted during library construction. This
new RNA will be referred to as set 2 RNA.
Seventeen random clones were differentially expressed at ratios
1.5-fold between cultures and 10 were differentially expressed
at
2-fold. The 2.2-fold value for osteopontin suggests that the
assay was sensitive enough to determine differential expression for
messages at least 2-fold in variance. Only one gene, SPARC (A24), was
expressed at
10-fold. No genes had an "all or none" expression
pattern. No ratios could be determined for 9 genes hybridizing at
background levels suggesting a detection cutoff. Similar results were
obtained after stripping the dot blot and reversing the probe order
(data not shown).
We selected for Northern analysis the 17 genes with a dot blot
ratio
1.5-fold, 7 nearly equally (<1.5-fold) expressed genes,
and the 9 undetectable genes and compared the expression ratios to
determine consistency between methods. There were 8 genes
with message ratios measured at
1.5-fold by both detection methods
(Table 1
). For these genes, there was
complete agreement on which culture had the highest message level.
Sixteen genes had message ratios measured by one or both methods that
were <1.5-fold. For these genes, 8 pairs of ratios were in agreement
and 8 pairs were in disagreement for the culture with the highest
message levels. Therefore, results from the 2 methods coincide only for
fold levels >50% difference in expression, establishing a 1.5-fold
difference as the bottom line of reproducibility between the 2 methods
and the limit for dot blot usefulness in these experiments.
|
Analysis of Additional Sets of RNA
Fourteen genes with
1.5-fold difference by Northern
analysis alone of set 2 RNA, shown in Table 1
, were
studied for consistency of differential expression. In
addition, we examined the following 6 genes previously reported as over
expressed in pup SMCs: elastin, osteopontin, platelet-derived growth
factor B chain (PDGF-B), cytochrome P450IA1,6 7 8 or
as characteristic of all smooth muscle:
smooth muscle actin and
SM22
.26 27 Message levels were analyzed in 3
additional RNA samples. These were sets 3 and 4, isolated from
additional pairs of pup and adult confluent cultures and set 5,
isolated from 3 different states of confluence (2 days after passage,
at confluence, and at 3 days after confluence) in the same SMCs used to
make set 2 RNA.
Five of the random clones were consistently differentially
expressed (Table 2
). Highest in the pup
SMCs were A2, A4, and A13 and in the adult were
1(I)collagen and
SPARC. Effects of confluence on message are shown in Figure 1
. Northern hybridization of A13 in set 5
RNA is shown in Figure 2
.
|
|
|
Identification of Differentially Expressed Unknowns
We next further sequenced clones A2, A4, and A13. A13 had 84%
identity in common with the ZO-2 gene sequence between bases 3367 and
3551 of the human sequence28 and 86% to bases 1938 to
2224 of the canine ZO-2 sequence.17 A4 had 100% DNA
sequence identities in common between bases 9 and 249 of the published
rat sequence of PPAR
.29 A2 was shown to have 80% DNA
homology to a human myeloid clone, KIAA0055, related to the
tre oncogene.30 With these 3 clones identified,
32 of the 40 clones were identified as known genes or ESTs. These
extended sequences were deposited into GenBank as ZO-2, U75916, A2,
AA107119 and AA107120, and PPAR
, U75919.
Gene Expression in Response to Balloon Injury
We next examined message levels of the 5 differentially expressed
genes to screen for involvement in the process of
neointimal formation. RNA for each time point was pooled
from carotid arteries of 5 to 15 animals that were injured on the same
day and harvested at the same time after angioplasty. Although Krox-24
was inconsistently differentially expressed, we examined it
here because this transcription factor is an immediate-early serum
response gene.31 Osteopontin was also monitored because
patterns of change in mRNA levels during balloon injury for this gene
have been well characterized.8 32
PPAR
, Krox-24, and A2 mRNAs were elevated during the first 24 hours
after injury (Figure 3
). The PPAR
message level was highest 4 hours after injury at 2.6 times the control
level (Figure 3a
). Message levels returned to the control level
at 24 hours and remained there for at least 1 week (data not shown).
