Vascular Biology |
-Actin Promoter
| Abstract |
|---|
|
|
|---|
-actin gene abolished nuclear factor binding and
decreased transcriptional activity of a 271-bp SM
-actin promoter
fragment when transfected into rat aortic SMC. However, the promoter
region containing this conserved sequence has negative cis regulatory
activity when studied in homologous systems. The goal of the
present studies was to further characterize the transcriptional
activity of the rat SM
-actin promoter region between 224 and
236 that is conserved across mammals. DNAse I analysis and
electrophoretic mobility shift assays demonstrated that SMC nuclear
proteins bound an extended sequence (TGTTTATCCCCATAA). Transient
transfection experiments of wild-type and mutant rat SM
-actin
promoter-luciferase constructs into rat aortic SMC revealed that
promoter activity was enhanced by mutations of specific
nucleotides in the TGTTTATCCCCA region. Interestingly, the
TGTTTATCCCCA element in the rat SM
-actin promoter is centered
between 2 canonical E-boxes. Mutations of the flanking E-boxes
abolished the enhancement in promoter activity seen with mutation of
the TGTTTATCCCCA element alone. Thus studies provide evidence for a
regulatory cassette in the rat SM
-actin promoter that regulates
gene expression via combinatorial interactions between 2 E-boxes and a
newly described TGTTTATCCCCA element.
Key Words: SM
-actin E-box smooth muscle cell differentiation transcription
| Introduction |
|---|
|
|
|---|
-actin (SM
-actin), an increase in extracellular
matrix production, cell migration into the
neointima, and proliferation.1 4 5 6 The
molecular mechanisms regulating this process of phenotypic modulation
are poorly understood.
A key to understanding SMC differentiation and phenotypic modulation in
response to injury is to identify the mechanisms that regulate SMC
specific or selective gene expression. The principle function of
mature, fully-differentiated SMC is contraction. Therefore,
understanding the mechanisms that regulate transcription of SMC
contractile genes may provide important insight into the molecular
regulation of SMC differentiation and phenotypic modulation. SM
-actin and smooth muscle myosin heavy chain are logical candidates
for studying transcriptional regulatory systems in
SMC.1 5 7 8 9 SM
-actin is the most abundant contractile
protein in differentiated SMC.10 Although it is also
expressed in other cell types such as myofibroblasts,11
tumor cells,12 and transiently in cardiac and skeletal
muscle cells during development,13 14 it is almost
exclusively expressed in SMC in the adult.15 Additionally,
it has been shown that its expression is decreased in proliferating SMC
found within human atherosclerotic lesions.5
There is clear evidence that there are differences in the promoter
sequences required for SM
-actin gene expression depending on cell
type. Previous studies have demonstrated that 2 highly conserved
CArG boxes in the SM
-actin promoter are required for high
level expression of a 125-bp rat SM
-actin promoter/reporter
construct in rat aortic SMC. Interestingly, this 125-bp promoter region
lacked activity in L6 myotubes, a cell type that
endogenously expresses the SM
-actin gene. Additionally,
this 125-bp promoter/reporter construct exhibited high activity in
endothelial cells, a cell type that does not
endogenously express the SM
-actin gene.16
Moreover, this 125-bp promoter fragment was inactive when tested in
transgenic mice.17 It is also clear that the SM
-actin
promoter is regulated through combinatorial interactions between
different factors. Transforming growth factor-ß induced activity of
the 125-bp rat SM
-actin promoter is dependent on both an intact
transforming growth factor-ß control element and intact CArG
boxes.18 Additionally, the homeodomain factor MHox
activates SM
-actin transcription via a CArG/serum response
factordependent mechanism.19 Thus the molecular
mechanisms regulating SM
-actin gene expression are complex and
dependent on combinatorial interactions of both positive and negative
acting transcription factors that may differ between cell types.
Further studies in SMC suggest that the combinatorial interactions
regulating SM
-actin expression may be species dependent. Addition
of 5' promoter sequences to the minimal 125-bp rat SM
-actin
promoter resulted in a decrease in promoter activity when transfected
in rat aortic SMC, suggesting the presence of 5' negative cis-acting
elements.16 Consistent with these findings,
addition of the region from 257 to 151 of the chicken SM
-actin
promoter to the first 151 bp of the promoter resulted in a decrease in
activity when transfected into chicken embryonic and adult
SMC.20 In contrast, the 151-bp chicken promoter had low
level activity when transfected into rat aortic SMC. This activity was
enhanced by the addition of the 257 to 151 upstream
fragment.20 Mutation of the single E-box in this upstream
region had no effect on the activity of the chicken SM
-actin
promoter in rat aortic SMC, but the positive activity associated with
this region was completely abolished by a 2-bp mutation in a conserved
TGTTTATC sequence.21 Of key importance, results from these
studies using a heterologous system are in direct contrast with
previous results with this same fragment in a homologous
system20 (chicken SM
-actin promoter in chicken SMC)
and with a similar fragment of the rat SM
-actin promoter in rat
SMC.16 Unlike in the heterologous system, results in the
homologous system defined a negative regulatory activity to this
promoter region. Taken together, results suggest the presence of a
putative cis-acting element in the SM
-actin promoter that shows
species specific differences in its regulation.
