Original Contributions |
From the Institut National de la Santé et de la Recherche Médicale, (INSERM) Unité 321, Lipoprotéines et Athérogénèse, Hôpital de la Pitié, Paris, France.
Correspondence to Dr S. Griglio, INSERM Unité 321, Hôpital de la Pitié, 83 Boulevard de l'Hôpital, 75651 Paris Cedex 13, France. E-mail stengel@infobiogen.fr; sgriglio{at}infobiogen.fr
| Abstract |
|---|
|
|
|---|
Key Words: macrophage foam cells lipid peroxidation reverse transcriptionpolymerase chain reaction mRNA lipoprotein lipase
| Introduction |
|---|
|
|
|---|
The mechanism of the conversion of macrophages to foam cells containing large amounts of cholesterol, cholesteryl esters, and TGs is presently the subject of extensive investigation.6 The uptake of lipoproteins by such cells involves several receptors of distinct specificity, including scavenger receptors,7 CD36,8 and Fc receptors9 for oxLDL; the LDL receptor; the LDL receptorrelated protein receptor10 11 ; the VLDL receptor for TG-rich lipoproteins12 ; and last, membrane-binding proteins for uptake of certain TG-rich lipoproteins.13 These cellular uptake mechanisms are rendered complex by the contribution of additional factors such as heparan sulfate proteoglycans of the matrix and cell plasma membranes and equally by LPL,14 which may serve to "anchor" lipoproteins to the cell surface.
LPL is a key enzyme of lipoprotein metabolism that hydrolyzes the TG component of chylomicrons and VLDL.15 Moreover, LPL can act as a ligand to create a "bridge" between TG-rich lipoproteins and several receptors of the LDL family.16 LPL may also serve as a molecular bridge between LDL and proteoglycans.17 18 19 Growing evidence for the implication of LPL in lipoprotein uptake within arterial tissue is emerging. Indeed, LPL mRNA was recently shown to be expressed in the vessel wall in areas rich in macrophages and foam cells.20 21 22 Considered together, these findings suggest that LPL and entrapped lipoproteins may be localized in close proximity and thus may contribute simultaneously to the development of atheromatous lesions.
OxLDLs are characteristic constituents of both early and advanced atherosclerotic lesions.23 24 25 26 A major fraction of aortic LDL has been detected in mildly oxidized form and as such, is potentially atherogenic, given its capacity to induce secretion of monocyte chemotactic protein-127 , monocyte-endothelial adherence,28 and expression of macrophage-colony stimulating factor.29 LPL preanchored to endothelial cells binds mildly oxLDL with high affinity.30 Moreover, addition of LPL to J774 macrophages markedly increased the binding (50- to 100-fold) and uptake (20-fold) of mildly oxLDL31 but did not enhance the uptake of highly oxLDL.31 In contrast with extensive data on the interactions between LPL and lipoproteins, cell receptors, and proteoglycans, there is a paucity of information on the regulation of LPL secretion and mRNA expression in human macrophages by native and modified LDL.
In view of the potential pathophysiological role of LPL in the mechanisms governing the uptake of LDL and of oxLDL by macrophages, our aim was to determine the effect of such lipoproteins on LPL secretion and mRNA levels in human monocytederived macrophages. In particular, we examined the effect of the degree of oxidative modification of LDL on its biological activity in this cellular system. In contrast to mildly oxLDL, highly oxLDL markedly inhibited LPL activity and mRNA expression in monocyte-derived macrophages. Our data support the hypothesis that the inhibitory effect of highly oxLDL was mediated, at least in part, by lysoPC, a product of PC formed by phospholipolysis during extensive LDL oxidation.
| Methods |
|---|
|
|
|---|
-32P]dATP (3000 Ci/mmol) and glycerol
tri[9,10(n)-3H]oleate (680.8
GBq/nmol) were purchased from Amersham and Dupont de Nemours
DivisionNEN. The following antibodies were from Dako: anti-CD68
(clone KP1), anti-CD14 (clone TÛK4), anti-CD3 (clone T34B5),
and goat anti-mouse FITC-conjugated IgG. The chromogenic
Limulus amebocyte lysate assay for
lipopolysaccharide was purchased from Biogenic. The assay kits
for LDH and protein bicinchoninic acid assay reagents were purchased
from Boehringer Mannheim and Pierce Interchim, respectively.
All other reagents were from Sigma Chemical Co.
Isolation and Culture of Human MonocyteDerived
Macrophages
Human mononuclear cells were isolated from freshly drawn blood
samples of individual healthy donors (20 to 35 mL) as described
earlier.32 In brief, blood diluted with PBS (1:1,
vol/vol) was carefully loaded onto a Ficoll gradient under sterile
conditions. After an initial centrifugation step (20
minutes at 2700g), monocytes were collected at the interface
and then washed 3 times at room temperature in PBS containing 0.1%
EDTA (successively at 1000g, 340g, and
160g for 10 minutes) and then once in PBS alone at
160g for 10 minutes. Finally, the cell pellet was
resuspended in RPMI-1640 medium containing gentamicin (40 µg/mL) and
glutamine (0.05%). A typical monocyte preparation yielded 100 to
300x106 cells per donor. The cells were
distributed at a density of 1x106 cells per well
in Primaria 24-well plastic culture dishes (for LPL activities and
lipid determinations) and 3x106 cells per well
in Primaria 6-well dishes (for RNA assays). After 45 minutes of
adherence, the cells were washed twice with PBS; finally, fresh medium
containing 10% pooled human sera was added. At day 12 of culture,
monocyte-derived macrophages (denoted macrophages) were
washed 3 times with PBS and then incubated for defined time intervals
with LDL, oxLDL, or acLDL in the aforementioned culture medium to which
1% Nutridoma had been added instead of human serum. For determination
of LPL activity, heparin (Choay) (10 U/mL) was added at the same time
as the lipoproteins and incubated for 24 hours. LPL activity released
into the medium was at least 10-fold higher in the presence of heparin;
cell-associated activity was then barely detectable. When LPL secretion
was measured during macrophage maturation, the medium
containing heparin was replaced 24 hours before the day indicated in
the time-course study. All cell cultures incubated with lipoproteins,
oxysterols, or lysoPC were carried out in a humidified 37°C incubator
(95% air atmosphere/5% CO2). Cell viability was
measured by trypan blue exclusion and by the release of LDH activity
(5% to 10%) into the medium. At the end of the incubation period (6
or 24 hours), medium from the 24-well plates was immediately taken and
stored at -80°C for determination of LPL activity. Cells were washed
3 times with cold PBS and further incubated overnight with 0.1N NaOH
for cell protein determination by the bicinchoninic acid method. After
6 hours of incubation, total RNA from 6-well plates was immediately
extracted with RNA plus.
Characterization of Human MonocyteDerived Macrophages
Monocytes and macrophages were characterized with
specific antibodies that were detected by indirect
immunostaining. CD14 and CD68 were used as specific
makers for monocytes and CD3 for lymphocytes. At day 12 of culture, all
adherent cells were CD68-positive and CD3-negative, thus indicating the
absence of T cells.
Lipoprotein Purification and Chemical Modifications
Normolipidemic plasma of healthy blood donors was used to
isolate LDL by sequential ultracentrifugation. Native
LDLs (d=1.024 to 1.050 g/mL) were centrifuged at
their upper limiting density and thereafter exhaustively dialyzed at
4°C against degassed 0.01 mol/L PBS at pH 7.4. Aliquots of LDL were
taken to check the purity of each preparation as described
elsewhere.33 Protein content was determined by
the assay of Lowry et al.34 Copper-oxidized LDLs
were prepared under sterile conditions by incubating 500 µg LDL
protein per milliliter in PBS containing 2.5 µmol/L
CuCl2 for 48 hours or for the indicated times at
37°C. At the end of the incubation period, oxLDLs were extensively
dialyzed at 4°C against PBS (pH 7.4). AcLDLs were prepared with
acetic anhydride as described by Basu et al.35
All lipoprotein fractions were dialyzed against PBS buffer at pH 7.4,
then against RPMI-1640, and subsequently filtered through a 0.22-µm
filter (Millipore). The time course of the copper-induced oxidation of
LDL was deduced from the spectrophotometric measurement of
conjugated-diene formation at 234 nm. The net electric charge of both
native LDL and oxLDL at pH 8.6 was determined by electrophoresis in
agarose gel.36 The electrophoretic mobility was
expressed as the electrophoretic mobility (REM) of oxLDL relative to
that of native LDL (REM). Determination of the content of
thiobarbituric acidreacting substances, expressed as
malondialdehyde (MDA) equivalents,37 and of
lipoperoxides (LPOs)38 in oxLDL provided an estimation of
the degree of lipid oxidation. Endotoxin content of oxLDL was measured
with the chromogenic Limulus amebocyte lysate
assay and was found to be <50 pg/100 µg oxLDL protein.
LPL Assay
LPL activity in the cell incubation medium was assayed with a
trioleate-lysoPC emulsion.39 Aliquots (50 to 100
µL) of cell incubation medium were incubated with 100 µL of a
substrate emulsion mixture containing 2.64 mmol/L glyceryl
trioleate, 61 Bq glycerol
tri[9,10(n)-3H]oleate (NEN; specific
activity, 680.8 GBq/nmol), 0.21 mmol/L L-
-lysoPC,
0.4% BSA, 0.2 mol/L Tris HCl at pH 8, and 0.3 mL
heat-inactivated human serum for 3 mL of emulsion. The
enzymatic reaction was carried out in a shaking bath for 60 minutes at
30°C. The reaction was stopped by successively adding 3.25 mL of
solvent mixture (methanol/chloroform/heptane, vol/vol/vol, 1.41/1.25/1)
and 1.02 mL of borate buffer at pH 10.40
Liberated radiolabeled fatty acids were counted in the upper phase. One
unit of enzyme activity corresponded to 1 nmol of free fatty acid
liberated per minute per milligram of cellular protein.
RNA Isolation, First-Strand cDNA Synthesis, and RT-PCR
Total RNA was isolated from adherent macrophages with
RNA Plus, and its concentration was determined by spectrophotometry at
260 nm. First-strand cDNA synthesis was performed with 5 or 10 µg of
total RNA. Immediately before use, RNA was heated for 5 minutes at
70°C in the presence of RNasin (2 U), oligodT (2 µg), and antisense
oligonucleotide LPL-3 (1 µg)
(CATTCTTCACAGAATTCACATGCC) in aqueous solution in a total volume of 30
µL; after denaturation, RT was performed at 37°C for 2 hours in a
total volume of 50 µL containing 1x reverse transcriptase buffer,
0.5 mmol/L dNTP, 10 mmol/L DTT, and 500 U of SuperScript
M-MLV reverse transcriptase. Detection and quantification of LPL mRNA
were performed by RT-PCR in the presence of two specific
oligonucleotides, LPL-1 (5'-GAGATTTCTCTGTATGGCAC-3')
and LPL-2 (5'-CTGCAAATGAGACACTTTCT C-3'). The incubation volume was
adjusted to 50 µL by adding master mix components to the first-strand
cDNA dilutions; the final concentrations were 1x Taq DNA
polymerase buffer, 0.2 mmol/L dNTP, 200 ng
oligonucleotides of each upstream and downstream
primer, and 0.5 U of Taq DNA polymerase. Incubations were
performed in a Schleicher & Schuell OmniGene thermal cycler, starting
with a cycle at 94°C for 5 minutes followed by 35 successive cycles
of 1 minute at 94°C, 45 seconds at 55°C, and 1 minute at 72°C
successively; these cycles were followed by 1 cycle for 7 minutes at
72°C before storage. The PCR products were analyzed by
fractionation of 10-µL aliquots on a 3% agarose/TAE gel. Control
samples analyzed in the absence of reverse transcriptase were
free from genomic DNA. Competitive PCR experiments were performed in
the presence of DNA-mimic actin or GAPDH from Clontech Laboratories
(0.01 to 1 amol per assay) for 30 cycles at 60°C as described in
Reference 4141 and according to Clontech recommendations.
Analysis of LDL Phospholipids by Thin-Layer
Chromatography
LDL lipids were extracted with chloroform/methanol (2:1,
vol/vol) as described.42 The lipid extracts were
dried under N2, redissolved in 200 µL of
CHCl3-CH2OH (2:1, vol/vol), and
separated by thin-layer chromatography on silica gel 60
plates (Merck) with a solvent mixture of chloroform/methanol/water
(65/35/6, vol/vol/vol) as the mobile phase. Lipid spots were visualized
with I2 vapor. Phospholipid identification was
performed by cochromatography with known standards of
L-
-PC from egg yolk (Sigma) and L-
-lysoPC
from egg yolk (Sigma). After complete disappearance of the
I2 color, bands were scraped from the plates and
eluted from the silica gel with CHCl3-CHOH (2:1,
vol/vol). Aliquots were dried and resuspended in isopropanol, and
phospholipids were quantified with a commercial kit (Boehringer
Mannheim).
Statistical Analysis
Data are expressed as mean±SEM. Differences were examined by
the paired Student's t test. A value of P<0.05
denoted a significant difference. All experiments were repeated at
least 3 times with different cell and lipoprotein preparations.
Representative experiments are indicated in the
text.
| Results |
|---|
|
|
|---|
|
Effect of Modified LDL on Human Macrophage LPL Activity and
mRNA Expression
Macrophages obtained after 12 days of culture were
incubated with native LDL (100 µg protein per milliliter) or with LDL
from the same preparation that had either undergone copper-mediated
oxidation for 48 hours (ox48 hoursLDL) or been
modified by acetylation (acLDL) as described in the Methods
section. Native LDL and acLDL had no significant effect on either LPL
activity (Figure 2A
) or mRNA level
(Figure 2B
). In contrast, oxLDL exerted marked inhibition of LPL
activity (-62%, P<0.01) and induced reduction in the mRNA
level (-47%, P<0.05); such inhibition was shown to be
dose dependent (Figure 3A
and 3B
). The
observation that acLDL had no impact on LPL activity and mRNA abundance
indicated that modified LDL in which the lysine residues of apoB100 had
undergone derivatization exerted no detectable effect on LPL expression
and led us to postulate that a lipid component formed during LDL
oxidation might be involved in such regulation. We verified that such
inhibition was not due to the potential cytotoxicity of oxLDL, because
under our conditions, LDH release was identical for all LDL
preparations (<10% release into the medium versus cell-associated LDH
activity). In addition, cell protein content was not affected, and the
expression of actin and scavenger receptor I and II mRNAs remained
unaffected or slightly increased after oxLDL treatment, as reported
earlier.41 Moreover, in the same experiments,
inhibition of platelet-activating factor receptor gene expression by
oxLDL was reversible, as shown by an additional 24-hour incubation in
medium devoid of oxLDL. If cytotoxicity has been demonstrated in vitro
for mouse macrophages incubated with LDL oxidized for 24 hours
with 5 µmol/L CuSO443 ,
oxLDL prepared under our conditions (48 hours with 2.5 µmol/L
CuCl2, followed by extensive dialysis) had no
detectable effect on macrophage morphology, as evaluated by
scanning electron microscopy (G. Le Naour et al, unpublished findings,
1997).
|
|
Effect of Ox48 hoursLDL on the Stability of LPL mRNA in
Monocyte-Derived Macrophages
The stability of LPL mRNA in monocyte-derived
macrophages was evaluated with actinomycin D (5 µg/mL), a
specific inhibitor of mRNA synthesis. Macrophages
were first incubated in the presence or absence of oxLDL
(ox48 hoursLDL, 100 µg protein per milliliter)
for 1 hour before addition of actinomycin D. After 1, 2, or 4 hours of
incubation, control and treated macrophages were washed and
total mRNA extracted. LPL mRNA was measured by RT-PCR (Figure 4
). No significant difference in the
stability of the LPL mRNA was observed under both conditions.
|
Effect of the Degree of Oxidation of LDL on Macrophage LPL
Activity and mRNA Expression
Ox48 hoursLDLs were compared with LDLs from
the same plasma sample but oxidized for shorter periods (1, 2, 3, 4, or
6 hours). Although the oxidative resistance of LDL varied among the
different LDL preparations, similar values were obtained for the
formation of LPOs, MDA, and modification of REM as a function of the
period of oxidation (Table
). REM
increased progressively with the period of oxidation, whereas MDA
levels increased after 2 hours and remained stable thereafter until 48
hours. LPO levels increased until 6 hours but decreased after 48 hours
of LDL oxidation, in agreement with other authors who moreover reported
a transient peak for LPO levels after 24 hours of LDL
oxidation.38 44
|
Expression of LPL activity by monocytes-macrophages was
not modified by LDL oxidized for short periods (up to 2 hours) but
increased slightly (25% of control) on incubation with LDL oxidized
for 3 or 4 hours; enzyme activity declined in the presence of LDL
oxidized 6 hours (ox6 hoursLDL), attaining levels
(-31%) intermediate between those induced by native LDL (as the
control) and by highly oxLDL (ox48 hoursLDL,
-62%) (Figure 5A
). LPL mRNA levels were
measured after incubation of macrophages with 2 houroxidized
LDL (ox2 hoursLDL) and were similar to those
detected under control conditions, whereas incubation with
ox6 hoursLDL led to mRNA levels that were
comparable with those obtained with ox48 hoursLDL
(-70% and -45% of control levels) (Figure 5B
). Thus, a threshold
degree of oxidation (6 hours or more) appears necessary to inhibit LPL
expression in human monocytederived macrophages.
|
Effect of 7ß-OH and 25-OH on LPL Activity in Human
Macrophages
Among the complex products of lipid oxidation, two oxysterols,
namely 7ß-OH and 25-OH, at 5 µg/mL concentration have been recently
shown to inhibit both the release of LPL activity (-50%) and the
expression of LPL mRNA (-60% and -70% for each oxysterol,
respectively)45 when added to human
monocytederived macrophages cultured for 7 days. Under our
incubation conditions, 7ß-OH but not 25-OH added at a concentration
of 5 µg/mL induced a significant diminution of LPL activity (-27%,
P<0.05) (Figure 6
). On
incubation of macrophages for 12 days under the same conditions
as those of Mattsson Hultén et al,45 ie,
medium containing 10% human and 10% fetal calf serum during cell
growth followed by 10% fetal calf serum for incubation with sterols,
we detected a significant decrease in LPL activity (-25%,
P<0.05) with 7ß-OH but a greater reduction (-52%,
P<0.01) with 25-OH. The difference in the response of
macrophage LPL to 25-OH appears to result from the addition of
fetal serum to the incubation medium, thereby introducing growth
factors that may potentiate 25-OH toxicity.
|
Formation of LysoPC During LDL Oxidation and Effect on LPL Activity
in Human Macrophages
LysoPC concentrations increased 2-fold after 6 hours and
4-fold after 48 hours of LDL oxidation, whereas PC contents decreased
by 43% and 69% in the respective LDL populations (Table
). Such
variations have also been reported by other
authors.46 47 LysoPC was tested at final
concentrations of 2, 10, and 20 µmol/L, corresponding to levels
that were in the range of concentrations added as ox48
hoursLDL. We observed a clearcut inhibition of LPL activity
(-34% with 2 µmol/L, P<0.01 and -53% with
20 µmol/L, P<0.01) to
suppress in the absence of any detectable
toxic effect (Figure 7A
). LPL mRNA abundance was markedly decreased
(-60%) at lysoPC concentrations as low as 2 µmol/L (Figure 7B
).
|
| Discussion |
|---|
|
|
|---|
The observation that acLDL did not modify LPL expression in human monocytederived macrophages indicates that chemical derivatization of apoB100, which occurs during LDL oxidation, is not directly implicated in the inhibition exerted by oxLDL. The active moiety in oxLDL therefore appears to be a lipid. In this context, it is relevant that recent experiments on CD36 cDNA-transfected cell lines have shown that delipidated oxLDLs do not bind to the CD36 receptor, which normally recognizes oxLDL.48 Also, chloroform extracts of oxLDL lipids were shown to activate mitogen-activated protein kinase activity, as did intact oxLDL.49 Considered together, these observations suggest a direct role of oxidized lipids in the cellular binding and metabolic effects of oxLDL but do not exclude the possibility that the oxidative modification of apoB100 may also play a role. Indeed, an enhanced binding of moderately oxLDL (after long-term storage in the absence of EDTA) to LPL anchored to the endothelial cell matrix has been shown to result from modification of apoB100.30
Moderately copper-oxidized LDL (<6 hours) was without effect on both LPL activity and mRNA levels. By contrast, LDL obtained after prolonged copper oxidation (6 or 48 hours) significantly decreased the secretion of active LPL activity by cultured macrophages. In this respect, it is relevant that the lysoPC content of oxLDL increased 2-fold after 6 hours of copper-mediated oxidation, attaining a 4-fold elevation after 48 hours in our experiments; in parallel, the proportion of PC, its precursor, declined over the same period of time. Indeed, as much as 50% of LDL PC can be converted to lysoPC during oxidation.50 As reported herein, addition of lysoPC to our monocyte-macrophage system induced significant reductions in LPL activity and mRNA abundance. The concentrations used (2 to 20 µmol/L) were in the range of lysoPC levels detected in LDL during their progressive oxidation (from 5.6 to 15 nmol/100 µg LDL protein), thereby suggesting that lysoPC is a potent mediator of the inhibitory effect of oxLDL on macrophage LPL expression.
Insight into the biological activity of lysoPC in oxLDL has been gained from experiments in which the endogenous content of lysoPC has been increased by the action of phospholipase A2. Thus, phospholipase A2treated LDL becomes more negatively charged and enriched in lysoPC and thereafter is more efficiently endocytosed51 via the macrophage scavenger pathway.52 If acLDL, which is devoid of lysoPC, is also treated with phospholipase A2, then it acquires lysoPC levels and mitogenic properties similar to those of oxLDL.52 We also treated native LDL with phospholipase A2 and measured both an increase in its lysoPC content and a decrease in macrophage LPL activity (47%, P<0.01) when cells were incubated with phospholipase-treated LDL (S.G. et al, unpublished findings, 1997). Thus, lysoPC either added alone or formed endogenously in LDL mimics certain biological properties of oxLDL, such as the inhibition of LPL activity secreted by macrophages. By analogy with the former observations, the difference we observed between oxLDL, which decreased LPL expression in monocyte-macrophages, and acLDL, which was without effect, could be explained on the basis of the distinct lysoPC contents of these LDL preparations. Indeed, the lysoPC content of acLDL was 26.5±2.18 nmol/mg LDL protein6 and did not differ from that of native LDL. The exact mechanism by which lysoPC decreases LPL activity and mRNA levels remains to be defined. Nonetheless, lysoPC has been demonstrated to activate the adenylyl cyclase system in human platelets, in a megakaryoblastic cell line, and in monocyte-like THP-1 cells53 and to potentiate the diacylglycerol-induced activation of protein kinase C,54 thereby suggesting that this molecule is an important lipid messenger in macrophages.
Recently, it has been shown that cholesterol hydroperoxides are among the initial products of copper oxidation in LDL; subsequently, oxysterols attain elevated levels at 5 hours.55 The content of 7ß-OH and 25-OH in LDL preparations, prepared in our laboratory under exactly the same oxidative conditions as in the current study, increased from initial levels of 7.8 and 5.7 ng/mg LDL protein, respectively, to 354 and 9.3 ng/mg LDL protein after 6 hours and to 41 284 and 878 ng/mg protein LDL after 48 hours of copper oxidation.44 Such levels correspond to 4.1 µg of 7ß-OH and 0.09 µg of 25-OH per 100 µg of oxLDL protein and were in the range of concentrations tested herein. Mattson Hultén et al45 showed that both of these oxysterols were potent inhibitors of the expression of human macrophage LPL activity and mRNA mass, while under our conditions, only 7ß-OH had a biological effect. Such discrepancies may have arisen from addition of fetal calf serum to the incubation medium by the aforementioned authors45 ; the underlying mechanism remains indeterminate, however. The cytotoxicity of oxysterols to various cell types has been documented and evaluated in human monocytederived macrophages,56 in which oxysterols may activate apoptosis. At the low dose of oxysterols (5 µg/mL) that we used, toxicity was not detectable; however, they became toxic at the higher concentrations that we tested (>7.5 µg/mL). In vivo, several oxysterols have been identified in atherosclerotic lesions,57 58 whereas lysoPC is detectable in the lesions of animals fed an atherogenic diet59 and in human atheromatous plaque.25 Moreover, lipid peroxidation/protein adducts have also been detected in macrophages in human atherosclerotic plaques.26 Although the respective roles of these oxidized components of oxLDL remain to be established in vivo, their presence in plaques suggests that they may influence the overall macrophage phenotype and LPL expression in particular.
With respect to the potential atherogenic action of LPL, mildly oxLDL (<6 hours) did not modify enzyme expression in human macrophages; by contrast, uptake of such LDL was markedly enhanced (20-fold) in J774 macrophages on addition of exogenous, purified bovine LPL.31 From this observation and from our own findings, we speculate that LPL is particularly efficient in promoting macrophage uptake of mildly oxLDL because LPL expression is not downregulated by the latter. In vivo, LDLs isolated from plaques and fatty streaks are moderately oxidized.24 Thus, higher uptake and sustained LPL secretion could reinforce the atherogenic process associated with mildly oxLDL. By contrast, highly oxLDLs, which induce reduction in macrophage-associated LPL activity and mRNA levels, are internalized by macrophages via pathways such as the scavenger receptor and the CD36-oxLDL binding protein and which are distinct from that mediated by LPL-proteoglycan complexes. Highly oxLDL appears therefore to transform macrophages into foam cells through several mechanisms, which include inhibition of cholesterol efflux60 and inactivation of lysosomal proteases.61 Our data thus suggest that progressive oxidation of LDL is associated with at least two distinct mechanisms of induction of foam cell formation.
In summary, the current study demonstrates that LPL expression (enzyme activity and mRNA levels) is differentially modulated in human monocytederived macrophages by potentially atherogenic oxLDL that accumulates in the arterial wall. Highly oxLDL downregulates LPL expression in a dose-dependent manner, thereby reflecting the inhibitory action of LDL-associated lysoPC. In contrast, mildly oxLDL did not downregulate LPL expression; therefore, their binding and uptake by macrophages are markedly increased given the high affinity of LPL for such LDL.31 These investigations demonstrate that the degree of oxidation of LDL is intimately related to the mechanism of their binding and uptake by macrophages and in turn, to the role of LPL in this process. Clearly, LPL play a key role in the cellular and molecular mechanisms that regulate foam cell formation.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received April 30, 1997; accepted February 16, 1998.
| References |
|---|
|
|
|---|
2-macroglobulin receptor/low density lipoprotein
receptor-related protein and scavenger receptor in human
atherosclerotic lesions. J Clin Invest. 1994;93:20142021.
This article has been cited by other articles:
![]() |
G. Muller, R. A. Catar, B. Niemann, M. Barton, L. Knels, M. Wendel, and H. Morawietz Upregulation of endothelin receptor B in human endothelial cells by low-density lipoproteins. Experimental Biology and Medicine, June 1, 2006; 231(6): 766 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cuaz-Perolin, C. Furman, G. Larigauderie, L. Legedz, C. Lasselin, C. Copin, M. Jaye, G. Searfoss, K.T. Yu, N. Duverger, et al. REDD2 Gene Is Upregulated by Modified LDL or Hypoxia and Mediates Human Macrophage Cell Death Arterioscler. Thromb. Vasc. Biol., October 1, 2004; 24(10): 1830 - 1835. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. OSTERUD and E. BJORKLID Role of Monocytes in Atherogenesis Physiol Rev, October 1, 2003; 83(4): 1069 - 1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R Mead and D. P Ramji The pivotal role of lipoprotein lipase in atherosclerosis Cardiovasc Res, August 1, 2002; 55(2): 261 - 269. [Full Text] [PDF] |
||||
![]() |
M.-C. Beauchamp, E. Letendre, and G. Renier Macrophage lipoprotein lipase expression is increased in patients with heterozygous familial hypercholesterolemia J. Lipid Res., February 1, 2002; 43(2): 215 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ouchi, S. Kihara, Y. Arita, M. Nishida, A. Matsuyama, Y. Okamoto, M. Ishigami, H. Kuriyama, K. Kishida, H. Nishizawa, et al. Adipocyte-Derived Plasma Protein, Adiponectin, Suppresses Lipid Accumulation and Class A Scavenger Receptor Expression in Human Monocyte-Derived Macrophages Circulation, February 27, 2001; 103(8): 1057 - 1063. [Abstract] [Full Text] [PDF] |
||||
![]() |