Krox-24 was upregulated at least as early as 1 hour after injury, where
it was 11.4 times higher than the control level, shown in Figure 3b
. Message levels quickly dropped to 2.5-fold over the control
by 6 hours after injury. By 24 hours, Krox-24 returned to the control
level (data not shown). A2 message levels, Figure 3c
, increased
with a peak at 6 hours of 1.5-fold, returned to the control level by 24
hours, and remained low up to a week after injury (data not shown)
|
ZO-2 exhibited sustained elevations comparable with levels of
osteopontin, and like osteopontin, ZO-2 remained elevated up to at
least 28 days after injury (Figure 4
).
Osteopontin message levels (Figure 4a
) were in agreement with
published results.8 ZO-2 message is shown in Figure 4b
. Within 4 hours, ZO-2 message reached a peak of 8.8 times the
control value; previous northern data showed that the message level was
still rising at 1 hour after injury (data not shown). This level
decreased to 2 times the control value by 24 hours and was maintained
between 1.5 to 2 times the control level. To determine whether the
upregulation of ZO-2 was in intimal or medial layers, injured carotids
were separated into neointimal and medial portions (Figure 5
). At 14 to 21 days after injury,
neointimal ZO-2 message was approximately 2-fold higher
than the uninjured whole carotid. Interestingly, there was a difference
in ZO-2 levels between the neointima and the media at 14
days that mostly disappeared by 28 days after injury, when both layers
had around twice the ZO-2 level of the control uninjured media.
|
|
Consistent with published results,7
1(I)collagen mRNA (Figure 4c
) began decreasing within 1 hour
after injury and reached a low of 5.9-fold less than control at 24
hours. Message levels returned to and remained near uninjured control
levels by 10 days. SPARC message, a consistent marker of adult
SMCs, showed no overall trend in expression in vivo after balloon
injury (Figure 4
days).
ZO-2 Expression in Pup Cell Clones
We have previously reported that clones made from pup cell
cultures show either an adult or pup-like phenotype both by
morphology and expression pattern. Four epithelioid pup
clones9 (Figure 6
) showed
equally high levels of ZO-2 expression. One clone had the
spindle-shaped morphology of adult SMC cells (clone V). This clone and
clone II, with epithelioid morphology, had approximately equally low
levels of ZO-2 message. Clone II is also adult-like in having very low
expression of PDGF-B,9 a pup SMCspecific
gene.7
|
Expression of Other Tight Junction Proteins
We examined the message level of several MAGUK and tight
junction proteins, including ZO-1,17 the synapse
associated proteins 90 and 97 (SAP90 and SAP97)33 34
and tight junction integral membrane proteins
occludin,22 35 claudin 1 and 2.36 37 ZO-1
message levels were higher in pup SMCs at all growth states (Table 2
) with the highest level at subconfluence with 2.8 times the
adult and decreasing to 1.2-fold the adult at three days after
confluency. There was a higher level of SAP90 in the adult SMCs at all
growth states, with the highest level, a 4.9-fold difference, being
found at confluence. Occludin and SAP97 messages were equally expressed
between the pup and adult SMCs (data not shown). We analyzed
claudin 1 and 2 by rtPCR in pup and adult SMCs. Both genes are
expressed in pup SMCs but not adult SMCs (data not shown).
ZO-1 Protein Expression In Vivo
Because there are no antibodies currently available against rodent
ZO-2, we next examined the protein expression pattern of ZO-1, another
tight junction MAGUK gene to examine for the presence of tight
junctions in smooth muscle.17 ZO-1 antibody staining of
confluent pup cells showed a continuous band of ZO-1 protein localized
to cell/cell interfaces (Figure 7A
). A
similar pattern was seen when cells grown from sparse density formed
cell contacts (Figure 7B
), whereas membranes at the exterior of
cell islands and isolated cells exhibited only disconnected spots of
ZO-1 staining. The adult cells, in contrast, exhibited cytoplasmic
rather than membrane localized staining for ZO-1, whether at confluent
or subconfluent growth states, Figures 7C
and 7D
,
respectively.
|
Disappointingly, ZO-1 was not localized on luminal neointimal SMCs but was more generally expressed in the intima and media, as determined by immunohistochemical staining of cross sections of uninjured or injured carotid arteries at either 14 or 28 days after injury. En face preparations of 14-day balloon-injured vessels stained with ZO-1 antibodies showed that while endothelial cells at the injury boundary localized ZO-1 to sites of cell to cell contact, the adjacent neointimal SMCs had only diffuse cytoplasmic staining (data not shown).
| Discussion |
|---|
|
|
|---|
, and
ZO-2 messages were always higher in pup SMCs. SPARC and
1(I)collagen messages were always higher in adult SMCs. Three of
these genes, ZO-2, PPAR
, and
1(I)collagen were upregulated after
balloon injury; ZO-2 was higher in the neointima than in
the uninjured media at least up to 21 days after injury and elevated in
the injured whole carotid up to 28 days after injury. We were initially surprised that no gene was found more than once among the 40 clones. Lewins analysis of different tissues38 led him to estimate that <100 abundant genes make up approximately 50% of a cells mRNA, whereas approximately 10 000 intermediate and low abundance genes make up the remainder. Even large scale studies using in depth sequencing show <25% repeat sequences from several thousand random clones.39 Repeat clones, although possible, are not likely to be frequent occurrences in the sample size used in our survey.
Two genes showing consistent differential expression in the pup
cells, PPAR
and A2, are transcription factors. Both genes showed
transient elevation in vivo shortly after balloon injury. PPAR
message was higher in pup SMCs and was elevated only during the day
after balloon injury. Three additional members of the PPAR family have
been discovered to date.40 These genes belong to the
steroid/thyroid/vitamin super-family of nuclear receptors involved in
transcription and differentiation. Overexpression studies in vitro have
shown that PPAR
initiates adipogenic differentiation and suppresses
myogenic differentiation in myoid and fibroblastic cell
lines.41 PPAR
has recently been found by rtPCR in rat
aortic SMCs.42 Activators of PPAR
inhibit
smooth muscle activation and inflammatory response.43 A2,
found in immature myeloid cells, appears to be a novel transcription
factor based on an 80% homology to a human gene with homology to the
tre oncogene.
Perhaps the most surprising observation made during this study was the presence of tight junction proteins in smooth muscle because tight junctions are thought to be found almost exclusively in epithelia, including the endothleium. However, in vitro pup cells9 form an epithelioid monolayer that resembles the appearance of tight junction containing cells cultures. The ZO-1 staining pattern for confluent and subconfluent pup cultures is similar to that seen by Li and Poznansky in confluent and subconfluent endothelial cultures.44 In both pup and these endothelial cells, adjacent cells had a continuous band of ZO-1 staining, whereas cells in islands or by themselves had discontinuous bands or punctate staining at exposed membrane surfaces. Similar membrane structures were seen by Ehler et al who examined cell/cell junctions containing ZO-1 and cingulin in epithelioid but not spindle-shaped smooth muscle clonal lines cultured from juvenile mouse aortas.45 An epithelioid pattern with freeze fracture evidence for tight junctions is also seen in vivo in the surface layer of neointimal cells formed after balloon injury.46 47 Our data suggest a broader expression of tight junction genes in SMC. In addition to ZO-1 and ZO-2, both pup and adult SMCs express occludin mRNA by Northern analysis (data not shown). Recently it has been shown by gene targeted disruption that occludin is not required for tight junction strand formation and may play an accessory role at tight junctions.35 Furuse et al have shown there are at least 2 additional integral membrane proteins, claudin 1 and 2,36 that are present in tight junctions and reconstitute tight junctions strands when transfected into a fibroblast line lacking these structures.37 We have found claudin 1 and 2 message expressed in pup but not adult SMCs by rtPCR assay. These data show that both peripheral cytoplasmic components and integral membrane components of the tight junction are expressed in smooth muscle.
Although immunocytochemistry shows that ZO-1 is located in junctions between adjacent pup cells and pup cell monolayers, other SMCs in vivo and in vitro had ZO-1 throughout the cytoplasm. The expression of ZO-1, but not ZO-2, in cells lacking tight junctions has been documented in several additional cell types. ZO-1 is found in cardiac myocytes at fascia adherens, which have a cohesive role at intercalated discs,17 at adherens junctions in hepatocytes and cell/cell contacts in rat 3Y1 fibroblasts.48 ZO-1 is also found in astrocytes at points of cell/cell contact, in Schwann cells, and in dermal fibroblasts.49 The RNA expression data for ZO-2, the claudins and occludin, which are tight junction-specific genes, argues for the presence of tight junctions in pup SMCs when added to the ZO-1 protein localization pattern.
The appearance of ZO proteins in smooth muscle may reflect roles for
these proteins other than tight junction formation. The above examples
show that ZO-1 is more ubiquitously expressed and has different
functions at the membrane in a variety of cell/cell interfaces than
ZO-2. Our data on ZO-2 in smooth muscle suggests it is somewhat more
widely expressed as well. Studies of related dlg family members suggest
the intriguing possibility that ZO-2 and ZO-1 are part of a signaling
complex involved in cell-cell interactions. Gottardi et al have shown
that ZO-1 can move between the nucleus and the cell membrane during
remodelling of cell-cell contacts.50 ZO-1 binds to
-catenin and possibly other catenins,51 52 to the
cytoskeletal elements F-actin53 and
cortactin,54 and the tight junction associated protein
occludin22 (thereby bridging between the cytoskeleton and
the tight junction) and binds to ZO-2 itself.17 Matsumine
et al have found that the MAGUK human disc large protein (hDLG) binds
to the carboxy terminal region of the adenomatous polyposis coli (APC)
tumor suppresser gene through the second of its 3 disc-large homology
region repeat regions,55 an interaction which
possibly affects the ability of APC to block cell cycle
progression.56 Both hDLG and APC colocalize at the lateral
cytoplasm of colon epithelial cells and the synaptic regions of
cultured hippocampal neurons.55 Another MAGUK family
member, SAP90 (an adult SMC specific gene), binds to
N-methyl-D-aspartate receptor subunits, nitric oxide synthase,
and
1-syntrophin and binds to and clusters shaker-type K+
channels.18 19 20 The presence of ZO-1, ZO-2, and SAP90 in
morphologically different SMCs suggest similar signaling processes
might be involved in morphogenic changes that occur after vessel
injury.
In summary, mRNA expression differences and morphological data from only a small sampling of genes imply there are many more differences in gene expression between distinct types of rat vascular SMCs. Of the new differentially expressed genes identified in this study, ZO-2 may provide clues to morphogenic signaling pathways that could have implications for other phenotypic differences between smooth muscle subtypes.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
1-syntrophin mediated by PDZ domains.
Cell. 1996;84:757767.[Medline]
[Order article via Infotrieve]
-vascular and gamma-enteric smooth muscle isoactins:
Isolation and characterization of a rat gamma-enteric actin cDNA.
Mol Cell Biol. 1988;8:52245231.
. J Biol Chem. 1995;270:1346013469.
but not by PPARy activators.
Nature. 1998;393:790793.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
H. Hao, G. Gabbiani, and M.-L. Bochaton-Piallat Arterial Smooth Muscle Cell Heterogeneity: Implications for Atherosclerosis and Restenosis Development Arterioscler. Thromb. Vasc. Biol., September 1, 2003; 23(9): 1510 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Geary, J. M. Wong, A. Rossini, S. M. Schwartz, and L. D. Adams Expression Profiling Identifies 147 Genes Contributing to a Unique Primate Neointimal Smooth Muscle Cell Phenotype Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2010 - 2016. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, M. Fu, X. Zhu, Y. Xiao, Y. Mou, H. Zheng, M. A. Akinbami, Q. Wang, and Y. E. Chen Peroxisome Proliferator-activated Receptor delta Is Up-regulated during Vascular Lesion Formation and Promotes Post-confluent Cell Proliferation in Vascular Smooth Muscle Cells J. Biol. Chem., March 22, 2002; 277(13): 11505 - 11512. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. N. Tai, E. E. Brooks, S. Liang, R. Somogyi, J. D. Rosete, R. M. Lawn, and D. Shiffman Determination of Temporal Expression Patterns for Multiple Genes in the Rat Carotid Artery Injury Model Arterioscler. Thromb. Vasc. Biol., October 1, 2000; 20(10): 2184 - 2191. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. D. Adams, R. L. Geary, B. McManus, and S. M. Schwartz A Comparison of Aorta and Vena Cava Medial Message Expression by cDNA Array Analysis Identifies a Set of 68 Consistently Differentially Expressed Genes, All in Aortic Media Circ. Res., September 29, 2000; 87(7): 623 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, Y.-S. Fan, L. H. Chow, C. Van Den Diepstraten, E. van der Veer, S. M. Sims, and J. G. Pickering Innate Diversity of Adult Human Arterial Smooth Muscle Cells: Cloning of Distinct Subtypes From the Internal Thoracic Artery Circ. Res., September 14, 2001; 89(6): 517 - 525. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||