Interestingly, one major difference in the promoter sequence in the
region from 257 to 151 between the chicken and the rat is that
although the chicken promoter contains one E-box consensus binding site
close to the TGTTTATC, the rat promoter contains 2 E-boxes flanking the
conserved TGTTTATC. The E-box is a consensus sequence (CANNTG) found in
the promoter of many cell specific genes, and E-boxbinding basic
helix-loop-helix (bHLH) factors are known to regulate
differentiation in a variety of cell types.22 In separate
studies, we have shown that mutation of either one of the 2 E-boxes in
this region abolished activity of the rat SM
-actin promoter in L6
myotubes.23 Moreover, specific mutations in both E-boxes
resulted in a modest decrease in SM
-actin promoter activity when
transfected into rat aortic SMC. However, despite attempts using
homology based library screening and the yeast 2-hybrid system, no SMC
specific HLH factor has as yet been identified (Owens and McNamara,
unpublished data, 1999). A number of ubiquitously expressed HLH
factors are present in cultured SMC including Id, and the
immunoglobulin transcription factor-1 protein,21
upstream stimulatory factor-1 (USF-1) and USF-2.23
Additionally, SMC within neointimal lesions formed after
experimental vascular injury in animals and within human
atherosclerotic plaques have also been shown to express
Id.24 Thus it is appealing to hypothesize that HLH factors
may regulate SM
-actin gene expression through combinatorial
interactions between ubiquitously expressed HLH factors and other
non-HLH transcription factors.
The goals of the present study were the following: 1) to determine
whether the TGTTTATC sequence in the rat SM
-actin promoter bound
rat aortic nuclear factors; 2) to identify the full sequence involved
in nuclear factor binding; 3) to determine whether this cis element has
negative transcriptional activity in this context; and 4) to determine
whether the flanking E-boxes are involved in regulating activity of the
TGTTTATC element. Results demonstrated specific nuclear factor binding
to a region that extends 3' to this element, ie, TGTTTATCCCCA. Specific
mutations throughout this region resulted in loss of nuclear factor
binding and enhancement of transcriptional activity. Mutation of the
flanking E-boxes abolished the enhancement of promoter activity seen
with mutation of the TGTTTATCCCCA element, suggesting that this region
contains a negative regulatory cassette that is dependent on
combinatorial interaction between the TGTTTATCCCCA element and the
flanking E-boxes. This report is the first to identify the negative
cis-acting element (TGTTTATCCCCA) in the rat SM
-actin promoter and
demonstrate a combinatorial interaction between this element and the
flanking E-boxes.
| Methods |
|---|
|
|
|---|
Cell Culture and Transient Transfection Assays
SMCs were plated 24 hours before transfection at a seeding
density of 2x104 cells/cm2
on a 30-mm plate in 2 mL of medium containing equal parts of
Dulbeccos modified Eagles medium (GIBCO) and Hams F-12 (GIBCO),
supplemented with 10% fetal bovine serum (GIBCO), 100 U/mL penicillin,
and 100 µg/mL streptomycin, designated DMEM-F12. Transfection of
plasmid DNA into rat aortic SMC was performed using DOTAP transfection
reagent (Boehringer Mannheim). The cells were washed twice with
2 mL of serum free medium before transfection. Five µg of rat SM
-actin promoter luciferase plasmid-DNA was mixed with 15 µl of
DOTAP and transfected into rat aortic SMC in serum-free medium
supplemented with antibiotics. Cells were incubated for 6 hours, the
media was changed to serum containing DMEM-F12 medium and the cells
were incubated at 37°C in 4% CO2 for 48 hours.
The cells were subsequently harvested in luciferase cell lysate buffer
and prepared by 1 freeze-thaw cycle, followed by
centrifugation to remove cellular debris. Twenty µl
of each cell lysate was mixed with 100 µl of luciferase substrate and
luciferase activity measured in a luminometer (Promega). An equal
volume of cell lysate was used for protein determination to normalize
for variation in cell numbers. Relative luciferase promoter activity
was expressed as fold increase over promoterless. To control for
variations in transfection efficiency, the experiments were performed
in triplicate and repeated a minimum of 3 times with a least 2
different preparations of DNA. We have previously found that use of a
cotransfected reporter plasmid to control for transfection efficiency
confounds data interpretation, apparently due to competition between
viral promoter LacZ constructs and test constructs. This is
particularly evident for the smooth muscle
-actin promoter that
includes a number of elements, such as CarG boxes that are important
for regulation of many viral promoters. Indeed, previous studies have
demonstrated that the activity of an internal control plasmid may be
suppressed by certain plasmids, overestimating the enhancer/promoter
activity of the cotransfected test plasmid.25 To avoid
introducing these undefined variables, we have used the accepted
alternative of conducting the experiments several times (n=3, each run
performed in triplicate) with at least 2 different preparations of each
DNA. As indicated by our data, the variability between replicate
samples is very acceptable.
Nuclear Extracts
Rat aortic SMC were grown in 225-cm2
flasks in DMEM-F12. The cells were harvested and nuclear extracts were
prepared by the procedure of Dignam et al.26
Electrophoretic Mobility Shift Assay
Twenty-one bp double stranded oligonucleotide
probes were obtained by hybridizing single-stranded
oligonucleotides (Operon Technologies). The sense
sequence for the wild-type oligonucleotide was
CAGGATGTTTATCCCCATAAG; for the mutated oligonucleotides
CAGGATacTTATCCCCATAAG, CAGGATGTTTgggCCCATAAG,
CAGGATGTTTATCtagATAAG, and CAGGATacTTATCtagATAAG.
The probes were labeled with
-32P-dATP, using
the Klenow fragment of DNA polymerase, and subsequently purified on
Stratagene push columns (Stratagene). Binding reactions were carried
out in 10 mmol/L Tris(hydroxymethyl) aminomethaneHCL
pH 7.5, 1 mmol/L ethylenediamine-tetraacetic acid (EDTA), 1
mmol/L dithiothreitol, 5% glycerol, and 50 mmol/L NaCl. Labeled
DNA probe (0.5 to 1.0 ng; 1 to 5x104 cpm) was
added to each reaction mixture containing 1 µg of double stranded
poly dI-dC and 6 µg of protein from crude nuclear extracts. Reaction
mixtures were incubated for 30 minutes at room temperature (RT). For
the competition experiments, the same conditions were used except that
the specific competitor oligonucleotides were added to
the reaction mixture 15 minutes before addition of the labeled probe.
The sample was loaded an a 5% polyacrylamide gel that had been
prerun in 0.5xTris-Boric-EDTA buffer at RT for 30 minutes.
Electrophoresis was carried out at 170 V until the dye front ran off
the gel. The gel was dried and autoradiographed with an intensifying
screen.
DNAse I Footprinting Analysis
A radiolabeled 386-bp polymerase chain reaction
product containing the TGTTTATCCCCA sequence was synthesized from a
p271Luc template using 32P-end-labeled forward
primer. After gel purification, double stranded probe was diluted to 1
to 2x104 cpm/µL in water. For footprint
assays, 20 µL of Dignam buffer D (controls) or 20 µL of SMC nuclear
extract in Dignam buffer D (60 to 70 µg of protein) was subsequently
diluted to 49 µL with DNA binding buffer to a final concentration of
10 mmol/L Tris pH 8.0, 0.5 mmol/L EDTA, 0.5 mmol/L
dithiothreitol, 2% polyvinyl alcohol, 2.5% glycerol, and 0.02 mg/mL
poly deoxyinosine/deoxycytidine. The mixture was incubated on
ice for at least 10 minutes 2 µL (2 to 4x104
cpm) of radiolabeled probe were added, and samples were incubated at
room temperature for 20 to 45 minutes. Two to three Units of DNAse-I
(Life Technologies) in 100 µL of 10 mmol/L
MgCL2 was added to the protein containing and
control samples and incubated for 30 seconds at RT. Reactions were
stopped with 150 µL of 8 mol/L urea/0.5% SDS/5 mmol/L EDTA. The
digested fragments were then extracted once with phenol and then twice
with phenol:chloroform:isoamyl alcohol, precipitated with ethanol, and
resolved on an 8% acrylamide sequencing gel. Fragment
bands were visualized by autoradiography. Specific
positions of protected nucleotides were determined using a
G+A chemical sequencing ladder, generated from the same radiolabeled
probe.
| Results |
|---|
|
|
|---|
-Actin
Promoter is a Binding Site for Nuclear Factors in Rat Aortic
SMC
-actin promoter, there is complete conservation of
the nucleotide sequence TGTTTATC in the region from -228
to -236 across all species whose SM
-actin promoters have been
cloned (Figure 1
|
|
|
The TGTTTATCCCCA Sequence in the Rat SM
-Actin Promoter
Functions as a Negative cis Element in Rat Aortic SMC
Previous studies in the chicken SM
-actin promoter
demonstrated that the conserved sequence TGTTTATC was transcriptionally
active in rat aortic SMC. Results of the preceding studies demonstrate
specific rat aortic nuclear factor binding to the conserved
TGTTTATCCCCA sequence in the rat SM
-actin promoter. To determine
whether this conserved element is transcriptionally active in rat
aortic SMC, transient transfection studies were performed. Various
mutations were introduced into this region of the rat SM
-actin
promoter by site directed mutagenesis. The 271-bp fragments of the SM
-actin promoter with wild-type sequence and specific mutations in
the TGTTTATCCCCA element was subcloned into a luciferase reporter
vector. The specific mutations tested were as follows:
TacTTATCCCCA=pGL271 Mut-1,
TGTTTgggCCCA=pGL271 Mut-2, TGTTTATCtagA=
pGL271 Mut-3, and TacTTATC-tagA=pGL271 Mut-4
(Figure 4A
). These plasmid constructs
were transiently transfected in parallel with the wild-type plasmid
(pGL271WT) into rat aortic SMC. As shown in Figure 4B
, all
mutations of this conserved region caused an increase in
transcriptional promoter activity relative to the wild-type promoter
when transfected into rat aortic SMC, suggesting that this cis-acting
element functions as a repressor of SM
-actin transcription.
|
The Repressor Function of the TGTTTATCCCCA Element in the SM
-Actin Promoter is E-BoxDependent
Mutation of the TGTTTATCCCCA element in the SM
-actin promoter
results in enhancement of SM
-actin transcription. Interestingly,
this element is flanked by 2 E-boxes in the rat SM
-actin promoter.
E-boxes, which contain a consensus sequence (CANNTG), are found in
regulatory regions of many skeletal muscle specific genes and bind a
family of helix loop helix proteins that are involved in skeletal
muscle differentiation. However, no SMC specific helix-loop-helix
proteins have been identified. Previous studies have shown that
mutation of essential nucleotides in the E-box flanking the
TGTTTATC element at position -215 in the chicken SM
-actin promoter
had no effect on promoter activity.21 Additionally, in
separate studies, we have shown that mutation of either 1 of the 2
E-boxes in the rat SM
-actin promoter alone did not affect promoter
activity. However, specific mutations in both E-boxes modestly reduced
SM
-actin promoter activity when transfected into rat aortic
SMC.23 To determine whether the E-boxes at positions 214
to 219 and 252 to 257 in the rat SM
-actin promoter were
involved in combinatorial interactions with the TGTTTATCCCCA element,
transient transfection experiments were performed. Mutations were made
in both E-boxes (CAGTTG to gtacTG at position -252 and
CAGCTG to CAagct at position -214 (see Figure 5A
) flanking the wild-type (pGL271EbmWT)
and mutated (pLG271EbmMut-2) TGTTTATCCCCA element. Constructs were
transiently transfected into rat aortic SMC. Results demonstrated that
the specific 4-bp mutations of both E-boxes in the context of an intact
core TGTTTATCCCCA region only minimally affected promoter activity of
the rat SM
-actin promoter in this rat aortic SMC line. However,
mutation of both E-boxes abolished the increase of transcriptional
promoter activity seen with mutation of the TGTTTATCCCCA in the
wild-type E-box context (pGL271 Mut-2) (Figure 5B
). These data
suggest that this promoter region functions as a regulatory cassette
where the activity of the TGTTTATCCCCA element is E-box dependent.
|
DNAse I Footprint Analysis Provided Evidence of Protein
Interaction With the TGTTTATCCCCATAA Element That Was Modified but not
Abolished by Mutations That Disrupted Functional Activity of This
Element
To further elucidate the nature of SMC nuclear protein interaction
with the TGTTTATCCCCA-containing region, DNAse I footprint
analysis was performed with a 386-bp radiolabeled polymerase
chain reaction product containing the TGTTTATCCCCA sequence
incubated with SMC nuclear extract. Results demonstrated protection of
the TGTTTATCCCCATAA-containing region from 221 to 236 (Figure 6
, compare lanes 2 and 3 to lane 4), as
well as changes in DNAse hypersensitivity (see upper and lower arrows).
No footprint was seen over E1 or E2 with the wild-type probe. To
determine whether mutation of the ATC sequence resulted in an
alteration in DNAase I footprinting of this region, we performed the
same experiment using a 386-bp promoter fragment containing the ATC to
GGG (Mut-2) mutation shown to abolish the repressor function of this
element (Figure 5
). Interestingly, the ATC mutation resulted in
alteration of the DNAse digestion pattern even in the absence of SMC
nuclear extract (Figure 6
, lane 6 versus lanes 2 and 3). For
example, there was diminution of the upper hypersensitive site and
modification of the digestion pattern over the TCCCC region. Addition
of SMC nuclear extract resulted in a lack of protection at the site of
the mutation but not complete loss of protein binding to the full
TGTTTATCCCCATAA region as there was some protection of the region 5'
and 3' to the GGG mutation, and the hypersensitive region 5' to the
TGTTTATCCCCATAA region was again seen. Interestingly, as observed with
the wild-type probe, no footprint was seen over E1 or E2 with the
mutated probe.
|
| Discussion |
|---|
|
|
|---|
-actin is important
for understanding the molecular mechanisms that regulate SMC
differentiation and the phenotypic modulation observed in vascular
disease. Results from DNAse I footprint analysis and EMSA
demonstrated that rat aortic nuclear factors bind to the specific
nucleotides TGTTTATCCCCA within the proximal 271 bp of the
SM
-actin promoter. Multiple mutations along the length of the
TGTTTATCCCCA element resulted in loss of nuclear factor binding and
increased activity of the rat SM
-actin promoter/reporter when
transfected into rat aortic SMC. Thus our results confirm and extend
previous observations indicating that the TGTTTATCCCCA element in the
224- to 236-bp fragment of the SM
-actin promoter indeed
repressed expression of the rat SM
-actin 271-bp promoter/reporter
construct in rat aortic SMC. Recent studies by Kimura et al provide
evidence in support of our hypothesis that the TGTTTATCCCCA element
within the 222- to 234-bp fragment of the SM
-actin promoter is
a negative regulatory element and also help clarify some significant
differences in regulation that may be a function of SMC tissue type or
species.27 Kimura et al demonstrated that the TATCTTA
sequence from 222 to 228 of the chicken SM
-actin promoter was
essential for the negative regulation of the chicken SM
-actin
promoter in gizzard SMC. Consistent with our data, mutation of
this region resulted in a 3-fold increase in chicken SM
-actin
promoter activity, providing evidence that this region functions as a
repressor in both vascular and gizzard SMC. Southwestern cloning
identified that the factor that bound this cis element was the chicken
homologue of the human c-myc gene single-strand binding protein-1
(MSSP-1). Indeed, the TATCTTA element is a consensus site for MSSP-1
binding and overexpression of MSSP-1 in gizzard SMC resulted in a
2-fold decrease in chicken SM
-actin promoter
activity.27 However, the sequence from 222 to 228 in
the chicken SM
-actin promoter is only 57% homologous with the
sequence in this region of the mammalian SM
-actin promoters. The
sequence of this region in the rat SM
-actin promoter (TATCCCC) is
not a consensus binding site for MSSP-1. There is some overlap in this
region of the rat promoter (TATC) with that of the chicken SM
-actin
promoter (TATCTTA). However, Takai et al demonstrated that it is the
TCTT sequence in the MSSP consensus site that is important for DNA
binding of the MSSP proteins.28 Mutation of either the TC
or TT sequences in this cis element resulted in loss of ability to
compete the MSSP proteins off of the promoter fragment containing the
wild-type consensus sequence in a gel shift assay. The rat SM
-actin
promoter does not contain the TT portion of this element. Although we
cannot rule out the fact that MSSP may be involved in the regulation of
the rat SM
-actin promoter, these data suggest that it is not
mediated by the TGTTTATCCCCA element. MSSP may be an important factor
accounting for the differences in our data when we tested the chicken
SM
-actin promoter in rat SMC21 versus the rat SM
-actin promoter in rat SMC (Figure 4
-actin promoter are tissue
type or species specific.
Further evidence for tissue-type or species-specific differences in the
cis- and trans-acting factors that regulate SM
-actin promoter
activity comes from additional transient transfection studies with
promoter fragments containing mutations of the TGTT 5' to the MSSP-1
consensus site in the chicken SM
-actin promoter. Kimura et al
demonstrated that mutation of this TGTT sequence in the chicken
promoter had no effect on promoter activity. In contrast, our transient
transfection data demonstrated that a 2-bp mutation (TGTTTATCCCCA to
TacTTATCCCCA) in the rat SM
-actin promoter enhanced promoter
activity suggesting that the TGTT sequence is important in regulating
the expression of the SM
-actin promoter in vascular but not gizzard
SMC. A TGTTT (TGT3) promoter element has been identified by DNAse I
footprinting in the Hepatitis B Virus enhancer29 ; however,
beyond the TGTTT, there is no sequence homology in the flanking
nucleotides of the element in the Hepatitis B virus with
that of the full protein-binding, transcriptionally-active SM
-actin
TGTTTATCCCCA element. The TGTTT-site in the Hepatitis B Virus enhancer
does overlap with the recognition sequences of at least 2 other DNA
binding factors. Analysis of subcomponents of the cis element
containing the TGTTT revealed that neither of the cis elements alone
exhibited enhancer activity, strongly suggesting transcriptional
regulation through combinatorial interaction of nuclear
proteins.29
Interestingly, the TGTTTATCCCCA site in the rat SM
-actin promoter
exhibits combinatorial interactions with the flanking E-boxes.
Expression of the rat SM
-actin promoter/reporter construct is
enhanced with mutation of the TGTTTATCCCCA element only in the presence
of intact E-boxes. The established paradigm for E-boxmediated
regulation of muscle specific gene expression involves E-box binding of
heterodimers of a cell specific HLH (such as MyoD) and a ubiquitously
expressed HLH (E-protein), resulting in transcriptional activation of
cell specific genes. However, recent data suggests that HLH factors can
control gene expression through combinatorial interactions with other
non-HLH transcription factors. For example, muscle enhancer factor
2 potentiates the transcriptional activity of the myogenic HLH
factors,30 and the intermediate Ets-1 binding site in the
immunoglobulin µ Heavy-Chain enhancer is required for transcriptional
synergy of the flanking E-boxes.31 Our data demonstrating
E-boxdependent activity of the TGTTTATCCCCA further extends this
observation. Moreover, these data provide the first evidence for
E-boxdependent combinatorial interactions regulating a SM selective
gene in SMC, although the specific mechanisms whereby the TGTTTATCCCCA
sequence interacts with the E-boxes are unclear. Of interest, in the
present studies, the activity of the E-boxes was only
"unveiled" in the context of mutation of the repressor element. In
contrast, in separate studies in separate SMC lines at earlier passage
number, we observed a modest decreases in promoter activity with
specific E-box mutations in the absence of mutation of the TGTTTATCCCCA
element.23 Although the exact reasons for these modest
differences are unclear, one possibility is that alteration in the
stoichiometry of the factors that interact with the E-boxes and
TGTTTATCCCCA change with phenotypic modulation in culture.
Consistent with this, cells at high passage showed greater
repressor activity. Obviously, this remains to be directly tested.
However, it is interesting to speculate that such differences may be
important in modifying the level of expression of SM
-actin in vivo
under conditions that lead to SMC phenotypic modulation such as in
response to vascular injury.
Results of our DNAse I footprint analysis failed to detect
nuclear proteins binding to the E-boxes flanking the TGTTTATCCCCA in
either the wild-type or mutated fragment. However, we cannot rule out
the possibility that bHLH factors bind these E-boxes under other
conditions. Indeed, separate studies by Johnson and Owens using EMSA
demonstrated that 2 cMyc-related bHLH-leucine zipper proteins (USF-1
and USF-2) bound to the E-box 3' to the TGTTTATCCCCA element.
Additionally, overexpression of USF-1 and USF-2 enhanced SM
-actin
transcription of p271CAT 2.5- to 3-fold.23 Johnson and
Owens further demonstrated that factors from rat aortic SMC nuclear
extract also bound the E-box 5' to the TGTTTATCCCCA; however, the
identity of this binding factor is unknown. Interestingly, these EMSA
studies were performed using oligonucleotides
containing the specific E-box sequences with 6 bp on the 5' end and 9
bp on the 3' end of both E-boxes. Of note, these promoter fragments do
not contain the TGTTTATCCCCA element. It is possible that differences
in E-box binding observed in our DNAse footprint assay and Johnson and
Owens EMSA could be secondary to differences in experimental
conditions. Alternatively, SMC nuclear proteins may bind both cis
elements in the cellular context and the interaction may be regulated
by chromatin structure, phosphorylation, or other
posttranslational modifications. It is also possible that mutation of
the E-boxes alters the secondary structure of the DNA affecting the
stability of the adjacent TGTTTATCCCCA protein complex.
In summary, results of the present study provide evidence for a
novel cis-acting element in the rat SM
-actin promoter
(TGTTTATCCCCA). Additionally, we demonstrate that this novel element
regulates rat SM
-actin gene transcription through combinatorial
interaction with the adjacent E-boxes. It is clear that different cis-
and trans-acting factors regulate SM
-actin promoter activity in
different species. As rat models are commonly used to study the role of
SMC in vascular lesion formation and SM
-actin expression is
decreased during vascular lesion formation, identification of the
TGTTTATCCCCA-binding factors and their specific interaction with the
adjacent E-boxes may provide important insight into the molecular
regulation of the SMC phenotypic modulation in vascular disease.
| Acknowledgments |
|---|
Received September 28, 1998; accepted May 19, 1999.
| References |
|---|
|
|
|---|
2.
Hanke H, Strohschneider T, Oberhoff M, Betz E, Karsch
KR. Time course of smooth muscle cell proliferation in the intima and
media of arteries following experimental angioplasty. Circ
Res. 1990;67:651659.
3.
Clowes AW, Clowes MM, Kocher O, Ropraz P, Chaponnier
C, Gabbiani G. Arterial smooth muscle cells in vivo:
relationship between actin isoform expression and mitogenesis and their
modulation by heparin. J Cell Biol. 1988;107:19391945.
4.
Blank RS, Thompson MM, Owens GK. Cell cycle versus
density dependence of smooth muscle alpha actin expression in cultured
rat aortic smooth muscle cells. J Cell Biol. 1988;107:299306.
5.
Glukhova MA, Kabakov AE, Frid MG, Ornatsky OI, Belkin
AM, Mukhin DN, Orekhov AN, Koteliansky VE, Smirnov VN. Modulation of
human aorta smooth muscle cell phenotype: a study of
muscle-specific variants of vinculin, caldesmon, and actin expression.
Proc Natl Acad Sci U S A. 1988;85:95429546.
6.
Kawamoto S, Adelstein RS. Characterization of myosin
heavy chains in cultured aorta smooth muscle cells. A comparative
study. J Biol Chem. 1987;262:72827288.
7.
Owens GK, Loeb A, Gordon D, Thompson MM. Expression of
smooth muscle-specific alpha-isoactin in cultured vascular smooth
muscle cells: relationship between growth and cytodifferentiation.
J Cell Biol. 1986;102:343352.
8.
Kuro-o M, Nagai R, Nakahara K, Katoh H, Tsai RC,
Tsuchimochi H, Yazaki Y, Ohkubo A, Takaku F. cDNA cloning of a myosin
heavy chain isoform in embryonic smooth muscle and its expression
during vascular development and in
arteriosclerosis. J Biol Chem. 1991;266:37683773.
9. Giachelli CM, Bae N, Almeida M, Denhardt DT, Alpers CE, Schwartz SM. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest. 1993;92:16861696.
10.
Fatigati V, Murphy RA. Actin and tropomyosin variants
in smooth muscles. Dependence on tissue type. J Biol
Chem. 1984;259:1438314388.
11. Arciniegas E, Sutton AB, Allen TD, Schor AM. Transforming growth factor beta 1 promotes the differentiation of endothelial cells into smooth muscle-like cells in vitro. J Cell Sci. 1992;103:521529.[Abstract]
12. Cintorino M, Bellizzi d, Leoncini P, Tripodi SA, Xu LJ, Sappino AP, Schmitt-Graff A, Gabbiani G. Expression of alpha-smooth-muscle actin in stromal cells of the uterine cervix during epithelial neoplastic changes. Int J Cancer. 1991;47:843846.[Medline] [Order article via Infotrieve]
13.
Ruzicka DL, Schwartz RJ. Sequential activation of
alpha-actin genes during avian cardiogenesis: vascular smooth muscle
alpha-actin gene transcripts mark the onset of
cardiomyocyte differentiation. J Cell Biol. 1988;107:25752586.
14. Woodcock-Mitchell J, Mitchell JJ, Low RB, Kieny M, Sengel P, Rubbia L, Skalli O, Jackson B, Gabbiani G. Alpha-smooth muscle actin is transiently expressed in embryonic rat cardiac and skeletal muscles. Differentiation. 1988;39:161166.[Medline] [Order article via Infotrieve]
15. Vandekerckhove J, Weber K. The complete amino acid sequence of actins from bovine aorta, bovine heart, bovine fast skeletal muscle, and rabbit slow skeletal muscle. a protein-chemical analysis of muscle actin differentiation. Differentiation. 1979;14:123133.[Medline] [Order article via Infotrieve]
16.
Shimizu RT, Blank RS, Jervis R, Lawrenz-Smith SC,
Owens GK. The smooth muscle alpha-actin gene promoter is differentially
regulated in smooth muscle versus non-smooth muscle cells. J
Biol Chem. 1995;270:76317643.
17.
Mack CP, Owens GK. Regulation of smooth muscle
alpha-actin expression in vivo is dependent on CArG elements within the
5' and first intron promoter regions. Circ Res. 1999;84:852861.
18.
Hautmann MB, Madsen CS, Owens GK. A transforming growth
factor beta (TGFbeta) control element drives TGFbeta-induced
stimulation of smooth muscle alpha-actin gene expression in concert
with two CArG elements. J Biol Chem. 1997;272:1094810956.
19.
Hautmann MB, Thompson MM, Swartz EA, Olson EN, Owens
GK. Angiotensin II-induced stimulation of smooth muscle
alpha-actin expression by serum response factor and the homeodomain
transcription factor MHox. Circ Res. 1997;81:600610.
20.
Blank RS, McQuinn TC, Yin KC, Thompson MM, Takeyasu K,
Schwartz RJ, Owens GK. Elements of the smooth muscle alpha-actin
promoter required in cis for transcriptional activation in smooth
muscle. evidence for cell type-specific regulation. J Biol
Chem. 1992;267:984989.
21.
McNamara CA, Thompson MM, Vernon SM, Shimizu RT, Blank
RS, Owens GK. Nuclear proteins bind a cis-acting element in the smooth
muscle alpha-actin promoter. Am J Physiol. 1995;268:C1259C1266.
22.
Olson EN. Myod family: a paradigm for development?
[review]. Genes Dev. 1990;4:14541461.
23.
Johnson AD, Owens GK. Differential activation of the
SMalphaA promoter in smooth vs. skeletal muscle cells by bHLH factors.
Am J Physiol. 1999;276:C1420C1431.
24. Matsumura M, Lobe DR, Jeon C, McNamara CA. Id3 and a novel isoform are involved in the response to vascular injury (abstract). Circulation. 1997;96:1274.
25.
Farr A, Roman A. A pitfall of using a second plasmid to
determine transfection efficiency. Nucleic Acids Res. 1992;20:920.
26.
Dignam JD, Lebovitz RM, Roeder RG. Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Res. 1983;11:14751489.
27.
Kimura K, Saga H, Hayashi K, Obata H, Chimori Y, Ariga
H, Sobue K. c-Myc gene single-strand binding protein-1, MSSP-1,
suppresses transcription of alpha-smooth muscle actin gene in chicken
visceral smooth muscle cells. Nucleic Acids Res. 1998;26:24202425.
28.
Takai T, Nishita Y, Iguchi-Ariga SM, Ariga H. Molecular
cloning of MSSP-2, a c-myc gene single-strand binding protein:
characterization of binding specificity and DNA replication activity.
Nucleic Acids Res. 1994;22:55765581.
29.
Ben-Levy R, Faktor O, Berger I, Shaul Y. Cellular
factors that interact with the hepatitis b virus enhancer. Mol
Cell Biol. 1989;9:18041809.
30.
Molkentin JD, Olson EN. Combinatorial control of muscle
development by basic helix-loop-helix and MADS-box transcription
factors [review]. Proc Natl Acad Sci U S A. 1996;93:93669373.
31.
Dang W, Sun XH, Sen R. ETS-mediated cooperation between
basic helix-loop-helix motifs of the immunoglobulin mu heavy-chain gene
enhancer. Mol Cell Biol. 1998;18:14771488.
32.
Min BH, Foster DN, Strauch AR. The 5'-flanking region
of the mouse vascular smooth muscle alpha-actin gene contains
evolutionarily conserved sequence motifs within a functional promoter.
J Biol Chem. 1990;265:1666716675.
33.
Reddy S, Ozgur K, Lu M, Chang W, Mohan SR, Kumar CC,
Ruley HE. Structure of the human smooth muscle alpha-actin gene.
Analysis of a cdna and 5' upstream region. J Biol
Chem. 1990;265:16831687.
34.
Carroll SL, Bergsma DJ, Schwartz RJ. Structure and
complete nucleotide sequence of the chicken alpha-smooth
muscle (aortic) actin gene. An actin gene which produces multiple
messenger RNAs. J Biol Chem. 1986;261:89658976.
This article has been cited by other articles:
![]() |
G. Elberg, L. Chen, D. Elberg, M. D. Chan, C. J. Logan, and M. A. Turman MKL1 mediates TGF-{beta}1-induced {alpha}-smooth muscle actin expression in human renal epithelial cells Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1116 - F1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. King, V. P. Iyemere, P. L. Weissberg, and C. M. Shanahan Kruppel-like Factor 4 (KLF4/GKLF) Is a Target of Bone Morphogenetic Proteins and Transforming Growth Factor beta 1 in the Regulation of Vascular Smooth Muscle Cell Phenotype J. Biol. Chem., March 21, 2003; 278(13): 11661 - 11669. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Chambers, P. Leoni, N. Kaminski, G. J. Laurent, and R. A. Heller Global Expression Profiling of Fibroblast Responses to Transforming Growth Factor-{beta}1 Reveals the Induction of Inhibitor of Differentiation-1 and Provides Evidence of Smooth Muscle Cell Phenotypic Switching Am. J. Pathol., February 1, 2003; 162(2): 533 - 546. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |