Original Contributions |
From the King Gustaf V Research Institute, Karolinska Hospital (F.C., A.N., J.N., J.R.), and the Department of Cell and Molecular Biology, Karolinska Institute (J.T.), Stockholm, Sweden; the Department of Medical Laboratory Sciences and Technology, Division of Clinical Chemistry, Huddinge University Hospital, Huddinge, Sweden (U.D.); the Atherosclerosis Research Center, Division of Cardiology, Department of Medicine, Cedars-Sinai Medical Center and UCLA School of Medicine, Los Angeles (P.D., P.K.S., B.C.); and the Department of Medicine, University of California, San Diego (J.L.W., W.P.), Calif.
Correspondence to Federico Calara, King Gustaf V Research Institute, Karolinska Hospital, S-171 76 Stockholm, Sweden. E-mail rcalara{at}instmed.ks.se
| Abstract |
|---|
|
|
|---|
4 mg/kg body weight ). Within 6
hours, an accumulation of apolipoprotein B and epitopes present on
oxLDL are detected in the arterial
endothelium and media. The presence of oxLDL is
associated with activation of the transcription factor nuclear
factor-
B in the endothelium as well as
endothelial expression of intercellular adhesion
molecule-1. Injection of LDL enriched with the antioxidant probucol
resulted in arterial accumulation of apolipoprotein B, but
the expression of oxLDL-specific epitopes was reduced at 24 hours.
Thus, this simple model has the potential to analyze the
mechanisms behind and biological effects of LDL oxidation in vivo.
Key Words: atherosclerosis oxLDL nuclear factor-
B intercellular adhesion molecule-1
| Introduction |
|---|
|
|
|---|
In the present study, we developed an animal model in which a single injection of unmodified, heterologous LDL resulted in an accumulation of LDL in the arterial wall, where it became oxidatively modified within 6 hours.
| Methods |
|---|
|
|
|---|
B (
-p65 mAb) from Boehringer Mannheim;
anti-rat monocyte and macrophage antibody (clone ED-1) obtained
from Serotec; anti-rat ICAM-1 supplied by R&D Systems; and
anti
-actin (HHF-35) from DAKO. Mouse monoclonal antibody NA59,
specific for epitopes generated during oxidative modification of LDL,
was supplied by Dr Joseph Witztum (University of California at San
Diego, La Jolla, Calif).20 Biotinylated horse
anti-mouse secondary antibody was supplied by Vector.
Oligonucleotides for EMSAs were obtained from Promega.
[
-32P]dATP and 125I
were from Amersham. The Limulus amebocyte lysate assay was
performed by Microbiology Reference Laboratory (Cincinnati, Ohio). Male
Sprague-Dawley rats were obtained from B&K Universal AB (Sollentuna,
Sweden). Probucol was kindly provided by Dr Ann-Margret Lindquist,
Astra-Hässle (Mölndal, Sweden). Lipopolysaccharide
(LPS) was from Sigma, and PD-10 columns were from Pharmacia. ICAM-1
primers were synthesized by Pharmacia.
Preparation and Oxidation of LDL
Blood samples for LDL preparation were taken from healthy
volunteers and hyperlipidemic male survivors of
myocardial infarction under the age of 45 years after 12 hours of
fasting, during which time smokers were asked to refrain from smoking.
All subjects were free from symptoms of infectious disease at the time
of blood sampling. Venous blood was drawn into precooled Vacutainer
tubes containing disodium EDTA (1.4 mg/mL) and placed on ice. Plasma
was then recovered by low-speed centrifugation
(1400g, 20 minutes, 1°C) and kept at this temperature
throughout the preparation procedures. LDL was prepared by cumulative
rate ultracentrifugation in a density
gradient21 as described in detail
earlier.9 LDL was concentrated by pooling LDL
prepared from at least four donors, adjusting the density to 1.065 g/L
by adding NaBr containing 10 µmol/L EDTA, and ultracentrifuging
the samples (200 000g, 20 hours, 1°C). The LDL was frozen
in 10% sucrose (vol/vol) at -80°C. Cryopreserving the samples in
sucrose did not affect the biological properties of LDL, as described
previously.22 Within 1 hour before the injection
of native LDL into the animals, excess salt and sucrose were removed
from the LDL by running the samples over a PD-10 column preequilibrated
in PBS. The LDL was sterilized by passing it through a 0.45-µm filter
and was kept on ice until injected. The protein content was determined
by the method of Lowry et al.23 LDL (1 mg/mL) was
oxidized by exposure to 5 µmol/L CuSO4 for
18 hours at 37°C. Compared with native LDL, the
CuSO4-oxidized LDL showed increased
electrophoretic mobility on agarose gels,24
increased amounts of lipid peroxides (
800 nmol/mg LDL
protein),2 and higher concentrations of
thiobarbituric acidreactive substances (
40 nmol/mg LDL
protein).25 Endotoxin levels in both native and
oxLDL were <2 ng/mg LDL protein, as determined by the
Limulus amebocyte lysate assay.
Probucol Enrichment of LDL
Plasma prepared as described above was incubated for 2 hours at
37°C with probucol (0.05 mmol/L) dissolved in ethanol. The LDL
was then isolated and concentrated, and the protein concentration was
determined by using the methods described above. Roughly 45% of the
added probucol is incorporated into the LDL fraction when this protocol
is used with plasma with a total cholesterol level of 6.5
to 7.0 mmol/L.
Radiolabeling of LDL
LDL was iodinated with 125I by
the ICl method of McFarlane.26 Unbound iodine was
removed by passing the labeled LDL through a PD-10 column equilibrated
with PBS containing 0.27 mmol/L EDTA and 20 µmol/L BHT to
protect against oxidation27 and filtered through
a 0.45-µm filter. Specific activity was 400 to 600 counts per minute
per nanogram LDL protein, and 96% was protein bound as determined by
trichloroacetic acid (TCA) precipitation.
Animal Protocol
Male Sprague-Dawley rats (300 to 400 g) were injected
intraperitoneally or intravenously in
the tail vein with PBS, LPS, or human native or oxLDL while under ether
anesthesia. The rats were euthanized at different times up
to 48 hours under anesthesia (75 mg/kg ketamine and
3 mg/kg xylazine HCl [Rompun]) by intracoronary injection of
KCl. Heparin (1000 IU/kg) was injected into the heart followed by
perfusion with 0.9% saline containing 0.02 µmol/L BHT for 5
minutes. Rats were perfusion fixed for 5 minutes with either 4%
formaldehyde for those rats to be analyzed by
immunohistochemistry or 3% glutaraldehyde for those
rats to be analyzed by electron microscopy. After perfusion,
the aorta, iliac and femoral arteries, and the liver were removed.
Tissue to be used for immunohistochemistry was placed in 4%
formaldehyde for 3 hours, transferred to a 15% sucrose solution, and
kept at 4°C overnight before being embedded in paraffin. The
abdominal aorta and iliofemoral arteries were cut into three equal
pieces and mounted together in one block. For EMSAs the aortas,
iliofemoral arteries, and livers were removed rapidly without previous
perfusion and kept for 5 minutes in ice-cold 0.9% NaCl containing
0.02 µmol/L BHT. The arteries were then stripped of adventitia
and immediately frozen in LN2. The samples were
kept at -80°C until assayed.
In rats injected with 125I-LDL (4 mg/kg IP and IV), the tip of the tail was cut and 0.5 mL of blood was collected at different times up to 24 hours and then allowed to clot at room temperature for 30 minutes. Serum was collected after centrifugation for 20 minutes at 2714 rpm at 4°C and counted in a Packard Cobra Auto-Gamma counting system.
Analysis of LDL After Intraperitoneal Injection
LDL was recovered from the peritoneal cavity 2, 6, and 12 hours
after intraperitoneal injection by injecting 2 mL
of ice-cold PBS containing 20 µmol/L BHT while the rat was under
anesthesia (30 mg ketamine and 3 mg/kg Rompun).
They were then euthanized by an intracoronary injection of KCl,
and the PBS was aspirated from the peritoneal cavity. Analysis
of LDL modification was performed by agarose gel electrophoresis. The
relative mobility was expressed as a ratio between the distance
migrated of the reisolated LDL divided by the distance migrated of
noninjected LDL.
Preparation of Nuclear Extracts
Nuclear extracts were prepared according to Dignam et
al,28 and the tissue from two rats was used for
nuclear extraction at each data point. Tissues were cut into small
pieces in ice-cold saline and homogenized in a Dounce
homogenizer in 1 mL hypotonic lysis buffer. After a
10-minute incubation on ice, samples were centrifuged at
9000g for 2 minutes. Pellets were rinsed with 0.02 mol/L KCl
buffer and centrifuged at 9000g for another minute.
Pellets were resuspended in 115.5 µL of 0.02 mol/L KCl buffer and 460
µL of 0.6 mol/L KCl buffer. Nuclear proteins were extracted by gentle
agitation for 30 minutes at 4°C. After centrifugation
for 15 minutes at 9000g, the supernatant containing the
nuclear protein was divided into aliquots and kept frozen at -70°C.
Protein concentration was determined by the Coomassie Plus Assay from
Pierce Chemical Co.
EMSA
Six micrograms of nuclear extract was incubated with 0.05
µg of poly(dI-dC) in binding buffer (10 mmol/L Tris-HCl, pH 7.5,
50 mmol/L NaCl, 4% glycerol, 1 mmol/L
MgCl2, 0.5 mmol/L EDTA, and 0.5 mmol/L
DTT) on ice for 10 minutes The double-stranded NF-
B
oligonucleotide (5' AGTTGAGGGGACTTTCCCAGGC
3') was labeled with [
-32P]dATP, purified
over a Pharamacia NICK column, added (50 000 cpm per tube) with or
without a 100x excess of unlabeled oligonucleotide,
and incubated for 20 minutes at room temperature. The samples were then
run on a 4% polyacrylamide gel in Tris-buffered EDTA buffer
for 2 hours at 200 V at 4°C. The gels were dried under vacuum and
heat and then exposed to Kodak film.
Preparation of RNA
RNA extracts were prepared and purified by using the protocol
and reagents from the total RNA isolation system (Promega SDS). Aortas
and iliac arteries from one rat were frozen in
LN2 and homogenized in 6 mL of
denaturing solution containing citrate/sarcosine/ß-mercaptoethanol
and guanidine thiocyanate in a Dounce homogenizer. RNA
extraction was performed by adding 0.6 mL of 2 mol/L sodium acetate, pH
4.0, and the sample was mixed. Six milliliters of phenol/chloroform
alcohol mixture was added, and the sample was mixed thoroughly and
chilled on ice for 15 minutes. The sample was then centrifuged
at 10 000g for 20 minutes at 4°C. The top aqueous phase
was removed, an equal volume of isopropanol was added, and the sample
was incubated at -20°C for 30 minutes to precipitate the RNA. The
RNA pellet was recovered by centrifugation at
10 000g for 15 minutes at 4°C and resuspended in 5 mL of
denaturing solution. The RNA was reprecipitated in isopropanol and the
pellet recovered. The RNA pellet was washed in ice-cold ethanol and the
pellet recovered by centrifugation. The pellet was then
resuspended in 1 mL of RNAse-free water. After purification, the sample
was treated with DNAse by adding 0.1 U/µL DNAse, 2 U/µL RNAse
inhibitor, 100 µL of transcription buffer, and 10
mmol/L DTT to 30 µg of RNA sample and incubated at 37°C for 30
minutes. The reaction was stopped by adding 4 mmol/L of EDTA.
RT-PCR
For the cDNA synthesis, 2 µg of RNA was added to 100 µL
reagent mixture (10 mmol/L DTT, 0.5 mmol/L 4 dNTP, 1 U/µL
RNAse I, and 10 U/µL M-MLV reverse transcriptase) and
reverse-transcribed at 42°C for 50 minutes by the random-priming
method using Pd(N)6 hexamers. cDNA synthesis was
performed using a Perkin-Elmer DNA thermal cycler model 9600
(Perkin-Elmer Sundbyberg) at an initial temperature of 30°C for 10
minutes, 42°C for 50 minutes, and 94°C for 2 minutes. The ICAM-1
oligonucleotide primers were designed from the cDNA
sequence of rat ICAM-1.29 Primer 1
(5'-GTTGGTACTGATCATTGCCC-3') was complementary to cDNA sequences 1530
to 1550, and primer 2 (5'-TCAGAGGAAGCATGGTGTTC-3') was complementary
to sequences 1972 to 1992. ß-Actin primers were from the rat
ß-actin control amplimer set from Clonetech Intermedica. PCR
amplification was performed by adding 2 µL of cDNA with 50 µL of
reagent mixture (0.2 mmol/L of 4 dNTP, 2 U Taq
polymerase, and 0.4 µmol/L of each primer) and amplified by a
35-step cycle program after denaturation at 90°C for 30 minutes. Each
cycle included 94°C for 45 seconds, 60°C for 45 seconds, and 72°C
for 2 minutes. A 15-µL aliquot of each reaction was electrophoresed
on a 2% agarose gel, and the bands were analyzed by ethidium
bromide staining. Semiquantification of the ICAM-1 bands was performed
by measuring the OD of the ICAM-1 and ß-actin bands with a Fuji Bas
1500 BioImaging Analyzer. The results were expressed as a ratio
of the OD of ICAM-1 to the OD of ß-actin.
Immunohistochemistry
Tissue sections were deparaffinized with xylene and dehydrated
with graded ethanol. The membranes were permeabilized
in 0.2% Triton X-100. Endogenous peroxidase activity was
quenched by incubating the sections in 0.3%
H2O2 and 80% methanol for
30 minutes at room temperature. After they were washed, the sections
were blocked with 10% horse serum in PBS for 30 minutes. Primary
antibodies were diluted in PBS (as indicated in the figure legends) and
incubated with the sections for 18 hours at 4°C in a humidified
chamber. The sections were washed, incubated with biotinylated
secondary antibody at a dilution of 1:200 for 30 minutes, and then
washed again. The sections were incubated for 30 minutes with a
peroxidase-labeled avidin-biotin complex and washed again. The sections
were developed with diaminobenzidine (Vector) and counterstained in
hematoxylin. Negative controls included substitution of the primary
antibody with either PBS or an irrelevant antibody.
Immunohistochemically stained sections (n
3) were analyzed by
a modified version of the technique described by Galis et
al.30 Consistent positive staining
covering >50% of the intima was recorded as 3, consistent
positive staining covering <50% of the intima as 2, variable or
weak staining as 1, and no staining as 0. The interobserver variability
of the scoring was <20%.
Electron Microscopy
Tissue for electron microscopy was postfixed in 1%
cacodylatebuffered OsO4 containing 0.7%
K4Fe(CN)6, dehydrated in
graded ethanol, stained with 2% uranyl acetate in ethanol, and
embedded in Spurr low-viscosity epoxy resin. Thin sections were cut
with a diamond knife on an LKB Ultrotome IV, picked up on
carbon-stabilized Formvar films, stained with alkaline lead citrate,
and finally examined in a JEOL EM 100CX.
Statistical Methods
Values are given as mean±SD. Between-group analyses
were made with an unpaired t test. A value of
P<0.05 was considered significant.
Ethical Considerations
This study was approved by the Institutional Animal Care and Use
Committee at the Karolinska Institute.
| Results |
|---|
|
|
|---|
|
With the use of antibodies against human apoB and epitopes present
on oxLDL (NA59), LDL and oxLDL could be detected in the
arterial endothelium and media 6 hours
after intraperitoneal injection of native LDL
(Figure 2
). Semiquantitative evaluation
of the staining showed that the accumulation of LDL peaked at 12 hours,
whereas oxLDL peaked at 24 hours (Figure 3
). The immunostaining
for apoB and oxLDL was cell associated and within the extracellular
matrix. Intravenous injection of LDL resulted in an earlier
and stronger immunostaining of apoB and oxLDL than with
intraperitoneal injection.
|
|
Intraperitoneal injection of LDL enriched with the
antioxidant probucol also resulted in an accumulation of apoB, but at
24 hours a clear reduction of epitopes present on oxLDL was seen
(Figure 4
). The semiquantitative scoring
of staining for oxLDL was 3.0±0.0 after injection of LDL without
enrichment of probucol compared with 1.0±0.0 after probucol enrichment
(n=3). After intraperitoneal injection of equal
amounts of oxLDL, neither apoB nor oxLDL could be detected in the media
or endothelium at any time up to 48 hours. The general
pattern of apoB and oxLDL immunostaining was the same
in the aorta and the iliac and femoral arteries, although the staining
tended to be more intense in the smaller arteries.
|
Electron Microscopic Observations After Injection of Native
LDL
At 24 hours, the endothelial cell layer of the
femoral arteries from rats injected
intraperitoneally and intravenously
with native LDL was intact and did not clearly differ in morphology
from the PBS-injected controls. Both the luminal and abluminal surfaces
were rich in caveolae, and neighboring cells were connected by
junctional complexes. The smooth muscle cells of the media were normal
in appearance, with numerous plasma membrane caveolae and a cytoplasm
dominated by myofilaments and mitochondria. Immediately inside the
internal elastic lamina and in direct association with the first layer
of medial smooth muscle cells, focal collections of electron-dense
material were observed in the LDL-injected rats (Figure 5A
). These localized aggregates showed a
spatial relationship to both the caveolae and the coated pits on the
surface of the smooth muscle cells (Figure 5A
and 5B
). At higher
magnification, aggregates were found to be composed of lipid bilayers
arranged in parallel and forming membrane-like whorls (Figure 5B
and 5C
). Similar material was also seen in the deeper parts of the media,
but in decreasing amounts. On the other hand, no structures of this
type were detected outside the internal elastic membrane, ie, in the
subendothelial space. In the PBS-injected control
vessels, deposits of the type described above were only very
occasionally noted, and if so, typically in deeper parts of the media
together with small vesicular fragments derived from damaged or dying
cells.
|
Activation of NF-
B
Intraperitoneal injection of LPS (100
µg/kg) resulted in a strong increase of active NF-
B, compared with
baseline, in both the arteries and liver within 24 hours as
analyzed by EMSA (Figure 6
).
Injection of oxLDL (4 mg/kg) was found to strongly activate
NF-
B in the liver, whereas no activation was seen in the arteries
(Figure 6
). After injection of equal amounts of native LDL (4 mg/kg),
no activation of NF-
B was seen in the liver, whereas an activation
was seen in the arteries (Figure 6
). With the use of an antibody to
detect the active form of NF-
B (
-p65 mAb), positive nuclear
staining was seen in the arterial
endothelium at 12 and 24 hours after injection of
native LDL, whereas weaker staining was seen in the media localized to
both the nucleus and cytoplasm (Figure 7
).
|
|
Expression of Adhesion Molecules and Monocyte
Adhesion
Positive staining for the adhesion molecule ICAM-1 was restricted
to the arterial endothelium beginning at 24
hours after injection of native LDL and persisting up to 48 hours
(Figure 8
). Positive staining for ICAM-1
was not noticed after injection of PBS or oxLDL at any time. A 463-bp
band was observed after RT-PCR analysis for ICAM-1 in RNA
extracted from rats at 24 hours after injection of PBS, native LDL, or
native LDL+probucol (Figure 9
). The mRNA
levels, however, were lowered in the PBS- and native
LDL+probucolinjected rats when compared with native LDLinjected
rats (Figure 9
). Semiquantitative analysis of the ICAM-1 RT-PCR
bands showed a more than fivefold increase of the ICAM-1/ß-actin OD
ratio in the native LDLinjected rats when compared with PBS- or
native LDL+probucolinjected rats. (P=0.005) (Figure 10
). Monocytes could not be detected in
the arterial wall with the ED-1 antibody, and no
accumulation of leukocytes could be noted either on the luminal vessel
surface or in the subendothelial space at 24 hours
after injection of native LDL.
|
|
|
| Discussion |
|---|
|
|
|---|
Previous work has shown accumulation of lipoproteins in the arterial wall to be a crucial step in atherogenesis.31 Areas prone to develop atherosclerotic lesions have enhanced retention of lipoproteins.32 33 Retention and aggregation of LDL-sized particles can be seen in the subintimal extracellular matrix 2 hours after bolus infusion of heterologous LDL in rabbits,35 and transendothelial transport of LDL has been described in rats after LDL injection.35 The entrapment of LDL is believed to be mediated by an interaction of apoB-100 segments with proteoglycans,18 and these complexes form aggregates that are susceptible to oxidation in vitro.36 Colocalization of epitopes on apoB and oxLDL has been described in human atherosclerotic lesions,37 but at least some antibodies against oxLDL also detect oxidation-specific epitopes on proteins other than LDL.38
Our results support and extend the previous work. The colocalization of
apoB and oxLDL in the endothelium and media and the
fact that probucol enrichment of LDL before injection reduced LDL
oxidation without affecting apoB accumulation strongly suggest that LDL
oxidation occurs locally in the arterial wall after
retention. Considering the slight increase in relative electrophoretic
mobility of LDL reisolated from the peritoneal cavity at 6 and 12 hours
after intraperitoneal injection, a minor
modification occurring in the peritoneal cavity cannot be excluded.
Still, this is not a requirement for the accumulation and oxidation of
LDL in the arterial wall, since LDL injected
intravenously was also found to accumulate in the
arterial wall and evoke similar effects. Furthermore, LDL
injected intraperitoneally did not activate
NF-
B in the liver and did not show an increase in electrophoretic
mobility when reisolated from plasma up to 12 hours after injection.
The relatively rapid modification of LDL and the biological effects
seen in our model may be due to the fact that rats lack extracellular
SOD.39 It cannot be excluded, however, that part
of the staining for oxLDL is due to cross-reactivity with
oxidation-specific epitopes on proteins other than LDL. The electron
microscopic observation of an extracellular, focal collection of lipid
bilayers forming membrane-like whorls inside the internal elastic
membrane 24 hours after injection of LDL suggests that LDL may be taken
up locally in large amounts in the arterial wall via the
endothelium and then processed in the media to generate
free lipid molecules that aggregate into membrane-like complexes.
Extracellular, multilamellar liposome-like structures have been
described in human and rabbit atherosclerotic
lesions.40 In animal models, these structures
form early in lesion development and do not require the presence of
foam cells. It is not known whether these structures represent
modified aggregates of lipoproteins trapped in the extracellular
matrix42 or excreted lipid products from
arterial wall cells.42 The close
proximity of these aggregates to caveolae is of interest, in view of
recent observations on cultured fibroblasts indicating that caveolae
represent sites where cholesterol derived from LDL
is accumulated and released from the cell.43
The absence of an accumulation of oxLDL and of an inflammatory response
in the arterial wall after injection of oxLDL is not
surprising. Previous work has shown that injection of oxLDL in the rat
results in rapid clearance through scavenger receptors in the liver,
with a t1/2 of a few
minutes.44 Furthermore, plasma is rich in
antioxidants.45 Native LDL, on the other hand,
disappears from serum at a low rate.44 The
present finding of a strong activation of NF-
B in the liver
after injection of oxLDL could be explained by its rapid uptake by the
liver. Activation of NF-
B in the liver has also been reported after
injection of mildly modified LDL.46 In our model,
injection of native LDL did not activate NF-
B in the liver,
and activation in the endothelium could not be detected
until epitopes present on oxLDL were seen at the same location,
suggesting that NF-
B is activated as a result of LDL
oxidation.
Activation of NF-
B in endothelial cells by modified
LDL has been well studied in vitro. Endothelial cells
under flow stress and incubated with oxLDL had an increase in
superoxide production, NF-
B activation, and adhesion
molecule expression.47 LDL minimally modified by
lipoxygenase increased NF-
B activation in
endothelial cells through a mechanism involving cAMP
and protein kinase A.48 In addition, NF-
B has
been shown to be associated with the increased expression of
macrophage colony stimulating factor in vascular
endothelial cells after exposure to
oxLDL.49 50 In contrast, studies on oxLDL-induced
NF-
B activation in vascular smooth muscle cells differ in their
results. Ares and coworkers51 showed that
Cu2+-oxidized LDL inhibited NF-
B activation
and induced activator protein-1 in human smooth muscle
cells in vitro, whereas Maziere and coworkers52
showed activation of NF-
B. NF-
B has also been shown to be
activated and ICAM-1 expressed in the neointimal
and medial smooth muscle cells of rat femoral arteries after balloon
injury.53
The adhesion molecule ICAM-1 mediates leukocyte adhesion to the
endothelium.54 Structural and
deletion analyses show that putative NF-
B binding sites in
the promoter of the ICAM-1 gene are required for their induction by
cytokines.55 56 From in vitro cell
culture studies, ICAM-1 can be expressed in endothelial
cells after stimulation from cytokines such as tumor necrosis
factor.57 ICAM-1 could also be activated
by lysophosphatidylcholine in cultured human and rabbit
arterial endothelial
cells.58 Minimally modified LDL, however, has
been shown to increase P-selectin expression, but not ICAM-1 and
vascular cell adhesion molecule (VCAM)-1, in
vitro.59 In our model, NF-
B activation in the
endothelium after injection of native LDL and its
subsequent oxidation were associated with expression of ICAM-1 and an
increase in mRNA levels, which could be reduced when LDL was enriched
with probucol before injection.
Important knowledge of the biological in vivo effects of oxLDL has been
gained from animal work. Systemic administration of oxLDL in hamsters
results in leukocyte adhesion in the microcirculation and aortic
endothelium and is believed to be mediated by reactive
oxygen intermediates and platelet-activating factor (PAF) or
PAF-like substances.60 61 The water-soluble
antioxidant vitamin C, but not the lipid-soluble antioxidants vitamin E
and probucol, prevents leukocyte adherence,63
indicating that this model involves the action of water-soluble
reactive oxygen intermediates and may not be ideal to study the
biological effects of LDL oxidation in the vessel wall. Furthermore,
the presence of oxLDL in the circulation is unlikely to occur in
vivo.44 The systemic injection of minimally
modified LDL, but not of native LDL, into mice has been shown to
activate NF-
B in the liver and stimulate the expression of
inflammatory genes such as macrophage colony stimulating factor
in the circulation and JE (the mice homologue of monocyte chemotactic
protein-1) in the liver.63 Mice that readily
develop fatty streaks on an atherogenic diet (eg, C57BL/6) were found
to accumulate conjugated dienes in the liver, associated with NF-
B
activation and expression of the inflammatory genes macrophage
colony stimulating factor, JE, heme oxygenase, and members
of the serum amyloid family.46 In
hypercholesterolemic rabbits, oxLDL has been shown to
accumulate in arteries,8 and
hypercholesterolemia is associated with
expression of VCAM-1 in endothelial cells overlaying
fatty streaks.64 ICAM-1 and VCAM-1 have also been
demonstrated in human atherosclerotic
lesions.65 66
Our results support the hypothesis that LDL oxidation occurs locally in
the arterial wall after retention of apoB, resulting in a
mainly endothelial activation of NF-
B and
endothelial expression of ICAM-1. It is highly unlikely
that the findings could be explained by an immune response to human
LDL, considering the short time span. Thus, this relatively simple
model offers the opportunity to study mechanisms behind LDL oxidation
in the vessel wall and to analyze early biological effects of
LDL oxidation in vivo. Furthermore, this model could also be used to
rapidly evaluate the effects of therapeutic intervention on the early
events in atherogenesis.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received June 10, 1997; accepted December 5, 1997.
| References |
|---|
|
|
|---|
2. El-Saadani M, Esterbauer H, El-Sayed M, Goher M, Nassar AY, Jurgens G. A spectrophotometric assay for lipid peroxides in serum lipoproteins using a commercially available agent. J Lipid Res. 1989;30:627630.[Abstract]
3. Esterbauer H, Gebicki J, Puhl H, Jürgens G. The role of lipid peroxidation and antioxidants in oxidative modification of LDL. Free Radic Biol Med. 1992;13:341390.[Medline] [Order article via Infotrieve]
4. Kugiyama K, Kerns SA, Morrisett JD, Roberts R, Henry PD. Impairment of endothelium-dependent arterial relaxation by lysolecithin in modified low-density lipoprotein. Nature. 1990;344:160162.[Medline] [Order article via Infotrieve]
5. Watson A, Navab M, Hama S, Sevanian A, Prescott S, Stafforini D, McIntyre T, Du B, Fogelman A, Berliner J. Effect of platelet activating factor-acetylhydrolase on the formation and activation of minimally oxidized low density lipoprotein. J Clin Invest. 1995;95:774782.
6.
Steinbrecher U, Witztum J, Parthasarathy S, Steinberg
D. Decrease in reactive amino groups during oxidation or
endothelial cell modification of LDL: correlation with
changes in receptor-mediated catabolism.
Arteriosclerosis. 1987;7:135143.
7.
Sparrow CP, Parthasarathy S, Steinberg D. A
macrophage receptor that recognizes oxidized low density
lipoprotein but not acetylated low density lipoprotein.
J Biol Chem. 1989;264:25992604.
8. Ylä-Herttuala S, Palinski W, Rosenfeld ME, Parthasarathy S, Carew TE, Butler S, Witztum JL. Evidence for presence of oxidatively modified low density lipoprotein in atherosclerotic lesions of rabbit and man. J Clin Invest. 1989;84:10861095.
9. Regnström J, Nilsson J, Tornvall P, Landou C, Hamsten A. Susceptibility to low density lipoprotein oxidation and coronary atherosclerosis in man. Lancet. 1992;339:11831186.[Medline] [Order article via Infotrieve]
10.
Carew TE, Schwenke DC, Steinberg D. Antiatherogenic
effects of probucol unrelated to its
hypocholesterolemic effect: evidence that antioxidants
in vivo can selectively inhibit low density lipoprotein degradation in
macrophage-rich fatty streaks and slow the progression of
atherosclerosis in the Watanabe heritable
hyperlipidemic (WHHL) rabbit. Proc Natl Acad Sci
U S A. 1987;84:77257729.
11. Frostegård J, Haegerstrand A, Gidlund M, Nilsson J. Biologically modified low density lipoprotein increases the adhesive properties of endothelial cells. Atherosclerosis. 1991;90:119126.[Medline] [Order article via Infotrieve]
12.
Frostegård J, Nilsson J, Haegerstrand A, Hamsten A,
Wigzell H, Gidlund M. Oxidized low density lipoprotein induces
differentiation and adhesion of human monocytes and the monocytic cell
line U 937. Proc Natl Acad Sci U S A. 1990;87:904908.
13.
Henriksen T, Mahoney EM, Steinberg D. Enhanced
macrophage degradation of biologically modified low density
lipoprotein. Arteriosclerosis. 1983;3:149159.
14.
Steinbrecher UP, Parthasarathy S, Leake DS, Witztum JL,
Steinberg D. Modification of low density lipoprotein by
endothelial cells involves lipid peroxidation and
degradation of low density lipoprotein phospholipids. Proc Natl
Acad Sci U S A. 1984;81:38833887.
15. Berliner JA, Territo MC, Sevanian A, Ramin S, Kim JA, Bamshad B, Esterson M, Fogelman AM. Minimally modified low density lipoprotein stimulates monocyte endothelial interactions. J Clin Invest. 1990;85:12601266.
16. Sparrow C, Parthasarathy S, Steinberg D. Enzymatic modification of low density lipoprotein by purified lipoxygenase plus phospholipase A2 mimics cell mediated modification. J Lipid Res. 1988;29:745753.[Abstract]
17. Negre-Salvayre A, Alomar Y, Troly M, Salvayre R. Ultraviolet-treated lipoproteins as a model system for the study of the biological effects of lipid peroxides on cultured cells, III: the protective effects of antioxidants (probucol, catechin, vitamin E) against the cytotoxicity of oxidized LDL occurs in two different ways. Biochim Biophys Acta. 1991;1096:291300.[Medline] [Order article via Infotrieve]
18.
Camejo G, Olofsson S-O, Lopez F, Carlsson P,
Bondjers G. Identification of apo B-100 segments mediating the
interaction of low density lipoproteins with arterial
proteoglycans. Arteriosclerosis. 1988;8:368377.
19.
Ylä-Herttuala S, Rosenfeld M, Parthasarathy S,
Glass C, Sigal E, Steinberg D. Colocalization of
15-lipoxygenase mRNA and protein with epitopes of
oxidized low density lipoprotein in macrophage rich areas of
atherosclerotic lesions. Proc Natl Acad Sci U S A. 1990;87:69596963.
20.
Palinski W, Yla-Herttuala S, Rosenfeld M, Butler S,
Socher S, Parthasarathy S, Curtiss L, Witztum J. Antisera and
monoclonal antibodies specific for epitopes generated during oxidative
modification of low density lipoprotein.
Arteriosclerosis. 1990;10:325335.
21. Redgrave TG, Roberts DCK, West CE. Separation of plasma lipoproteins by density gradient ultracentrifugation. Anal Biochem. 1975;65:4249.[Medline] [Order article via Infotrieve]
22. Rumsey SC, Galeano NF, Arad Y, Deckelbaum RJ. Cryopreservation with sucrose maintains normal physical and biological properties of human plasma low density lipoproteins. J Lipid Res. 1992;33:15511561.[Abstract]
23.
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein
measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265275.
24. Noble RP. Electrophoretic separation of plasma lipoproteins in agarose gel. J Lipid Res. 1968;9:693700.[Abstract]
25. Yagi K. Short communications: a simple fluorometric assay for lipoperoxide in blood plasma. Biochem Med.. 1976;15:212216.[Medline] [Order article via Infotrieve]
26. McFarlane AS. Labelling of plasma proteins with radioactive iodine. Biochem J. 1956;62:135143.[Medline] [Order article via Infotrieve]
27. Khouw A, Parthasarathy S, Witztum JL. Radioiodination of low density lipoprotein initiates lipid peroxidation: protection by use of antioxidants. J Lipid Res. 1993;34:14831496.[Abstract]
28.
Dignam J, Lebovitz R, Roeder R. Accurate transcription
initiation by RNA polymerase II in a soluble extract from isolated
mammalian nuclei. Nucleic Acids Res. 1983;11:14751489.
29. Kita Y, Takashi T, Iigo Y, Tamatani T, Miyasaka M, Horiuchi T. Sequence and expression of rat ICAM-1. Biochim Biophys Acta. 1992;1131:108110.[Medline] [Order article via Infotrieve]
30. Galis Z, Sukhova G, Lark M, Libby P. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J Clin Invest. 1994;94:24932503.
31.
Hoff H, Heideman C, Gotto A, Gaubatz J.
Apolipoprotein B retention in the grossly normal and atherosclerotic
human aorta. Circ Res. 1977;41:684690.
32.
Schwenke DC, Carew TE. Initiation of atherosclerotic
lesions in cholesterol-fed rabbits, I: focal increases in
arterial LDL concentration precede development of fatty
streak lesions. Arteriosclerosis. 1989;9:895907.
33.
Schwenke DC, Carew TE. Initiation of atherosclerotic
lesions in cholesterol-fed rabbits, II: selective retention
of LDL vs. selective increases in LDL permeability in susceptible sites
of arteries. Arteriosclerosis. 1989;9:908918.
34.
Nievelstein P, Fogelman A, Mottino G, Frank J. Lipid
accumulation in rabbit aortic intima 2 hours after bolus infusion of
low density lipoprotein. Arterioscler Thromb. 1991;11:17951805.
35.
Lin S, Jan K, Weinbaum S, Chien S.
Transendothelial transport of low density lipoprotein
in association with cell mitosis in rat aorta.
Arteriosclerosis. 1989;9:230236.
36.
Hurt-Camejo E, Camejo G, Rosengren B, Lopez F,
Ahlström C, Fager G, Bondjers G. Effect of arterial
proteoglycans and glycosaminoglycans on low density
lipoprotein oxidation and its uptake by human macrophages and
arterial smooth muscle cells. Arterioscler
Thromb. 1992;12:569583.
37.
Jürgens G, Chen Q, Esterbauer H, Mair S,
Ledinski G, Dinges H. Immunostaining of human autopsy
aortas with antibodies to modified apolipoprotein B and apoprotein(a).
Arterioscler Thromb. 1993;13:16891699.
38.
O'Brien K, Alpers C, Hokanson J, Wang S, Chait A.
Oxidation-specific epitopes in human coronary
atherosclerosis are not limited to oxidized low-density
lipoprotein. Circulation. 1996;94:12161225.
39. Karlsson K, Marklund S. Extracellular superoxide dismutase in the vascular system of mammals. J Biochem. 1988;255:223228.
40. Chao F-F, Blanchette-Mackie J, Dickens BF, Gamble W, Kruth HS. Development of unesterified cholesterol-rich lipid particles in atherosclerotic lesions of WHHL and cholesterol-fed NZW rabbits. J Lipid Res. 1994;35:7183.[Abstract]
41.
Yin Y, Lim K-H, Weinbaum S, Chien S, Rumschitzki DS. A
model for the initiation and growth of extracellular lipid liposomes in
arterial intima. Am J Physiol. 1997;272:H1033H1046.
42.
Chung B, Tallis G, Yalamoori V, Anantharamaiah GM,
Segrest JP. Liposome-like particles isolated from human atherosclerotic
plaques are structurally and compositionally similar to surface
remnants of triglyceride-rich lipoproteins.
Arterioscler Thromb. 1994;14:622635.
43. Fielding P, Fielding C. Plasma membrane caveolae mediate the efflux of cellular free cholesterol. Biochemistry. 1995;34:1428814292.[Medline] [Order article via Infotrieve]
44.
Van Berkel T, De Rijke Y, Kruijt J. Different fate in
vivo of oxidatively modified low density lipoprotein and
acetylated low density lipoprotein in rats. J Biol
Chem. 1991;266:22822289.
45.
Frei B, Stocker R, Ames BN. Antioxidant defenses and
lipid peroxidation in human blood plasma. Proc Natl Acad Sci
U S A. 1988;85:97489752.
46. Liao F, Andalibi A, deBeer F, Fogelman A, Lusis A. Genetic control of inflammatory gene induction and NF-kB-like transcription factor activation in response to an atherogenic diet in mice. J Clin Invest. 1993;91:25722579.
47.
Tsao PS, Buitrago R, Chan JR, Cooke JP. Fluid flow
inhibits endothelial adhesiveness: nitric oxide and
transcriptional regulation of VCAM-1. Circulation. 1996;94:16821689.
48. Parhami F, Fang Z, Fogelman A, Andalibi A, Territo M, Berliner J. Minimally modified low density lipoprotein-induced inflammatory responses in endothelial cells are mediated by cyclic adenosine monophosphate. J Clin Invest. 1993;92:471478.
49.
Peng HB, Rajavashisth TB, Libby P, Liao JK. Nitric
oxide inhibits macrophage-colony stimulating factor gene
transcription in vascular endothelial cells.
J Biol Chem. 1995;270:1705017055.
50.
Rajavashisth T, Yamada H, Mishra N. Transcriptional
activation of the macrophage-colony stimulating factor gene by
minimally modified LDL. Arterioscler Thromb Vasc Biol. 1995;15:15911598.
51.
Ares M, Kallin B, Eriksson P, Nilsson J. Oxidized LDL
induces transcription factor activator protein-1 but
inhibits activation of nuclear factor-
B in human vascular
smooth muscle cells. Arterioscler Thromb Vasc Biol. 1995;15:15841590.
52.
Maziere C, Auclair M, Djavaheri-Mergny M, Packer L,
Maziere J-C. Oxidized low density lipoprotein induces activation of the
transcription factor NF-
B in fibroblasts,
endothelial and smooth muscle cells. Biochem Mol
Biol Int. 1996;39:12011207.[Medline]
[Order article via Infotrieve]
53.
Cercek B, Yamashita M, Dimayuga P, Zhu J, Fishbein MC,
Kaul S, Shah PK, Nilsson J, Regnstrom J. Nuclear factor-
B
activity and arterial response to balloon injury.
Atherosclerosis.. 1997;131:5966.[Medline]
[Order article via Infotrieve]
54. van de Stolpe A, van der Saag PT. Intercellular adhesion molecule-1. J Mol Med. 1996;74:1333.[Medline] [Order article via Infotrieve]
55.
Neish A, Williams A, Palmer H, Whitley M, Collins T.
Functional analysis of the human vascular cell adhesion
molecule-1 promotor. J Exp Med. 1992;176:15831593.
56.
Vorarberger G, Schäfer R, Stratowa C. Cloning of
the human gene for intercellular adhesion molecule 1 and
analysis of its 5' regulatory region. J
Immunol. 1991;147:27772786.
57.
Dustin ML, Springer TA. Lymphocyte function-associated
antigen-1 (LFA-1) interaction with intercellular adhesion molecule-1
(ICAM-1) is one of at least three mechanisms for lymphocyte adhesion to
the cultured endothelial cells. J Cell Biol.. 1988;107:321331.
58. Kume N, Cybulsky MI, Gimbrone MA Jr. Lysophosphatidylcholine, a component of atherogenic lipoproteins, induces mononuclear leukocyte adhesion molecules in cultured human and rabbit arterial endothelial cells. J Clin Invest. 1992;90:11381144.
59.
Berliner J, Navab M, Fogelman A, Frank J, Demer L,
Edwards P, Watson A, Lusis A. Atherosclerosis: basic
mechanisms. Circulation. 1995;91:24882496.
60.
Lehr H, Becker M, Marklund S, Hübner C,
Arfors K, Kohlschütter A, Messmer K. Superoxide-dependent
stimulation of leukocyte adhesion by oxidatively modified LDL in vivo.
Arterioscler Thromb. 1992;12:824829.
61.
Lehr H, Seemüller J, Hübner C, Menger
M, Messmer K. Oxidized LDL-induced
leukocyte/endothelium interaction in vivo involves the
receptor for platelet-activating factor. Arterioscler
Thromb. 1993;13:10131018.
62.
Lehr H, Frei B, Olofsson A, Carew T, Arfors K.
Protection from oxidized LDL-induced leukocyte adhesion to
microvascular and macrovascular endothelium in vivo by
vitamin C but not by vitamin E. Circulation. 1995;91:15251532.
63. Liao F, Berliner J, Mehrabian M, Navab M, Demer L, Lusis A, Fogelman A. Minimally modified low density lipoprotein is biologically active in vivo in mice. J Clin Invest. 1991;87:22532257.
64.
Cybulsky M, Gimbrone M. Endothelial
expression of a mononuclear adhesion molecule during atherogenesis.
Science. 1991;251:788791.
65. O'Brien K, Allen M, McDonald T, Chait A, Harlan J, Fishbein D, McCarty J, Ferguson M, Hudkins K, Benjamin C, Lobb R, Alpers C. Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques. J Clin Invest. 1993;92:945951.
66. Poston R, Haskard D, Coucher J, Gall N, Johnson-Tidey R. Expression of intercellular adhesion molecule-1 in atherosclerotic plaques. Am J Pathol. 1992;140:665673.[Abstract]
This article has been cited by other articles:
![]() |
C. A. Gleissner, N. Leitinger, and K. Ley Effects of Native and Modified Low-Density Lipoproteins on Monocyte Recruitment in Atherosclerosis Hypertension, August 1, 2007; 50(2): 276 - 283. [Full Text] [PDF] |
||||
![]() |
J. Nilsson, G. K. Hansson, and P. K. Shah Immunomodulation of Atherosclerosis: Implications for Vaccine Development Arterioscler. Thromb. Vasc. Biol., January 1, 2005; 25(1): 18 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schiopu, J. Bengtsson, I. Soderberg, S. Janciauskiene, S. Lindgren, M. P.S. Ares, P. K. Shah, R. Carlsson, J. Nilsson, and G. N. Fredrikson Recombinant Human Antibodies Against Aldehyde-Modified Apolipoprotein B-100 Peptide Sequences Inhibit Atherosclerosis Circulation, October 5, 2004; 110(14): 2047 - 2052. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Monaco and E. Paleolog Nuclear factor {kappa}B: a potential therapeutic target in atherosclerosis and thrombosis Cardiovasc Res, March 1, 2004; 61(4): 671 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Violi, F. Micheletta, and L. Iuliano Antioxidants and atherosclerosis Eur. Heart J. Suppl., March 1, 2002; 4(suppl_B): B17 - B21. [Abstract] [PDF] |
||||
![]() |
S. Tsimikas and J. L. Witztum Measuring Circulating Oxidized Low-Density Lipoprotein to Evaluate Coronary Risk Circulation, April 17, 2001; 103(15): 1930 - 1932. [Full Text] [PDF] |
||||
![]() |
A. Niemann-Jonsson, P. Dimayuga, S. Jovinge, F. Calara, M. P. S. Ares, G. N. Fredrikson, and J. Nilsson Accumulation of LDL in Rat Arteries Is Associated With Activation of Tumor Necrosis Factor-{alpha} Expression Arterioscler. Thromb. Vasc. Biol., October 1, 2000; 20(10): 2205 - 2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hajra, A. I. Evans, M. Chen, S. J. Hyduk, T. Collins, and M. I. Cybulsky The NF-kappa B signal transduction pathway in aortic endothelial cells is primed for activation in regions predisposed to atherosclerotic lesion formation PNAS, August 1, 2000; 97(16): 9052 - 9057. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Iuliano, A. Mauriello, E. Sbarigia, L. G. Spagnoli, and F. Violi Radiolabeled Native Low-Density Lipoprotein Injected Into Patients With Carotid Stenosis Accumulates in Macrophages of Atherosclerotic Plaque : Effect of Vitamin E Supplementation Circulation, March 21, 2000; 101(11): 1249 - 1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Parthasarathy, N. Santanam, S. Ramachandran, and O. Meilhac Oxidants and antioxidants in atherogenesis: an appraisal J. Lipid Res., December 1, 1999; 40(12): 2143 - 2157. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Dichtl, A. Stiko, P. Eriksson, I. Goncalves, F. Calara, C. Banfi, M. P. S. Ares, A. Hamsten, and J. Nilsson Oxidized LDL and Lysophosphatidylcholine Stimulate Plasminogen Activator Inhibitor-1 Expression in Vascular Smooth Muscle Cells Arterioscler. Thromb. Vasc. Biol., December 1, 1999; 19(12): 3025 - 3032. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Dichtl, L. Nilsson, I. Goncalves, M. P. S. Ares, C. Banfi, F. Calara, A. Hamsten, P. Eriksson, and J. Nilsson Very Low-Density Lipoprotein Activates Nuclear Factor-{kappa}B in Endothelial Cells Circ. Res., May 14, 1999; 84(9): 1085 - 1094. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |