Original Contributions |
From the Medizinische Kernklinik und Poliklinik, Universitäts-Krankenhaus Eppendorf, Hamburg, Germany.
Correspondence to Jobst Greeve, Medizinische Klinik, Universitäts-Krankenhaus Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany.
| Abstract |
|---|
|
|
|---|
Key Words: apo B mRNA editing hepatic expression APOBEC-1 TATA-less promoter
| Introduction |
|---|
|
|
|---|
Editing of apo B mRNA is mediated by a multicomponent enzyme complex termed apo B mRNA editing enzyme.4 8 9 10 Its catalytic subunit APOBEC-1 (apo B editing catalytic polypeptide 1) is a cytidine deaminase with a novel RNA binding motif.11 12 13 14 15 16 APOBEC-1 requires additional "auxiliary" proteins for efficient apo B mRNA editing.11 12 13 14 15 16 In mice and rats, APOBEC-1 is expressed in many organs, the highest expression being found in the small intestine, spleen, and liver, followed by the kidney, lung, skeletal muscle, and heart.11 17 Editing of apo B mRNA in the rat and mouse liver can be modulated by developmental, hormonal, or nutritional stimuli, most of which apparently do not modulate the expression of APOBEC-1.18 19 20 21 22 23 24 25 Thus, apo B mRNA editing in the rat or mouse liver is dependent on both the abundance of APOBEC-1 and other trans-acting factors yet to be conclusively identified.26 27 28 In humans and rabbits, which do not edit hepatic apo B mRNA, APOBEC-1 is mainly expressed in the small intestine and, to some extent, in the colon (rabbit) but in no other organ.14 29 The lack of APOBEC-1 limits the editing of apo B mRNA in the liver of mammals that do not edit hepatic apo B mRNA.
Adenovirus-mediated expression of APOBEC-1 in the rabbit liver in vivo leads to editing of hepatic apo B mRNA and consequently to a substantial reduction of circulating plasma LDL levels in normal and Watanabe heritable hyperlipidemic rabbits.30 31 In mice transgenic for human apo(B) and human apo(a), hepatic overexpression of APOBEC-1 by adenovirus-mediated gene transfer lowers Lp(a) levels in plasma.32 Thus, induction of apo B mRNA editing in the human liver appears to be a promising genetic approach to reduce elevated plasma levels of the atherogenic LDL or Lp(a).33 In APOBEC-1 transgenic mice and rabbits, however, in which APOBEC-1 expression was driven by the promoter of the human apo E gene, hepatocellular dysplasia and carcinoma developed in nearly every animal.34 Naturally, APOBEC-1 can be expressed in the liver of horses, dogs, rats, and mice without obvious oncogenic effects.7 11 17 The molecular basis for the hepatic expression of APOBEC-1 in these mammalian species is therefore of great interest. In the current investigation, the genomic organization of the rat APOBEC-1 gene and its expression pattern were studied. Two distinct promoters induce APOBEC-1 expression in the rat liver and intestine. The upstream, liver-specific promoter of the rat APOBEC-1 gene has the capacity to induce APOBEC-1 expression and apo B mRNA editing in human hepatoma cells.
| Methods |
|---|
|
|
|---|
Isolation and Characterization of Rat APOBEC-1 Genomic
Clones
A rat genomic EMBL-3 SP6/T7 library, prepared from adult male
Sprague-Dawley rats, was purchased from Clontech (catalog No. RL1022).
Recombinant phages (4x106)were screened by
hybridization with a full-length APOBEC-1 cDNA as described
previously.30 One hybridizing
-clone was
plaque purified for 3 rounds. Phage particles were purified from plaque
lysate by using a rabbit polyclonal antibody, and phage DNA was
purified on glass-milk (Lambda-Trap Plus, Clontech). The
-DNA was
digested with SacI, and the resulting restriction fragments
of 6.2, 4.0, 3.8, and 1.2 kb were cloned in SacI-digested
pT7/T3 (Pharmacia). The resulting recombinant plasmids were hybridized
with rat APOBEC-1 oligonucleotides to align them to the
cDNA sequence. The exon-intron junctions were sequenced by using the
ABI PRISM dye terminator cycle sequencing ready reaction kit
(Perkin-Elmer) with the following primers: DA113 (3' splice acceptor in
exon 2); APOBEC I (5' splice donor in exon 2); DA17
(TTCCCACATGATTTGTAGATTTGGGA GACT, sense primer in intron 2 for
sequencing exon 3 and its junctions); APOBEC XIV
(AGTCCTTGCCGATTTCGAGGATCTGCG TG, antisense +392 to +363 for the 3'
splice acceptor site of exon 4); APOBEC XVIII
(AGCCGATACCCCCATGTAACTCTGTTT, sense +313 to +339 for the 5' splice
donor site in exon 4); APOBEC III (for the 3' splice acceptor site in
exon 5); APOBEC IV (for the 5' splice donor site in exon 5); APOBEC V
(for the 3' splice acceptor site in exon 6), APOBEC XII
(CACATCCTGTGGGCCACAGGGTTGAAATGA, sense +661 to +690 for sequencing exon
6); and APOBEC XIIa [ATCCGGCCTGTCATTCCTGGGTAGCATGCTA, sense; 3'
position of poly(A) site for sequencing the 3' end of the 6.2-kb
SacI fragment, ie, 3' end of the 15.2-kb genomic fragment].
The 5' flanking region of exon 1, the 5' splice donor site of exon 1,
and the 5' flanking region of exon 2 were isolated by PCR "walking"
using the commercially available PromoterFinder DNA walking kit
(Clontech) with Clontech's Advantage polymerase mix exactly as
recommended. The following gene-specific primers were used: for
amplification of the 5' flanking region of exon 1, DAex13 for the
primary PCR (TTCTTCCTGATCTAATTTAAGGGAGGAGC, antisense exon 1, -158 to
-187 from ATG) and DAex15 for the nested PCR (GCCTTTCTGCCTTCAAAATCC
AACTCTCAT, antisense exon 1, -188 to -217 from ATG); for
amplification of the 5' splice donor site of exon 1 and intron 1,
DAex1S51 for the primary PCR (CCTACTCCCGCTAC AGAACCACTG TGCCC, sense in
exon 1, -246 to -218 from ATG) and DAex1S2
(ATGAGAGTTGGATTTTGAAGGCAGAAAGGC, sense in exon 1, -217 to -188 from
ATG); for amplification of the 5' flanking region of exon 2, DA113 for
primary PCR and DA115 for nested PCR; and for walking within intron 1
toward exon 1, DA43 (AGTGTATTAATGA GACTAAGAACTCACAA) for primary PCR
and DA45 (CAGGGAACCCTAAATCCTCTG TAACACTCT) for nested PCR. The primary
PCR was performed in a Perkin-Elmer DNA thermal cycler 480 using the
following 2-step cycle parameters: 7 cycles (94°C for 25
seconds, 72°C for 4 minutes) and 32 cycles (94°C for 25 seconds,
67°C for 4 minutes), followed by an additional 4 minutes at 67°C.
For nested PCR the following 2-step cycle parameters were
used: 5 cycles (94°C for 25 seconds, 72°C for 4 minutes) and 22
cycles (94°C for 25 seconds, 67°C for 4 minutes), followed by an
additional 4 minutes at 67°C. The amplified genomic fragments were
isolated from 0.8% agarose gels and cloned into the pGEM-T vector. A
portion (2.5 kb) of the 5' flanking region of exon 1, the exon-intron
junction of exon 1, and 2.0 kb of the 5' flanking region of exon 2 were
sequenced by using the ABI PRISM dye terminator cycle sequencing ready
reaction kit (Perkin-Elmer). For sequencing of the 5' flanking region
of exon 1, the following primers were used: DAex17
(GCCAAGTTACCCCACTAATTAGGATTTAGGG) and DAex16 (CCCAGGAGCA
GTGCCGCATCCACTTTCTTC). For sequencing of the 5' flanking region of exon
2, the following primers were synthesized: DA117
(CTCCCTCAAGGTCTAAGTCTCCCACTAG GG) and DA23 (ACTCACTATA
GGGCTCGAGCGGC).
Primer Extension Analysis of Transcriptional Start Sites in
APOBEC-1 mRNA From Rat Liver and Intestine
Five micrograms of total RNA from rat liver and intestine or
tRNA was denatured for 10 minutes at 70°C, annealed to radiolabeled
oligonucleotide DAex15 or DA115 for 30 minutes at
42°C, and extended with 10 U avian myeloblastosis reverse
transcriptase for 60 minutes. After addition of 4 U RNase A, the primer
extension products were separated on an 8%
polyacrylamide7 mol/L urea sequencing gel. The DNA sequence
of exon 1 and exon 2 was determined by using Sequenase (Amersham) and
radiolabeled oligonucleotides DAex15 and DA115. The
sequencing reactions were separated on the same sequencing gel along
with the primer extension products to map the transcriptional start
sites.
RNase Protection Assay of Transcriptional Start Sites and Splice
Variants of APOBEC-1 mRNA in Rat Organs
A rat genomic DNA fragment consisting of 158
nucleotides spanning 68 bp of the upstream promoter region
and 90 bp of transcribed sequences of exon 1 was amplified by PCR with
the oligonucleotides MS5 (GCGAGCTCGCCTGACAGCAA
ACCCCAGCCA, -68 to -39 from the transcriptional start site in exon 1)
and DAex15. A rat genomic fragment of 248 nucleotides
spanning 94 bp of the promoter region of exon 2 and 154 bp of the
transcribed sequences of exon 2 was amplified by PCR with the
oligonucleotides MS16 (GCGAGCTCTCTCCAGGGAGGACG GAAATC,
-166 to -148 from the transcriptional start site in exon 2) and
DA115. The two PCR products were cloned into the pGEM-T Easy vector
(Promega) and sequenced to identify their orientation. Two micrograms
of plasmid DNA linearized with EcoRI was transcribed for 30
minutes at 37°C with 5 U T7 RNA polymerase in the presence of
500 µmol/L each ATP, GTP, and CTP and 12 µmol/L of
[
-32P]UTP (specific activity, 800 Ci/mmol)
to generate an antisense transcript of 228 bases of exon 1 and of 322
bases of exon 2. After digestion of plasmid DNA with 10 U RNase-free
DNase I (Pharmacia) for 15 minutes at 37°C, the RNA transcripts were
purified by phenol-chloroform extraction and S-300 microspin columns
(Pharmacia). Total RNA was purified from 10 rat organs (liver,
intestine, stomach, colon, spleen, lung, kidney, brain, heart, and
skeletal muscle) by using Tri-Reagent and following the manufacturer`s
(Molecular Research Center Inc) protocol exactly. Fifty micrograms of
total RNA from each organ was coprecipitated with
4x104 counts per minute of
-32Plabeled RNA probe and hybridized for 18
hours at 42°C in 20 µL of solution A of the ribonuclease protection
assay II kit (Ambion Inc). After 200 µL of solution B containing
1:50diluted RNase A and RNase T1 was added, the incubation was
continued for 30 minutes at 37°C. After addition of 300 µL of
solution D, the undigested RNA fragments were precipitated for 30
minutes at -20°C and subsequently resolved on a 6% denaturing
polyacrylamide sequencing gel. A DNA molecular-weight marker
(Boehringer Mannheim 100-bp ladder) and
oligonucleotide DD3 with a length of 35
bases,30 which had been labeled by using T4
polynucleotide kinase and
[
-32P]ATP, were analyzed on the same
gel. The semilogarithmic graph of molecular weight versus length of
migration gave a straight line, from which the approximate lengths of
the protected RNA fragments were deduced. For improved precipitation of
smaller protected fragments, 250 µL of 100% ethanol was added to the
precipitation mix, and the precipitation was extended to 1 hour at
-20°C.
Generation of APOBEC-1 PromoterLuciferase Reporter Constructs: 5'
Flanking Region of Exon 1
Two fragments of the 5' flanking region of exon 1 of
2.5 and
2.0 kb that had been isolated by genomic PCR walking and cloned into
the pGEM-T vector were isolated by SalI digestion and cloned
into the XhoI site of pGL3-basic. The resulting promoter
constructs, designated LP1 and LP2, were sequenced to confirm their
orientation. LP1 extended from nucleotide position -2535
from the transcriptional start site to +92 (corresponding to position
-188 from the translational start site ATG) and LP2 from -2089 to
+92. Serial deletions were constructed by PCR by using the universal
downstream oligonucleotide MS1
(CACAAGCTTCCTGACCAGAGAAAGCTGAGG, APOBEC-1 5' UTR antisense; -252 to
-279 from translational start site ATG) and the following upstream
primers: for LP3, MS2 (GAAGTCGACTTCCATTTTGATAGAGGTCAG, position -930
to -901 from the transcriptional start site); for LP4, MS3
(ACCGTCGACTGTTTTTCAGTCA TCTGGACT, position -501 to -472); for LP5,
MS4 (AAGCGGCTGGATGTCGACAACA ACAATAAC, -155 to -126); for LP6, MS5
(GCGAGCTCGCCTGACAGCAAACCC CAGCCA, -68 to -39); and for LP7, MS6
(GCGAGCTCTTAAAGCCGAACCAGCAA, -25 to +1). The resulting promoter
fragments were digested with HindIII and SalI
(LP3 to LP5) or SacI (LP6 and LP7) and cloned into the
respective sites of pGL3-basic. The generated constructs were sequenced
to confirm the orientation and sequence. For the 5' flanking region of
exon 2,
2.0 kb of the 5' flanking region of exon 2, which had been
isolated by genomic PCR walking and cloned into the pGEM-T vector, was
cloned into the XhoI site of pGL3-basic. The resulting
construct, designated IP1, was sequenced to confirm its orientation and
sequence. IP1 extended from nucleotide position -2070 from
the transcriptional start site to +81 (corresponding to position -4 in
the 5' UTR from the translational start site ATG). Serial deletions
were constructed by PCR by using the universal downstream
oligonucleotide MS11 (TGTAAGCTTCCTTCCTCGGGAGCTTATG,
APOBEC-1 5' UTR antisense; -23 to -42 from the translational start
site ATG, corresponding to +44 to +63 from the transcriptional start
site) and the following upstream primers: for IP2, MS12
(TTTGTCGACTGATGATTGGTGTGGGAGTGC, -1173 to -1144 from the
transcriptional start site); for IP3, MS13
(GAAGTCGACCCAACGTTCTGGCAACAGAAG, -587 to -558 from the
transcriptional start site); for IP4, MS14
(CCTGTCGACTTCTTAGATATAGGAGCT, -324 to -298); for IP5, MS15
(GCGAGCTCTGGAATTTAACATCATCGATG, -311 to -293); for IP6, MS16
(GCGAGCTCTCTCC AGGGAGGACGGAAATC, -166 to -148); and for IP7, MS17
(TGGAGCTCAGGAAT GAGTCATCCTGT, -57 to -32). The resulting fragments
were digested with HindIII and SalI (IP2 to IP4)
or SacI (IP5 to IP7) and cloned into pGL3-basic. The
generated constructs were sequenced in their entirety to confirm
orientation and sequence. For IP
mutants, the fragment -2070 to
-1145 and the fragment -2070 to - 558 of the 5' flanking region
of exon 2 were amplified by PCR using a vector-specific SP6 primer
(ATTTAGGTGACACTATAGAATACTCAAG) and the antisense downstream primer MS22
(GCGAGCTCGCACTCCCACACCAATCATCAGTC, -1145 to -1173 from the
transcriptional start site in exon 2) or MS23
(GCGAGCTCTCTTCTGTTGCCAGAACGTTGGG, -557 to -582 from the
transcriptional start site in exon 2). The 2 PCR products were
digested with SacI and fused directly in front of the
promoter region of the construct IP5 by using the unique
SacI site. The proper orientation of insertion was
determined by DNA sequencing. These two constructs were designated
IP
1144216 and IP
556216. For IPxLP mutants, the fragments
-1167 to -266, -581 to -266, and -318 to -266 of the 5' flanking
region of exon 2 were amplified by PCR using the universal antisense
downstream primer MS22 (GCGAGCTCGCACTCCCACACCAATCATCAGTC, -266 to
-289 from the transcriptional start site in exon 2) and either MS12,
MS13, or MS14. The resulting PCR products were cloned into the
pGEM-T easy vector. Fragments of the proper orientation were excised
from the vector with SacI and NheI, gel purified,
and ligated in front of the promoter fragment of LP5 by using the
unique sites SacI and NheI in LP5. The resulting
promoter constructs were designated IP(1167266)-LP5,
IP(581266)-LP5, and IP(318266)-LP5.
Transfection of Promoter Constructs
Human colonic carcinoma Caco-2 cells, kindly provided by Dr C.
Courtelle, London, UK, were grown in Dulbecco's modified Eagle's
medium containing 2 mmol/L glutamine and 20% FCS. Mouse
fibroblast NIH/3T3 cells, kindly provided by Dr M. Spiess, Basel,
Switzerland, and the human hepatoma HuH-7 cells, kindly provided by Dr
J. Chowdhury, New York, NY, were grown in Dulbecco's modified
Eagle's medium containing 2 mmol/L glutamine and 10% FCS. Cells
(5x105) were seeded per well of a 6-well plate.
After 24 hours the cells were cotransfected with 2 µg/mL reporter
plasmid and 0.1 µg/mL CMVß-gal by using the Lipofectin procedure
(GIBCO) essentially as described.30 In brief,
cells were incubated for 6 hours with 1 mL of Optimem-1 (GIBCO)
containing 2 µg reporter plasmid, 0.1 µg CMVß-gal as the
internal-standard plasmid, and 15 µL Lipofectin. Subsequently, cells
were grown in normal medium for 48 hours, washed twice with PBS, and
lysed in 250 µL of reporter lysis buffer (Promega). The cell lysate
was freeze-thawed and centrifuged in a Microfuge. After
addition of 50 µL luciferase assay buffer (Promega), luciferase
activity was determined in 10 µL of soluble cell extract by using a
luminometer (Berthold Microlumat LB 96 P). ß-Gal activity was
measured by luminometry using the Galacto-Light reporter gene assay for
ß-gal (Tropix, BL300G). The luciferase activity of each well was
normalized to ß-gal activity. All assays were performed in
triplicate. At least 3 independent experiments, each in triplicate
assay, were performed for each determination. The mean±SEM was
calculated and expressed as relative luciferase activity, based on the
luciferase activity of cells transfected with the promoterless plasmid
pGL3-basic and the internal-standard plasmid CMVß-gal.
Construction of an APOBEC-1 Minigene
The XbaI-BamHI fragment of
pSVLAPOBEC-130 containing the open reading
frame of APOBEC-1 was cloned into the XbaI-BamHI
site of pT7T3 (Pharmacia). Subsequently, the BamHI fragment
of pSVK3 (Pharmacia), which contains the SV40 small T-antigen splice
site and the SV40 early poly(A) site, was ligated into the
BamHI site. Subsequently, the SalI fragment of
LP1 containing 2.5 kb of the 5' flanking region of exon 1 was ligated
into the SalI site. The orientation of the promoter fragment
was confirmed by DNA sequencing. The resulting plasmid pAPOBEC-1
contains 2.5 kb of the 5' flanking region of exon 1, the complete open
reading frame of APOBEC-1 followed by the SV40 small T-antigen splice
site, and the SV40 early poly(A) site in the plasmid backbone of pT7T3.
pSVLAPOBEC-1 and pAPOBEC-1 were transfected in human hepatoma HuH-7
cells and Hep G2 cells essentially as
described.30 Apo B mRNA was amplified by RT-PCR
and assayed for editing by primer extension analysis
essentially as described.7 30
| Results |
|---|
|
|
|---|
260 and 210 bp were generated from
hepatic APOBEC-1 mRNA by using the antisense
oligonucleotide DA1115 (Figure 1A
120, 100, and 80 bp (Figure 1A
20 nucleotides each at their 5' ends (Figure 1B
|
Characterization of the Rat APOBEC-1 Gene
A
-clone was isolated from an EMBL3 SP6/T7 rat genomic library
that encoded a 15.2-kb genomic fragment of the rat APOBEC-1 gene
(Figure 2A
). Digestion with
SacI generated 4 restriction fragments of 6.2, 4.0, 3.8, and
1.2 kb that were cloned and aligned with the APOBEC-1 cDNA sequence.
The exon-intron junctions were determined by DNA sequencing. The
isolated genomic fragment contained 5 exons and 0.7 kb of the 5'
flanking region of the most 5'-located exon. This exon contained the
translational start site for APOBEC-1 and the common 5' UTR of APOBEC-1
mRNA from both rat liver and intestine. The additional sequences of the
5' UTR of rat hepatic APOBEC-1 mRNA, however, could not be aligned with
this 15.2-kb rat genomic fragment. The 5' flanking region of the 5' UTR
of APOBEC-1 from rat liver and its 5' splice donor site were isolated
by PCR walking. The rat APOBEC-1 gene contains an additional exon in
the 5' position of exon 2, resulting in a total of 6 exons. Figure 2A
illustrates the genomic organization of the rat APOBEC-1 gene, the
isolated
-clone, its 4 SacI fragments, and the 4 PCR
walks that span the 5' end of the rat APOBEC-1 gene. In Figure 2B
, the
exon-intron organization and the exon-intron junctions are summarized.
Exon 1 has a size of 122 nucleotides. Exon 2 contains two
alternative 3' splice acceptor sites spaced by 51
nucleotides and thus encodes either 173 or 122
nucleotides, as was demonstrated by 5' RACE (Figure 1
).
Exon 3 contains 28 nucleotides, while exons 4 and 5 span
398 and 119 nucleotides, respectively. Exon 6 encodes 230
nucleotides up to the poly(A) signal.
|
Approximately 2.5 kb of the 5' flanking region of exon 1 and 3.0 kb of
the 5' flanking region of exon 2 were isolated by PCR walking and
sequenced; the sequences are available from the European Molecular
Biology Organization nucleotide sequence database under the accession
numbers AJ006695 and AJ006696 (Figure 3A
and 3B
). The 5' flanking region of exon 1 contains TAAA as a variant
TATA box at -16 to -13 (from the transcriptional start site) and a
CACT motif as a putative CAT box at -101 to -98 (Figure 3A
). Within
the 5' flanking region of exon 1, a variety of consensus sequences for
potential interactions with trans-acting factors were
identified by computer alignment and are illustrated in Figure 3A
.
Notably, motifs for hepatic transcription factors were identified:
liver activator protein at -964 to -956, HNF3/AP1 at
-706 to -698, and C/EBP at -303 to -299 and -837 to -833. The 5'
flanking region of exon 2 contains two CCACT motifs as variant CAT
boxes at -131 to -126 and -263 to -259. Within the typical distance
of the transcriptional start site (20 to 30 nucleotides), a
classic TATA box, however, is lacking. A putative TATA box, however, is
located upstream at position -307 to -304. A conserved downstream
element of many TATA-less promoters, the MED-1 motif
GCTCCC,35 is located within exon 2 at +49 to +53
from the transcriptional start site. The consensus sequences for
potential trans-acting factors within the 5' flanking region
of exon 2 as well as the MED-1 sequence in exon 2 are illustrated
(Figure 3B
).
|
Primer Extension Analysis of the Transcriptional Start
Sites for APOBEC-1 in Rat Liver and Intestine
Using radiolabeled antisense oligonucleotide
DAex15, which corresponds to the -188 to -217 region of the 5' UTR of
rat hepatic APOBEC-1 encoded by exon 1, we generated a discrete primer
extension product exclusively from total hepatic RNA but not from
total intestinal RNA or tRNA control (Figure 4A
). The DNA sequence analysis of
genomic DNA with radiolabeled DAex15 was separated side by side along
with the primer extension assay on the same sequencing gel (Figure 4A
).
By alignment with the genomic sequence, the putative transcriptional
start site of APOBEC-1 mRNA in rat liver was mapped to
nucleotide position -279 from the translational start
codon ATG (Figure 4A
and 4B
). This putative transcriptional start site
maps 22 nucleotides upstream from the 5' RACE of rat
hepatic APOBEC-1 mRNA that ended at nucleotide position
-257 (Figure 4B
). Using radiolabeled oligonucleotide
DA115, which corresponds to the -4 to -31 region of the 5' UTR of
APOBEC-1 encoded by exon 2, we generated a major primer extension
product from intestinal RNA only and not from hepatic RNA or tRNA
(Figure 4C
). A minor extension product was visible in both
intestinal and hepatic RNA but not in the tRNA control. Alignment of
the major extension product from rat intestinal APOBEC-1 mRNA with
the DNA sequence of exon 2 mapped the putative transcriptional start
site for APOBEC-1 mRNA in rat intestine to nucleotide
position -77 from ATG (Figure 4C
and 4D
). In comparison, the 2 larger
5' RACE products of APOBEC-1 mRNA from rat intestine extended to
nucleotide positions -85 and -64 from ATG, respectively
(Figure 4D
).
|
Ribonuclease Protection Assay for Transcriptional Start Sites of
APOBEC-1 in Various Rat Organs
The transcriptional start sites of APOBEC-1 in exons 1 and 2 and
the splice sites in exon 2 were further characterized by ribonuclease
protection assay. An antisense RNA probe of exon 1 was transcribed
containing a 158-bp genomic fragment that spans approximately the
distal 70 bp of the promoter and 90 bp of the transcribed sequences of
exon 1. This transcript has a length of 232 nucleotides
owing to transcribed vector sequences (Figure 5A
). With the use of this probe, an RNA
fragment of
90 bases was protected in total RNA from the liver,
intestine, colon, spleen, lung, kidney, heart, and skeletal muscle but
not in the stomach or brain (Figure 5A
). The strongest signals were
generated in the spleen, lung, and kidney. In the liver and intestine,
relatively weak protection was observed (Figure 5A
). With the use of
total RNA from the heart, the protected fragment was slightly larger
(Figure 5A
). No fragments of these sizes were protected when an equal
amount of yeast total RNA was used (Figure 5A
). However, 2 large bands
were generated in the same quantities in both yeast total RNA and RNA
from all organs tested. Increased RNase concentration or extended
digestion time did not diminish these 2 large fragments in yeast or rat
RNA. Identical results were obtained in 4 independent ribonuclease
protection assays using various preparations of this antisense RNA
probe encoded by exon 1 of rat APOBEC-1.
|
For exon 2, an antisense RNA probe was synthesized in vitro
containing
94 bp of the distal promoter region of exon 2 and 154 bp
of transcribed sequences of exon 2. Together with the transcribed
multiple cloning site, the transcript has a length of 322
nucleotides. The 248 nucleotides of exon 2
contain both the proximal and distal splice acceptor sites as well as
the various transcriptional start sites within exon 2, as deduced from
5' RACE. With the use of this antisense RNA probe, several fragments
were protected in total RNA from the liver, intestine, spleen, lung,
kidney, and to a lesser degree, the stomach, colon, heart, and skeletal
muscle (Figure 5B
). The RNA fragment of 154 nucleotides
corresponds to the major proximal splice acceptor site of exon 2. The
fragment of
144 nucleotides appears to be due to a minor
proximal splice acceptor site in exon 2. The fragment of 103
nucleotides represents the distal splice acceptor
site in exon 2. These 3 protected fragments that represent
splice variants of APOBEC-1 transcripts initiated in exon 1
are present in the spleen, liver, lung, and to a minor extent, the
colon, kidney, heart, and skeletal muscle; however, they are abundant
in the intestine, where the exon 1specific antisense transcript was
hardly protected (Figure 5A
and 5B
). In the intestine, an additional
RNA fragment of
80 nucleotides was protected (Figure 5B
). Moreover, a very faint band of
250 nucleotides was
specifically protected in the intestine (Figure 5B
). By improved
precipitation of smaller RNA fragments and separation on an 8%
polyacrylamide sequencing gel, 2 additional protected RNA
fragments of 60 and 40 nucleotides, respectively, could be
demonstrated exclusively in the intestine (Figure 5C
). The 3 fragments
of 80, 60, and 40 nucleotides correspond to the 3
intestinal transcriptional start sites as demonstrated by 5' RACE
(Figure 1A
and 1B
). No protected fragment was generated when yeast
total RNA was used (Figure 5B
and 5C
). Identical results, as shown in
Figure 5B
and 5C
, were obtained in 3 other independent ribonuclease
protection assays.
Functional Characterization of the 5' Flanking Regions of Exons 1
and 2
The promoter activities of the 5' flanking regions of exons 1 and
2 were investigated in transfection studies with luciferase as a
heterologous reporter. Serial deletions of the 5' flanking regions of
exons 1 and 2 were constructed by PCR, cloned into the pGL3-basic
vector, and sequenced. The constructs of the 5' flanking region of exon
1 were designated LP1 to LP7. LP1 and LP2 ended at
nucleotide position +92 from the transcriptional start
site, and LP3 to LP7 ended at nucleotide position +24 from
the transcriptional start site. The constructs of the 5' flanking
region of exon 2, designated IP1 to IP7, extended to
nucleotide position +81 (IP1) or +63 (IP2 to IP7) from the
intestinal transcriptional start site and therefore contained the MED-1
motif that is located at position +49 to +53.
The results of transfection studies for these promoter constructs
are illustrated in Figure 6
. LP1 (-2535
to +92) exerted a 2.5-fold stronger promoter activity in HuH-7 cells
and a 3-fold stronger promoter activity in NIH/3T3 cells compared with
Caco-2 cells (Figure 5A
). LP2 (-2089 to +92) and LP3 (-924 to +28)
showed a gradual loss of promoter activity in all 3 cell lines. LP4
(-495 to +28) and LP5 (-140 to +28) demonstrated an increase in
promoter strength in all 3 cell lines. LP5, with slightly more promoter
activity than LP1, still contained the TAAA motif at -16 to -13 as
the presumptive variant TATA box and the CACT motif at -101 to -98 as
the putative CAT box. LP6 (-63 to +28), which lost the putative CAT
box at -101 to -98, had strongly reduced promoter activity. LP7 (-20
to +28), in which the putative TATA box at -16 to -13 was the only
remaining promoter element, lost any promoter activity and was similar
to the promoterless control construct pGL3-basic. The construct LP1, in
which the promoter fragment of LP1 was inserted in the opposite
direction in pGL3-basic, exhibited less relative luciferase activity
than did pGL3-basic (data not shown).
|
In contrast, IP1 extending from position -2070 of the transcriptional
start site of APOBEC-1 mRNA in rat intestine to position +81
(corresponding to position -4 in the 5' UTR from the translational
start codon ATG) exhibited an
4-fold higher promoter activity in
human colonic carcinoma Caco-2 cells than in HuH-7 cells (Figure 6B
).
Truncations of the 5' flanking region of exon 2 in IP2 (-1167 to +63),
IP3 (-581 to +63), and IP4 (-318 to +63) had no major effect on
promoter activity in Caco-2 or HuH-7 cells. In NIH/3T3 cells, all
constructs (IP1 to IP7) had very low promoter activities (<5), close
to the activity of the promoterless construct pGL3-basic. In IP5 (-216
to +63) and IP6 (-161 to +63), a 2-fold increase in promoter activity
was observed in Caco-2 cells and a 5-fold increase in HuH-7 cells
compared with the effect of IP1. The shortest construct IP7 (-52 to
+63) demonstrated a 4-fold reduction of promoter activity in Caco-2
cells and nearly a 6-fold reduction in HuH-7 cells compared with the
effect of IP6. In Caco-2 cells, IP7 still exhibited a comparably high
relative luciferase activity. The construct IP2, in which the promoter
fragment of IP2 was inserted in the opposite direction in pGL3-basic,
exhibited less relative luciferase activity than did the promoterless
construct pGL3-basic (data not shown).
The addition of insulin (10 nmol/L), T3 (50 nmol/L), dexamethasone (100 nmol/L), or glucagon (5 nmol/L) to the cell culture medium of transfected HuH-7 cells did not significantly alter the reporter gene expression of any of the generated promoter constructs (LP1 to LP7 or IP1 to IP7) (data not shown, 3 independent experiments in triplicate assay each).
The regions -1144 to -216 and -556 to -216 were deleted from the 5'
flanking region of exon 2 (IP) by fusing the promoter fragments -2070
to -1145 and -2070 to -557 directly in front of the promoter
construct IP5, thus generating the constructs IP
1144216 and
IP
556216. In addition, the regions -1167 to -266, -581 to
-266, and -318 to -266 of the 5' flanking sequences of exon 2 were
ligated in front of the promoter construct LP5 to generate the
constructs IP(1167266)-LP5, IP(581266)-LP5, and
IP(318266)-LP5.
In a second set of experiments, these 5 additional constructs and the
basic constructs IP1, IP5, and LP5 were transfected in HuH-7, Caco-2,
and NIH/3T3 cells to determine their promoter activities. The mean±SEM
of 4 independent experiments are each shown in Figure 6C
and 6D
. In
comparison with IP1, IP
1144216 showed an increased promoter
activity similar to that of IP5 in both HuH-7 and Caco-2 cells. This
increase was most pronounced in HuH-7 cells, in which IP
1144216
had an
3-fold stronger promoter activity than IP1 (Figure 6C
).
IP
556216 lost promoter strength in both HuH-7 and Caco-2 cells
compared with IP
1144216 and exerted promoter activities similar to
those of IP1. In NIH/3T3 cells, all 4 constructs (IP1, IP5,
IP
1144216, and IP
556216) had low promoter activities, yet in
relative terms IP5 and IP
1144 to 216 were
2-fold stronger than
IP1 or IP
556216. Increased amounts of Caco-2 cells (1 to
2x106) seeded in a 6-well plate and resulting in
a very densely packed confluent monolayer of microscopically
differentiated Caco-2 cells at day 2 after transfection did not result
in higher reporter gene expression of the promoter constructs IP1, IP2,
or IP3 (data not shown). The crossover mutant IP(1167266)-LP5 had
markedly reduced promoter activity in all 3 cell lines compared with
the construct LP5 (Figure 6D
). The mutants IP(581266)-LP5 and
IP(318266)-LP5 demonstrated a gradual increase of promoter activity
in all 3 cell lines compared with IP(1167266)-LP5 (Figure 6D
).
IP(318266)-LP5, however, still had less promoter activities than did
the baseline construct LP5 (Figure 6D
).
Transfection of an APOBEC-1 Minigene Containing the 5' Flanking
Region of Exon 1 in Human Hepatoma HuH-7 Cells
pAPOBEC-1, which contained the promoter fragment LP1 (-2535 to
+28), the cDNA of rat APOBEC-1 from position -31 from ATG to position
-699, the SV40 small T-antigen splice site and the SV40 early poly(A)
site in the plasmid backbone of pT7T3, and the positive control plasmid
pSVLAPOBEC-1, in which APOBEC-1 expression was driven by the SV40
late promoter, were transfected into the human hepatoma cell line
HuH-7. Apo B mRNA from transfected and mock-transfected HuH-7 cells was
amplified by RT-PCR and assayed by primer extension (Figure 7
). Apo B mRNA from HuH-7 cells
transfected with pAPOBEC-1 was edited in contrast to that of
mock-transfected HuH-7 cells, yet the amount of apo B mRNA editing was
considerably lower in comparison with HuH-7 cells transfected with
pSVL APOBEC-1. Similar results were also obtained in human
hepatoma HepG2 cells.
|
| Discussion |
|---|
|
|
|---|
In the rat, APOBEC-1 is expressed not only in the intestine but also in the spleen, liver, kidney, lung, and heart, in contrast to the situation in humans or rabbits.11 14 29 Although most of these organs do not have influence on lipoprotein metabolism, the expression of APOBEC-1 in rat liver with hepatic apo B mRNA editing and the secretion of apo B-48containing VLDL has an important impact on species-specific LDL levels.4 7 Given the importance of LDL for the development of atherosclerosis and coronary artery disease, this topic is of great physiological significance. The current investigation focused on the molecular basis of tissue-specific expression of APOBEC-1 the in rat liver and intestine, the 2 main sources for apo Bcontaining lipoproteins. The results demonstrate that hepatic expression of APOBEC-1 is due to a distinct promoter in the rat APOBEC-1 gene, which was designated LP. The intestine-specific promoter, termed IP, lacks a typical TATA box in the vicinity of the transcriptional start site but contains a hexanucleotide MED-1 motif (GCTCCC) within the 5' UTR downstream from the transcriptional start site.35 This MED-1 sequence is characteristic for a new class of RNA polymerase II promoter without a canonical TATA box.35 Overall, our results are in good agreement with 2 other very recent publications on the genomic organization and expression pattern of the rat APOBEC-1 gene.36 37 As in the mouse,17 the rat APOBEC-1 gene appears to have acquired an additional exon with a distinct promoter region that directs expression of APOBEC-1 in organs other than the intestine. This upstream-located promoter LP leads to tissue-specific exon use and alternate splicing within the 5' UTR of exon 2, without alteration of the open reading frame of APOBEC-1. According to the data presented, this promoter LP is a "classic" promoter with a canonical TATA box and far less tissue specificity than the downstream promoter IP, which appears to be very specific for the intestine. Qian et al37 recently reported 2 allelic variants of the rat APOBEC-1 gene, of which the variant RE5 allele lacks the upstream liver-specific promoter. In RE5 transgenic mice, expression of rat APOBEC-1 was dramatically reduced in the liver, kidney, and brain in comparison with mice transgenic for the RE4 allele containing the upstream liver-specific promoter.37 The presumptive absence of this less-tissue-specific promoter in the human APOBEC-1 gene most probably represents the molecular basis for the restriction of APOBEC-1 expression to the human intestine.29 38
The transcriptional start sites for APOBEC-1 in the rat liver and
intestine were determined by 5' RACE and primer extension
analysis. In the liver, primer extension analysis and
5' RACE pinpointed the transcriptional start site exclusively within
exon 1. Primer extension analysis mapped the transcriptional
start site 22 nucleotides upstream from the longest 5' RACE
product. In the intestine, 5' RACE resulted in 3 distinct
products, all of which mapped to exon 2. The three 5' RACE
products differed each in
20 nucleotides at the 5'
end. Primer extension analysis of rat intestinal RNA yielded a
major and a minor extension product within this region of exon 2.
Ribonuclease protection assays confirmed the transcriptional start
sites and the splice variants of APOBEC-1 in the rat liver and
intestine and proved that the expression of APOBEC-1 in organs such as
the spleen, liver, lung, kidney, and heart was driven exclusively by
the upstream-located promoter LP. With the use of ribonuclease
protection assays, the transcriptional start sites for intestinal
APOBEC-1 mRNA were found to be located within exon 2, without any
evidence for transcription initiation in exon 1. Three transcriptional
start sites were found downstream from the distal splice acceptor site
exactly as identified by 5' RACE. The fragments of 154, 144, and 103
nucleotides, which are protected in intestinal RNA by the
exon 2specific antisense RNA probe, indicate that the splice acceptor
sites of exon 2 are additional sites of transcription initiation in the
intestine. This evidence of multiple start site selection for the
transcription of APOBEC-1 in the rat intestine further
supports the classification of IP as a TATA-less promoter for which
multiple transcription initiation is
characteristic.35
The transfection studies in human hepatoma HuH-7 cells and human
colonic carcinoma Caco-2 cells further demonstrate that the 2 promoters
of the rat APOBEC-1 gene have distinct activities. The liver-specific
promoter LP in the 5' flanking region of exon 1 had much stronger
activities in HuH-7 and NIH/3T3 cells than in Caco-2 cells. Its minimal
promoter elements reside within a region
140 bp from the
transcriptional start site, which contains the putative TATA box and
the putative CAT box. The organization of LP in the rat is very similar
to the upstream-located promoter of the mouse APOBEC-1 gene, which also
contains a variant TATA box 20 nucleotides upstream from
the transcriptional start site and an upstream CAT
box.29 In contrast to LP, IP exhibited a 4-fold
increased promoter activity in Caco-2 cells in comparison with HuH-7 or
NIH/3T3 cells. The constructs IP5 and IP6 had strongly increased
promoter activity in both Caco-2 and HuH-7 cells. Negative regulatory
elements within the region -1100 to -500 of IP were further
demonstrated by using the deletion mutants IP
1144216 and
IP
556216 as well as the crossover mutants IP(1167266)-LP5,
IP(581266)-LP5, and IP(318266)-LP5. This region appears to be a
universal negative regulatory element restricting the expression of IP
to the intestine. The expression of IP in human colonic carcinoma
Caco-2 cells probably underestimates its promoter activity in the small
intestine, for which no better-suited cell line was available for this
study. The addition of insulin, T3, dexamethasone, or
glucagon did not influence reporter gene expression of any of the
generated constructs. Whether these results reflect the absence of
hormonal regulation of the rat APOBEC-1 gene or are merely due to the
tested promoter constructs lacking the appropriate hormonal response
elements remains to be investigated. In accordance with the results
presented, T3 has been shown to stimulate the editing of rat
hepatic apo B mRNA without increasing the expression of
APOBEC-1.23 The modus of hormonal regulation of
hepatic apo B mRNA editing in the rat liver appears to be complex,
involving both APOBEC-1 and other trans-acting
factors.23 Our results are in some contrast to
the recent published study of Hirano et al,36 who
did not observe a major difference in promoter activity of the
intestine-specific promoter IP (REX1) between Caco-2 cells and rat
hepatoma McArdle7777 cells nor increased promotor activities of their
shorter constructs. Although the MED-1 motif was conserved in all
promoter constructs of the current study (IP1 to IP7), the constructs
of Hirano et al36 ended exactly within this
motif. Whether this or other differences explain this discrepancy
remains to be studied.
The liver-specific promoter LP of the rat APOBEC-1 gene is sufficient to induce APOBEC-1 expression in human hepatoma HuH-7 and HepG2 cells. This experiment demonstrates that the lack of a liver-specific promoter within the human APOBEC-1 gene29 38 most probably explains the absence of APOBEC-1 expression in the human liver rather than the hypothetical assumption of specific repressors for APOBEC-1 expression. Further characterization of the liver-specific promoter of the rat APOBEC-1 gene in transgenic animals will help to elucidate how APOBEC-1 can be expressed in the liver without harmful effects. The mystery of APOBEC-1 as an oncogene must reside within the regulatory elements of the APOBEC-1 gene from species such as the rat, mouse, dog, or horse, which naturally express APOBEC-1 in the liver. Solving this mystery might revive the prospects for gene therapy with APOBEC-1, which appeared to be gloomy due to the oncogenic threats of APOBEC-1.33
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received September 17, 1997; accepted January 28, 1998.
| References |
|---|
|
|
|---|
2.
Goldstein JL, Brown MS. A receptor-mediated pathway
for cholesterol homeostasis. Science. 1986;232:3447.
3. Steinberg D, Witztum JL. Lipoproteins and atherosclerosis: current concepts. JAMA. 1990;64:30473052.
4.
Innerarity TL, Boren J, Yamanaka S, Olofson S-O.
Biosynthesis of apolipoprotein B-48 containing lipoproteins.
J Biol Chem. 1996;271:23532356.
5. Powell LM, Wallis SC, Pease RJ, Edwards YH, Knott TJ, Scott J. A novel form of tissue-specific RNA processing produces apo B-48 in the intestine. Cell. 1987;50:831840.[Medline] [Order article via Infotrieve]
6.
Chen SH, Habib G, Yang CY, Gu ZW, Lee BR, Weng SA,
Silbermann SR, Cai SJ, Deslypere JP, Rosseneu M, Gotto AM, Li WH, Chan
L. Apo B-48 is the product from a messenger RNA with an
organ-specific in-frame translational stop codon. Science. 1987;238:363366.
7. Greeve J, Altkemper I, Dieterich JH, Greten H, Windler E. Apolipoprotein B mRNA editing in 12 different mammalian species: hepatic expression is reflected in low concentrations of apo B-containing plasma lipoproteins. J Lipid Res. 1993;34:13671382.[Abstract]
8.
Greeve J, Navaratnam N, Scott J. Characterization
of the apolipoprotein B mRNA editing enzyme: no similarity to the
proposed mechanism of RNA editing in kinetoplastid protozoa.
Nucleic Acids Res. 1991;19:35693576.
9.
Garcia ZC, Poksay KS, Boström K, Johnson DF,
Balestra ME, Shechter I, Innerarity TL. Characterization of
apolipoprotein B mRNA editing from rabbit intestine. Arterioscler
Thromb. 1992;12:172179.
10.
Hodges P, Navaratnam N, Greeve J, Scott J.
Site-specific creation of uridine from cytidine in apolipoprotein B
mRNA. Nucleic Acids Res. 1991;19:11971201.
11.
Teng BB, Burand CF, Davidson NO. Molecular
cloning of an apolipoprotein B messenger RNA editing protein.
Science. 1993;260:18161819.
12.
Navaratnam N, Morrison JR, Battacharya S, Patel D,
Funahashi T, Giannoni F, Teng BB, Davidson NO, Scott J. The p27
catalytic subunit of the apolipoprotein B mRNA editing enzyme is a
cytidine deaminase. J Biol Chem. 1993;268:2070920712.
13.
Driscoll DM, Zhang Q. Expression and characterization
of p27, the catalytic subunit of the apolipoprotein B mRNA editing
enzyme. J Biol Chem. 1994;269:1984319847.
14.
Yamanaka S, Poksay KS, Balestra ME, Zeng GQ, Innerarity
TL. Cloning and mutagenesis of the rabbit apo B mRNA editing protein.
J Biol Chem. 1994;269:2172521734.
15. Navaratnam N, Bhattacharya S, Fufino T, Patel D, Jaumuz AL, Scott J. Evolutionary origins of apo B mRNA editing: catalysis by a cytidine deaminase that has acquired a novel RNA-binding motif at its active site. Cell. 1995;81:187195.[Medline] [Order article via Infotrieve]
16.
Anant S, MacGinnitie AJ, Davidson NO. Apobec-1, the
catalytic subunit of the mammalian apolipoprotein B mRNA editing
enzyme, is a novel RNA-binding protein. J Biol Chem. 1995;270:1476214767.
17.
Nakamuta M, Oka K, Krushkal J, Kobayashi K,
Yamamoto M, Li WH, Chan L. Alternative mRNA splicing and differential
promoter utilization determine tissue-specific expression of the
apolipoprotein B mRNA editing protein (APOBEC-1) gene in mice.
J Biol Chem. 1995;270:1304213056.
18.
Davidson NO, Powell LM, Wallis SC, Scott J. Thyroid
hormone modulates the introduction of a stop codon in rat liver
apolipoprotein B messenger RNA. J Biol Chem. 1988;263:1348213485.
19.
Baum CL, Teng BB, Davidson NO. Apolipoprotein B
messenger RNA editing in rat liver: modulation by fasting and refeeding
a high carbohydrate diet. J Biol Chem. 1990;265:1926319270.
20.
Seishima M, Bisgaier CL, Davies SL, Glickman RM.
Regulation of hepatic apolipoprotein synthesis in the
17
-ethinyl estradiol-treated rat. J Lipid Res. 1991;30:941951.
21.
Sjöberg A, Oscarsson J, Boström K,
Innerarity TL, Eden S, Olofsson SO. Effects of growth hormone on
apolipoprotein-B (apo B) messenger ribonucleic acid editing, and apo
B48 and apo B100 synthesis and secretion in the rat liver.
Endocrinology. 1992;130:33563363.
22.
Patterson AP, Tennyson GE, Hoeg JM, Sviridov DD, Brewer
HB. Ontogenetic regulation of apolipoprotein B mRNA editing during rat
and human development. Arterioscler Thromb. 1992;12:468473.
23. Funahashi T, Giannoni F, DePaoli AM, Skarosi SF, Davidson NO. Tissue-specific, developmental and nutritional regulation of the gene encoding the catalytic subunit of the rat apolipoprotein B mRNA editing enzyme: functional role in the modulation of apo B mRNA editing. J Lipid Res. 1995;36:414428.[Abstract]
24. Lau PP, Cahill DJ, Zhu HJ, Chan L. Ethanol modulates apolipoprotein B mRNA editing in the rat. J Lipid Res. 1995;36:20692078.[Abstract]
25.
Thorngate FE, Raghow R, Wilcox HG, Werner CS, Heimberg
M, Elam MB. Insulin promotes the biosynthesis and secretion of
apolipoprotein B-48 by altering the apolipoprotein B mRNA editing.
Proc Natl Acad Sci U S A. 1994;91:53925396.
26.
Schock D, Kuo SR, Steinburg MF, Bolognino M, Sparks JD,
Sparks CE, Smith HC. An auxiliary factor containing a 240 kDa protein
complex is involved in apolipoprotein B RNA editing. Proc Natl
Acad Sci U S A. 1996;93:10971102.
27.
Mehta A, Banerjee S, Driscoll DM. Abobec-1 interacts
with a 65 kDa complementing protein to edit apolipoprotein B mRNA in
vitro. J Biol Chem. 1996;271:2829428299.
28.
Lau PP, Zhu HJ, Nakamuta M, Chan L. Cloning of an
APOBEC-1 binding protein that also interacts with apolipoprotein B mRNA
and evidence for its involvement in RNA editing. J Biol
Chem. 1997;272:14521455.
29.
Lau PP, Zhu HJ, Baldini A, Charnsangavej C, Chan L.
Dimeric structure of a human apolipoprotein B mRNA editing protein and
cloning and chromosomal localization of its gene. Proc Natl Acad
Sci U S A. 1994;91:85228526.
30. Greeve J, Jona VK, Chowdhury NR, Horwitz MS, Chowdhury JR. Hepatic gene transfer of the catalytic subunit of the apolipoprotein B mRNA editing enzyme results in a reduction of plasma LDL levels in normal and Watanabe heritable hyperlipidemic rabbits. J Lipid Res. 1996;37:20012017.[Abstract]
31. Kozarsky KF, Bonen DK, Giannoni F, Funahashi T, Wilson JM, Davidson NO. Hepatic expression of the catalytic subunit of the apolipoprotein B mRNA editing enzyme (abobec-1) ameliorates hypercholesterolemia in LDL-receptor deficient rabbits. Hum Gene Ther. 1996;7:943957.[Medline] [Order article via Infotrieve]
32. Hughes SD, Rouy D, Navaratnam N, Scott J, Rubin EM. Gene transfer of cytidine deaminase APOBEC-1 lowers lipoprotein(a) in transgenic mice and induces apolipoprotein B mRNA editing in rabbits. Hum Gene Ther. 1996;7:3949.[Medline] [Order article via Infotrieve]
33. Greeve J, Chowdhury JR, Chowdhury NR. Induction of hepatic apolipoprotein B mRNA editing for reducing serum cholesterol levels: a breakthrough or a disaster? Hepatology. 1996;24:964966.[Medline] [Order article via Infotrieve]
34.
Yamanaka S, Balestra ME, Ferrell LD, Fan J, Arnold KS,
Taylor S, Taylor JM, Innerarity TL. Apolipoprotein B mRNA editing
protein induces hepatocellular carcinoma and dysplasia in transgenic
animals. Proc Natl Acad Sci U S A. 1995;92:84838487.
35.
Ince TA, Scotto KW. A conserved downstream element
defines a new class of RNA polymerase II promoters. J Biol
Chem. 1995;270:3024930252.
36. Hirano KI, Min J, Funahashi T, Davidson NO. Cloning and characterization of the rat APOBEC-1 gene: a comparative analysis of gene structure and promoter usage in rat and mouse. J Lipid Res. 1997;38:11031118.[Abstract]
37.
Qian X, Balestra ME, Innerarity TL. Two distinct
TATA-less promoters direct tissue-specific expression of the rat apo B
editing catalytic polypeptide 1 gene. J Biol Chem. 1997;272:1806018070.
38. Hirano KI, Min J, Funahashi T, Baunoch DA, Davidson NO. Characterization of the human APOBEC-1 gene: expression in gastrointestinal tissues determined by alternative splicing with production of a novel truncated peptide. J Lipid Res. 1997;38:847859.[Abstract]
This article has been cited by other articles:
![]() |
J. Greeve, A. Philipsen, K. Krause, W. Klapper, K. Heidorn, B. E. Castle, J. Janda, K. B. Marcu, and R. Parwaresch Expression of activation-induced cytidine deaminase in human B-cell non-Hodgkin lymphomas Blood, May 1, 2003; 101(9): 3574 - 3580. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lellek, R. Kirsten, I. Diehl, F. Apostel, F. Buck, and J. Greeve Purification and Molecular Cloning of a Novel Essential Component of the Apolipoprotein B mRNA Editing Enzyme-Complex J. Biol. Chem., June 23, 2000; 275(26): 19848 - 19856. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |