Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:756-761

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karpe, F.
Right arrow Articles by Hamsten, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karpe, F.
Right arrow Articles by Hamsten, A.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:756-761.)
© 1998 American Heart Association, Inc.


Original Contributions

A Common Functional Polymorphism in the Promoter Region of the Microsomal Triglyceride Transfer Protein Gene Influences Plasma LDL Levels

Fredrik Karpe; Björn Lundahl; Ewa Ehrenborg; Per Eriksson; ; Anders Hamsten

From the Atherosclerosis Research Unit, King Gustaf V Research Institute, Karolinska Hospital, Stockholm, Sweden.

Correspondence to Fredrik Karpe, Atherosclerosis Research Unit, King Gustaf V Research Institute, Karolinska Hospital, S-171 76, Stockholm, Sweden. E-mail karpe{at}instmed.ks.se


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Microsomal triglyceride transfer protein (MTP) is required for the assembly and cellular secretion of apolipoprotein B (apoB) –containing lipoproteins from the liver and intestine. The secretion pattern of apoB-containing lipoproteins is likely to influence the VLDL and LDL levels in plasma. By initial opportunistic screening for polymorphic sites in the regulatory region of the MTP gene by gene sequencing in 20 healthy male subjects, a common functional G/T polymorphism was detected 493 bp upstream from the transcriptional start point. There was differential binding of unique nuclear proteins at this site, as shown by electrophoretic mobility shift assay. The G variant seemed to bind two or three nuclear proteins that do not bind to the T variant. Expression studies with minimal promoter constructs linked to the chloramphenicol acetyltransferase reporter and transfected into HepG2 cells revealed marked enhancement of transcriptional activity with the T variant. The prevalence of the MTP promoter genotypes was investigated in a group of 184 healthy, middle-aged white men; the frequency of homozygosity for the MTP -493 T variant was .06 and the allele frequency of MTP -493T was .25 in the population. These homozygous subjects had a 22% lower LDL cholesterol concentration than did heterozygotes or subjects homozygous for the MTP -493 G variant (2.9±0.6 versus 3.7±0.8 mmol/L, P<.05). Analysis of apoB and triglyceride contents in VLDL subfractions revealed a markedly changed balance within the VLDL population. Subjects homozygous for the MTP -493 T variant had fewer but more lipid-rich VLDL particles, thereby arguing for an effect of MTP expression on the hepatic secretion of triglyceride-rich, apoB-containing lipoproteins. This common genetic variation of the MTP promoter is likely to have important implications for cardiovascular disease.


Key Words: gene regulation • cardiovascular disease • apolipoprotein B • lipoprotein assembly • triglycerides


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The MTP is a heterodimer of the larger and unique 97-kDa subunit and the multifunctional 55-kDa protein disulfide isomerase.1 Functional MTP is an absolute requirement for the assembly and cellular secretion of apoB-containing lipoproteins. Cells that normally do not secrete apoB can acquire this competence if the genes encoding apoB and MTP are provided by gene transfection, as shown in HeLa cells and COS-1 cells.2 3 Conversely, if MTP activity is inhibited in cells that normally do secrete apoB-containing lipoproteins, the secretion of apoB is drastically reduced.4 5 A complete lack of MTP activity leads to abetalipoproteinemia,6 a disease caused by mutations in the coding region of the MTP gene.7 8 9

The promoter region of the MTP gene is highly conserved between species and shows signs of both cell type–specific expression and response to metabolic regulators. The activity of the human MTP promoter is suppressed by insulin and enhanced by cholesterol.10 The insulin response has been confirmed in HepG2 cells.11 It has also been shown that hamsters fed either a high-fat or a cholesterol-enriched diet have higher concentrations of MTP mRNA.

Against this background we hypothesized that genetic variation in MTP expression might influence the plasma concentrations of apoB-containing lipoproteins in humans. We report herein a common functional polymorphism in the promoter region of the MTP gene, of which the rarer allele is linked to low plasma LDL cholesterol concentrations.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Human Subjects
A total of 184 healthy white men, aged 30 to 45 years, were recruited at random from a register containing all permanent residents of the Stockholm metropolitan area (response rate of 70%). Men with documented coronary heart disease or any other chronic disease were excluded. The mean age of the study group was 40.3±3.4 years, and the body mass index was 24.5±2.8 kg/m2. Fifteen subjects from the group of 184 with selected MTP promoter genotypes were asked to return for a detailed compositional analysis of fasting plasma VLDL. The procedures described in this study have been approved by the Karolinska Hospital Ethics Committee.

Blood Sampling, DNA Procedures, and Lipoprotein Analyses
Blood sampling, preparation of plasma, and quantification of major fasting plasma lipoproteins were performed as described previously.12 For DNA procedures, nucleated cells from frozen whole blood were prepared according to Sambrook et al,13 and DNA was extracted by a salting-out method.14 All subjects were also genotyped for the apoE polymorphism.15 VLDL subfractions were isolated from fasting plasma, and the content of apoB-100 was quantified by analytical SDS–polyacrylamide gel electrophoresis as described.16

Gene Sequencing
DNA for direct sequencing of the MTP promoter was amplified in a two-step nested PCR reaction. Approximately 100 ng of genomic DNA was used for each individual PCR reaction. Primers were designed from the published promoter sequence (-743 bp in the 5' direction).7 First, a round of PCR was performed by using the primer 5'-CCCTCTTAATCTCTTTCCTAGAA (MTP-1) together with 5'-AAGAATCATATTGACCAGCAATC (MTP-2). Second, 1 µL of this PCR reaction mixture was used for a second PCR that utilized one unlabeled and one biotin-labeled primer at concentrations of 0.1 µmol/L each. These primers were MTP-1 and 5'-CCAGCTAGGAGTCACTGAGA (biotinylated). All amplifications were performed for 30 cycles at 96°C for 1 minute, 60°C for 30 seconds, and 72°C for 90 seconds in a buffer containing 1.0 mmol/L MgCl2, 0.2 mmol/L dNTP, 10 mmol/L Tris-HCl, pH 8.4 at 70°C, 0.1% Tween 20, and 0.2 U Taq polymerase. The biotinylated PCR fragments were immobilized by binding to streptavidin-coated magnetic beads (Dynabeads, Dynal), and the nonbiotinylated strands were removed by incubation in 50 µL of 0.15 mol/L NaOH for 5 minutes at room temperature. The bound DNA was rinsed three times and resuspended in 13 µL distilled water. Gene sequencing was performed with the chain-termination method using fluorescence-labeled primers distributed within the 750-bp promoter region. These were 5'-TAGAAATG AGATTCAGAAAGGAC (MTP-3fl), 5'-CAATCATCTATGTTTC ATCAA (MTP-7fl), and 5'-AAGTTTCCTCATTGGGTGA (MTP-8fl). The products were analyzed by using a Pharmacia ALF DNA sequencer. All primers were synthesized on a Gene Assembler Plus (Pharmacia). Labeling of primers with biotin or fluorescein was performed by incorporating BioDite or FluorePrime Fluorescein Amidite (Pharmacia), respectively, during synthesis. Fluorescence-labeled primers were purified by reverse-phase chromatography on a PepRPC column (Pharmacia FPLC). Normally, the sequences could be read, with a considerable overlap, thus confirming the sequence.

Genotyping
Primers MTP-1 and MTP-2 were used for genotyping of the -400 A/T polymorphism. First, a single-step PCR reaction was optimized further by increasing the MgCl2 concentration to 2.0 µmol/L and by changing the procedure to 35 cycles at 94°C for 30 seconds, 55°C for 60 seconds, and 72°C for 3 minutes. The PCR product was then incubated with the restriction enzyme Ssp1 (4 U). The -400 T allele gave rise to a cutting site. The restriction fragment length polymorphism was inspected after agarose gel (1.5%) electrophoresis of the incubate. The -400 A allele gave rise to the full-length fragment (838 bp), whereas the -400 T allele gave rise to two shorter fragments (494 and 344 bp, respectively).

The -493 G/T polymorphism does not give rise to a cutting site with any common restriction enzyme. However, a mutation in the 5' primer used for PCR of a gene product including the -493 site gave rise to an Hph1 cutting site for the -493 G allele. The PCR (5'-GGA TTTAAATTTAAACTGTTAATTCATATCAC and 5'-AGTTTCACACA TAAGGACAATCATCTA) gave rise to a 109-bp fragment, and the gene product was cleaved by Hph1. For this second round of PCR, the MgCl2 concentration was increased to 5 mmol/L and the number of cycles was changed to 35 at 94°C for 30 seconds, 57°C for 60 seconds, and 72°C for 2 minutes. The PCR product was incubated with Hph1 and the restriction fragment length polymorphism was studied after high-resolution 3% agarose gel electrophoresis (Metaphor-agarose). The -493 T allele gave rise to a full-length fragment (109 bp), whereas the -493 G allele gave rise to two fragments of 89 and 20 bp. HepG2 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% newborn calf serum.

DNA Constructs
For the EMSA, four sets of complementary oligonucleotides were designed: -400, 5'-GTCCAT ACAAGAAAAATTAAAATTTGGTTAG and 5'-GTCCATACAAG AAATATTAAAATTTGGTTAG; and -493, 5'-TTGAAGTGATTGGTGGT GGTATGAATTAACAG and 5'-TTGAAGTGATTGGTTGTGGTATGAATTAACAG. One set of double-stranded oligonucleotides containing the same sequences as above but flanked by BamHI and BglII ends was constructed for the CAT assay. Two double-stranded oligonucleotides were ligated head to tail into a BamHI-restricted HIV-chloramphemicol acetyl-transferase (HCAT) vector.17 The correct sequence and orientation of the inserts were tested by DNA sequencing.

EMSA
Nuclear extracts were prepared according to Alksnis et al.18 All buffers were freshly supplemented with leupeptin (0.7 µg/mL), aprotinin (16.6 µg/mL), PMSF (0.2 µmol/L), and 2-mercaptoethanol (0.33 µL/mL). The protein concentration in the extracts was estimated by the method of Kalb and Bernlohr.19 Incubation for EMSA was conducted as described20 and the reaction products were applied to a 7% (wt/vol) polyacrylamide gel (80:1 wt/wt of acrylamide/N,N'-methylene bisacrylamide), whereafter electrophoresis was performed in 22.5 mmol/L Tris–22.5 mmol/L boric acid–0.5 mmol/L EDTA buffer for 2.5 hours at 200 V. Nonradioactive competitor DNAs, either identical, of the opposite allelic variant, or of nonspecific origin, were added.

Transfection Assay
Twenty-four hours before transfection, cells were plated in Dulbecco's modified Eagle's medium supplemented with 10% newborn calf serum. Two to 4 hours before transfection, the dishes received fresh medium. Cells were incubated for 16 hours with calcium phosphate–precipitated DNAs (15 µg of plasmid per 90-mm dish).13 After a 2-minute 15% glycerol shock, fresh medium was added. Cells were harvested for assay of transient expression 36 hours later. The pSV ß-galactosidase gene (Promega) was cotransfected as an internal control.

Statistics
Conventional methods were used for calculation of means and SDs. Coefficients of skewness and kurtosis were calculated to test deviations from a normal distribution. Logarithmic transformation was performed on the individual values of skewed variables, and a normal distribution of transformed values was confirmed before statistical computations and significance testing. Statview II 4.0 and JMP 3.1 software was used for statistical analysis.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Polymorphic Sites in the MTP Promoter
A total of 184 healthy white men aged 30 to 45 years were recruited, 20 of whom were randomly selected for the search for polymorphisms in the MTP promoter. The entire group was subsequently genotyped for the common polymorphisms found during the initial sequencing procedure and used for association studies. Two common polymorphisms were identified in the promoter region of MTP. One was a G->T substitution at -493, and the other was an A->T substitution at -400. Two less-common polymorphisms were also found at -410 (A/G) and -388 (A/G). The allele frequency for the MTP -493 G/T polymorphism was .75/.25 in the population of 184 native Swedish men. The corresponding figures for the MTP -400 A/T polymorphism were .68/.32. The population was found to be in Hardy-Weinberg equilibrium for the two polymorphisms. The combination of genotypes for the -493 and -400 sites within the group of 184 subjects is in shown in Table 1Down.


View this table:
[in this window]
[in a new window]
 
Table 1. Distribution of Genotypes Based on the -493 and -400 MTP Polymorphisms Among 184 Healthy Men

Functional Studies of Polymorphic Sites
EMSA was performed to determine whether there was differential binding of nuclear protein(s) to the polymorphic sites that might regulate the transcriptional activity of the gene. By use of labeled, sequence-specific and excess, unlabeled nonspecific oligonucleotides, two factors (bands on the EMSA gel) showed sequence-specific binding to the MTP -493 site (Fig 1Down), whereas the EMSA pattern did not differ between the two MTP -400 constructs. The first factor (factor A) bound to the MTP -493G allele as shown by a faint extra band. A second factor represented by a clear double band (factor B) appeared only with the -493 G allele. The EMSA pattern did not differ between the two MTP -400 constructs. No homology was found between the region surrounding the -493 G/T site and the binding sites for known transcription factors.



View larger version (98K):
[in this window]
[in a new window]
 
Figure 1. Differential binding of the MTP -493 G/T polymorphism to HepG2 cell nuclear extracts and EMSA with 32-bp oligonucleotides containing either G or T at the -493 site. Lane 1, labeled oligonucleotide without nuclear extracts from HepG2 cells; 2, labeled oligonucleotide with nuclear extracts; 3, labeled oligonucleotide with a 50-fold excess of identical unlabeled oligonucleotides; 4, labeled oligonucleotide with a 50-fold excess of opposite unlabeled oligonucleotide; 5, labeled oligonucleotide with a 50-fold excess of nonspecific oligonucleotide; 6, same as lane 2. Factors A and B show differential binding to oligonucleotides.

A transfection assay was conducted to assess whether the allele-specific binding of nuclear proteins affected transcriptional activity of the MTP promoter. Two tandem copies of a 31-bp DNA segment containing either of the -493 G or T alleles were inserted upstream from a minimal and heterologous promoter driving the CAT gene. The minimal promoters were used to delineate the impact of putative transcriptional activators or repressors on the -493 G/T sites. Fig 2Down shows the expression of the CAT gene in HepG2 cells. The promoter constructs harboring the -493 T site had an almost twofold higher transcriptional activity than the -493 G construct (+187±69%, P<.05). The interpretation of this finding together with the EMSA pattern is that factor A and/or B could act as a transcriptional repressor. There was no difference in transcriptional activity between constructs containing either of the two -400 A or T alleles (Fig 2Down).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. MTP -493 G/T polymorphism influences transcriptional activity in vitro in HepG2 cells. Expression study with minimal MTP promoters ligated to the CAT reporter gene and transfected into HepG2 cells. CAT activity of MTP -493 G and MTP -400 A variants were set to 100%. Bars indicate mean±SD, n=4. *P<.05 by paired t test comparing the induction of 2xT-HCAT with that of 2xG-HCAT.

Associations With Plasma Lipoproteins
As the MTP -493 G/T polymorphism proved to be functional in EMSA and transfection assays, associations were sought between MTP genotype and plasma lipoprotein concentrations. Subjects who were homozygous for the rare -493 T allele had significantly lower LDL cholesterol and triglyceride levels than did either heterozygotes (-493 G/T) or homozygotes for the common allele (-493 G/G) (Table 2Down). The effect of the MTP -493 T allele therefore seemed to be recessive. The LDL cholesterol concentration of the -493 T/T individuals was, on average, 22% lower than the LDL cholesterol concentration in carriers of one or two copies of the -493 G allele. Similarly, men who were homozygous for the -493 T allele also tended to have lower plasma total cholesterol values (P=.06, compared with individuals with either the -493 G/G or G/T genotype). Otherwise, there were no differences in VLDL or HDL lipid concentrations according to MTP -493 genotype. Because body mass index may influence lipid and lipoprotein levels, they were recalculated according to genotype and after adjustment for body mass index in an ANCOVA. These latter results did not change from those found earlier, and we concluded that body mass index was not a confounder. The lipoprotein lipid levels were almost identical when subjects were grouped according to the MTP -400 A/T polymorphism (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 2. Plasma Concentrations of Major Lipoproteins According to MTP -493 G/T Genotype

The apoE polymorphism exerts a major influence on plasma LDL cholesterol levels. A potential confounding effect of apoE genotype on the association between MTP genotype and LDL cholesterol level was eliminated by confining the MTP genotype–lipoprotein phenotype association studies to subjects homozygous for the E3 allele. In this group of 94 subjects, the respective mean LDL cholesterol concentrations for the three MTP genotypes were 3.70±0.73 mmol/L for -493 G/G (n=52), 3.83±0.95 mmol/L for -493 G/T (n=37), and 2.90±0.42 mmol/L for -493 T/T (n=5). These figures are very similar to those encountered for the whole group (Table 2Up), suggesting that the -493 G/T polymorphism influences the LDL cholesterol concentration independently of apoE genotype.

The apoB content in VLDL subfractions was determined in five subject homozygous for the MTP -493 T allele and 10 subjects homozygous for the MTP -493 G allele. This procedure revealed marked differences in the relative amounts of apoB in large versus small VLDL despite a fairly unchanged total VLDL triglyceride level (Table 3Down). The apoB level in large VLDL was 50% lower in MTP -493 T/T subjects than in MTP -493 G/G subjects. The corresponding VLDL apoB reduction was even more prominent in the fraction containing small VLDL, in both absolute and relative terms (-60%). The lowering of apoB was more pronounced than the lowering of triglycerides, indicating that each VLDL particle carried more triglyceride molecules. There was no difference in apoB content of the IDL fraction. The LDL apoB level was lower in MTP -493 T/T subjects, but this reduction was proportional to the initial observation of a lower LDL cholesterol level.


View this table:
[in this window]
[in a new window]
 
Table 3. Distribution of ApoB Within All ApoB-Containing Lipoproteins and Triglyceride/ApoB Ratios Within the VLDL Fraction in Subjects Homozygous for Either the MTP -493 G or T Allele


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Polymorphisms in the promoter region of MTP have not been previously reported. We have detected a common G/T polymorphism located 493 bp upstream from the start of the transcription site for the MTP gene. The rare allele, with an allele frequency of {approx}.25, confers significantly higher transcriptional activity. Healthy homozygotes for this genetic variant, comprising {approx}6% of healthy, white, middle-aged Swedish men, have a low LDL cholesterol concentration in plasma.

The difference in LDL cholesterol concentrations between carriers of the MTP -493 G/G or G/T genotype and carriers of the MTP -493 T/T genotypes is {approx}0.8 mmol/L. The impact of homozygosity for the MTP -493 T allele on cardiovascular risk is therefore likely to be of major significance. Law and colleagues21 calculated that a 0.6 mmol/L reduction in the serum cholesterol level would correspond to a 50% lowering of the risk of future ischemic heart disease in 40-year-old men. According to the Framingham score, the 10-year risk of developing cardiovascular disease would be 25% lower in subjects with an MTP -493 T/T genotype.22

MTP has a pivotal role in controlling the secretion of apoB-containing lipoproteins, as MTP fills the immature VLDL particle with lipids before it is secreted.1 Poor lipidation of VLDL leads to intracellular degradation instead of secretion.23 Suppression of MTP function by specific MTP inhibitors leads to reduced secretion of VLDL,4 5 and it is likely that a major proportion of apoB is degraded under such circumstances. However, inhibition of MTP must be quite extensive to have an effect in vivo, as obligate heterozygotes for MTP deficiency (fathers or mothers of patients with abetalipoproteinemia) have a fairly normal plasma lipid and lipoprotein pattern.8 24 25

It is more difficult to speculate about the physiological effects of stimulated MTP function. In the present work, we describe a common variant of the MTP promoter leading to enhanced transcriptional activity of the gene. Furthermore, healthy human homozygotes for the rare allele had a considerably lower LDL cholesterol concentration. Which mechanisms could link increased MTP expression to lower plasma LDL cholesterol levels in humans? The LDL cholesterol concentration depends on the balance between the rate of LDL synthesis and the rate of removal of LDL particles from plasma. The regulation of the secretion of apoB-containing lipoproteins from the human liver is not completely understood. ApoB synthesis seems to be almost constant, irrespective of metabolic status.23 In contrast, increased availability of lipid substrate (mostly triglycerides) leads to increased secretion of preferentially large and lipid-rich VLDL and to decreased intracellular degradation of immature VLDL particles.23 Once in the circulation, the larger VLDL species are lipolyzed by lipoprotein lipase, and most of the remnant particles formed in this process are removed from the circulation before reaching a particle size or density corresponding to LDL.26 Small VLDL particles, on the other hand, seem to be direct precursors of LDL, as the secretion rate of small VLDL is tightly linked to the LDL cholesterol concentration in plasma.27 It could thus be speculated that enhanced function of MTP, as would occur with the rare MTP -493 T promoter variant we have described, acts by shifting the balance between secretion of large and small VLDLs. If MTP activity is increased, then lipidation of immature VLDL particles will be more efficient, and it is likely that an increased proportion of larger VLDL species will be secreted. These particles are, however, not direct precursors of LDL, and the input from the VLDL to the LDL fraction will decrease, thus accounting for the lower LDL cholesterol levels seen in individuals with the MTP -493 T/T genotype. The distribution of apoB within the VLDL subfractions argues in favor of this concept. The marked reduction of small VLDL apoB could reflect lowered secretion of this VLDL species, which would lead to diminished production of LDL. The higher VLDL particle content of triglycerides indicates that larger VLDL particles are secreted. Obviously, the secretion pattern of VLDL cannot be elucidated from a single analysis of fasting plasma levels of VLDL, but the relative triglyceride enrichment of the VLDL particles argues in favor of hepatic secretion of larger but fewer VLDL particles in the situation with high MTP expression.

Although the hypothesis of ascribing to MTP a role in the secretion of VLDL that regulates the LDL level in plasma is attractive, it must be borne in mind that the plasma LDL cholesterol level in humans is very much dependent on the expression of hepatic LDL receptors and by them, the removal pathway of LDL. This effect is clearly demonstrated in familial hypercholesterolemia, in which half of the functional LDL receptors are lacking in the heterozygous patient. As a consequence, the LDL cholesterol level in plasma is twofold to threefold above normal levels. The question arises whether high expression of MTP could lead to an alteration of intracellular cholesterol homeostasis. As MTP is also transferring cholesterol,28 an elevated MTP activity would lead to a depletion of cholesterol from intracellular stores. This would, in turn, be sensed by sterol-regulated binding proteins acting on the promoter of the LDL receptor gene.29 Perturbation of intracellular cholesterol homeostasis secondary to elevated MTP activity is likely to be sensed in a fashion similar to 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibition, in which upregulation of LDL receptors is the key mechanism underlying the lowering of LDL cholesterol in plasma.

Previous characterization of human and hamster MTP promoters revealed no regulatory regions upstream from -239 bp from the transcriptional start site.10 This does not, however, rule out the possibility of a regulatory region at -493, as stepwise promoter deletions may include both enhancing and repressing regions, and second, it is not known whether Hagan et al10 used a human clone with a -493 G or T.

In summary, we have shown that a novel, common polymorphism in the promoter region of MTP is of functional importance in regulating expression of the MTP gene and influences the LDL cholesterol concentration in plasma in healthy, middle-aged men. These findings add to our understanding of how the plasma LDL cholesterol level is regulated and suggest that genetic variation in MTP expression may have important implications for the development of cardiovascular disease in humans.


*    Selected Abbreviations and Acronyms
 
apo = apolipoprotein
CAT = chloramphenicol acetyltransferase
EMSA = electrophoretic mobility shift assay
MTP = microsomal triglyceride transfer protein
PCR = polymerase chain reaction


*    Acknowledgments
 
This study was supported by grants from the Swedish Medical Research Council (8691,12659), the Swedish Heart-Lung foundation, and the Marianne and Marcus Wallenberg foundation.

Received October 20, 1997; accepted December 8, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Gordon DA, Wetterau JR, Gregg RE. Microsomal triglyceride transfer protein: a protein complex required for the assembly of lipoprotein particles. Trends Cell Biol. 1995;5:317–321.[Medline] [Order article via Infotrieve]

2. Gordon DA, Jamil H, Sharp D, Mullaney D, Yao Z, Gregg RE, Wetterau J. Secretion of apolipoprotein B-containing lipoproteins from HeLa cells is dependent on expression of the microsomal triglyceride transfer protein and is regulated by lipid availability. Proc Natl Acad Sci U S A. 1994;91:7628–7632.[Abstract/Free Full Text]

3. Leiper JM, Bayliss JD, Pease RJ, Brett DJ, Scott J, Shoulders CC. Microsomal triglyceride transfer protein, the abetalipoproteinemia gene product, mediates the secretion of apolipoprotein B-containing lipoproteins from heterologous cells. J Biol Chem. 1994;269:21951–21954.[Abstract/Free Full Text]

4. Jamil H, Gordon DA, Eustice DC, Brooks CM, Dickson JK Jr, Chen Y, Ricci B, Chu C-H, Harrity TW, Ciosek Jr CP, Biller SA, Gregg RE, Wetterau JR. An inhibitor of the microsomal triglyceride transfer protein inhibits apoB secretion from HepG2 cells. Proc Natl Acad Sci U S A. 1996;93:11991–11995.[Abstract/Free Full Text]

5. Haghpassand M, Wilder D, Moberly JB. Inhibition of apolipoprotein B and triglyceride secretion in human hepatoma cells (HepG2). J Lipid Res. 1996;37:1468–1480.[Abstract]

6. Wetterau JR, Aggerbeck LP, Bouma M-E, Eisenberg C, Munck A, Hermier M, Schmitz J, Gay G, Rader DJ, Gregg RE. Absence of microsomal triglyceride transfer protein in individuals with abetalipoproteinemia. Science. 1992;258:999–1001.[Abstract/Free Full Text]

7. Sharp D, Blinderman L, Combs KA, Kienzle B, Ricci B, Wager-Smith K, Gil CM, Turck DJ, Aggerbeck LP, Gregg RE, Gordon DA, Wetterau JR. Cloning and gene defects in microsomal triglyceride transfer protein associated with abetalipoproteinemia. Nature. 1993;365:65–69.[Medline] [Order article via Infotrieve]

8. Shoulders CC, Brett DJ, Bayliss JD, Narcisi TME, Jarmuz A, Grantham TT, Leoni PRD, Bhattacharya S, Pease RJ, Cullen PM, Levi S, Byfield PGH, Purkiss P, Scott J. Abetalipoproteinemia is caused by defects of the gene encoding the 97 kDa subunit of a microsomal triglyceride transfer protein. Hum Mol Gen. 1993;2:2109–2116.[Abstract/Free Full Text]

9. Narcisi TME, Shoulders CC, Chester SA, Read J, Brett DJ, Harrison DW, Muller DPR, Lloyd JK, Scott J. Mutations of the microsomal triglyceride-transfer-protein gene in abetalipoproteinemia. Am J Hum Genet. 1995;57:1298–1310.[Medline] [Order article via Infotrieve]

10. Hagan DL, Kienzle B, Jamil H, Hariharan N. Transcriptional regulation of human and hamster microsomal triglyceride transfer protein genes. J Biol Chem. 1994;269:28737–28744.[Abstract/Free Full Text]

11. Lin MCM, Gordon D, Wetterau JR. Microsomal triglyceride transfer protein (MTP) in HepG2 cells: insulin negatively regulates MTP gene expression. J Lipid Res. 1995;36:1073–1081.[Abstract]

12. Tornvall P, B[ring]avenholm P, Landou C, de Faire U, Hamsten A. Relation ot plasma levels and composition of apolipoprotein B-containing lipoproteins to angiographically defined coronary artery disease in young patients with myocardial infarction. Circulation. 1993;88:2180–2189.[Abstract/Free Full Text]

13. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989.

14. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215.[Free Full Text]

15. van den Maagdenberg AMJM, de Knijff P, Stalenhoef AFH, Gevers Leuven JA, Havekes LM, Frants RR. Apolipoprotein E3-Leiden allele results from a partial duplication in exon 4. Biochem Biophys Res Commun. 1989;165:851–857.[Medline] [Order article via Infotrieve]

16. Karpe F, Hamsten A. Determination of apolipoproteins B-48 and B-100 in triglyceride-rich lipoproteins by analytical SDS-PAGE. J Lipid Res. 1994;35:1311–1317.[Abstract]

17. Lew DJ, Decker T, Strehlow I, Darnell JE. Overlapping elements in the guanylate-binding protein gene promoter mediate transcriptional induction by alpha and gamma interferons. Mol Cell Biol. 1991;11:182–191.[Abstract/Free Full Text]

18. Alksnis M, Barkhem T, Stromstedt PE, Ahola H, Kutoh E, JA G, Poellinger L, Nilsson S. High level expression of functional full length and truncated glucocorticoid receptor in Chinese hamster ovary cells: demonstration of ligand-induced down-regulation of expressed receptor mRNA and protein. J Biol Chem. 1991;266:10078–10085.[Abstract/Free Full Text]

19. Kalb VJ, Bernlohr RW. A new spectrometric assay for protein in cell extracts. Anal Biochem. 1977;82:362–371.[Medline] [Order article via Infotrieve]

20. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:10793–10745.

21. Law MR, Wald NJ, Thompson SG. By how much and how quickly does a reduction in serum cholesterol concentration lower risk of ischaemic heart disease? BMJ. 1994;308:367–373.[Abstract/Free Full Text]

22. Anderson KM, Wilson PWF, Odell PM, Kanell WB. An updated coronary risk profile. Circulation. 1991;83:356–362.[Free Full Text]

23. Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing lipoproteins: information obtained from cultured liver cells. J Lipid Res. 1993;34:167–179.[Abstract]

24. Salt HB, Wolff OH, Lloyd JK, Fosbrooke AS, Cameron AH, Hubble DV. On having no beta-lipoprotein: a syndrome comprising a-beta-lipoproteinaemia, acanthocytosis and steatorrhoea. Lancet. 1960;2:325–329.[Medline] [Order article via Infotrieve]

25. Talmud PJ, Lloyd JK, Muller DPR, Collins DR, Scott J, Humphries S. Genetic evidence from two families that the apolipoprotein B gene is not involved in abetalipoproteinemia. J Clin Invest. 1988;82:1803–1806.

26. Packard CJ, Munro A, Lorimer AR, Gotto AM, Shepherd J. Metabolism of apolipoprotein B in large triglyceride-rich very low density lipoproteins of normal and hypertriglyceridemic subjects. J Clin Invest. 1984;74:2178–2192.

27. Gaw A, Packard CJ, Lindsay GM, Griffin BA, Caslake MJ, Lorimer AR, Shepherd J. Overproduction of small very low density lipoproteins (Sf 20–60) in moderate hypercholesterolemia: relationship between apolipoprotein B kinetics and plasma lipoproteins. J Lipid Res. 1995;36:158–171.[Abstract]

28. Atzel A, Wetterau JR. Mechanism of microsomal triglyceride transfer protein catalyzed lipid transport. Biochemistry. 1993;32:10444–10450.[Medline] [Order article via Infotrieve]

29. Sudhof TC, Russell DW, Brown MS, Goldstein JL. 42 bp element from LDL receptor gene confers end-product repression by sterols when inserted into viral TK promoter. Cell. 1987;48:1061–1069.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Clin. Nutr.Home page
M. Gastaldi, S. Diziere, C. Defoort, H. Portugal, D. Lairon, M. Darmon, and R. Planells
Sex-specific association of fatty acid binding protein 2 and microsomal triacylglycerol transfer protein variants with response to dietary lipid changes in the 3-mo Medi-RIVAGE primary intervention study
Am. J. Clinical Nutrition, December 1, 2007; 86(6): 1633 - 1641.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
P. Borel, M. Moussa, E. Reboul, B. Lyan, C. Defoort, S. Vincent-Baudry, M. Maillot, M. Gastaldi, M. Darmon, H. Portugal, et al.
Human Plasma Levels of Vitamin E and Carotenoids Are Associated with Genetic Polymorphisms in Genes Involved in Lipid Metabolism
J. Nutr., December 1, 2007; 137(12): 2653 - 2659.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
G. Musso, R. Gambino, F. De Michieli, G. Biroli, A. Premoli, G. Pagano, S. Bo, M. Durazzo, and M. Cassader
Nitrosative stress predicts the presence and severity of nonalcoholic fatty liver at different stages of the development of insulin resistance and metabolic syndrome: possible role of vitamin A intake
Am. J. Clinical Nutrition, September 1, 2007; 86(3): 661 - 671.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
M. J. Neville, R. Clarke, J. G. Evans, D. C. Rubinsztein, and F. Karpe
Absence of Relationship Between MTTP Haplotypes and Longevity
J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2007; 62(2): 202 - 205.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
H. Ledmyr, L. Ottosson, M. Sunnerhagen, and E. Ehrenborg
The Ile128Thr polymorphism influences stability and ligand binding properties of the microsomal triglyceride transfer protein
J. Lipid Res., July 1, 2006; 47(7): 1378 - 1385.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Duez, B. Lamarche, K. D. Uffelman, R. Valero, J. S. Cohn, and G. F. Lewis
Hyperinsulinemia Is Associated With Increased Production Rate of Intestinal Apolipoprotein B-48-Containing Lipoproteins in Humans
Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1357 - 1363.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
M. Beekman, G. J. Blauw, J. J. Houwing-Duistermaat, B. W. Brandt, R. G. J. Westendorp, and P. E. Slagboom
Chromosome 4q25, microsomal transfer protein gene, and human longevity: novel data and a meta-analysis of association studies.
J. Gerontol. A Biol. Sci. Med. Sci., April 1, 2006; 61(4): 355 - 362.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Lundahl, C. Skoglund-Andersson, M. Caslake, D. Bedford, P. Stewart, A. Hamsten, C. J. Packard, and F. Karpe
Microsomal triglyceride transfer protein -493T variant reduces IDL plus LDL apoB production and the plasma concentration of large LDL particles
Am J Physiol Endocrinol Metab, April 1, 2006; 290(4): E739 - E745.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M M Richardson, E E Powell, H D Barrie, A D Clouston, D M Purdie, and J R Jonsson
A combination of genetic polymorphisms increases the risk of progressive disease in chronic hepatitis C
J. Med. Genet., July 1, 2005; 42(7): e45 - e45.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Nebel, P. J. P. Croucher, R. Stiegeler, S. Nikolaus, M. Krawczak, and S. Schreiber
No association between microsomal triglyceride transfer protein (MTP) haplotype and longevity in humans
PNAS, May 31, 2005; 102(22): 7906 - 7909.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
V. Sheena, R. Hertz, J. Nousbeck, I. Berman, J. Magenheim, and J. Bar-Tana
Transcriptional regulation of human microsomal triglyceride transfer protein by hepatocyte nuclear factor-4{alpha}
J. Lipid Res., February 1, 2005; 46(2): 328 - 341.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Stan, M. Lambert, E. Delvin, G. Paradis, J. O'Loughlin, J. A. Hanley, and E. Levy
Intestinal fatty acid binding protein and microsomal triglyceride transfer protein polymorphisms in French-Canadian youth
J. Lipid Res., February 1, 2005; 46(2): 320 - 327.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. C. Sposito, S. Gonbert, G. Turpin, M. J. Chapman, and J. Thillet
Common Polymorphism in the MTP Promoter Attenuates the Dyslipidemic and Proatherogenic Effects of Excess Body Weight
Arterioscler Thromb Vasc Biol, August 1, 2004; 24(8): e143 - e143.
[Full Text] [PDF]


Home page
Int J EpidemiolHome page
M. A Pereira, R. M Weggemans, D. R Jacobs Jr, P. J Hannan, P. L Zock, J. M Ordovas, and M. B Katan
Within-person variation in serum lipids: implications for clinical trials
Int. J. Epidemiol., June 1, 2004; 33(3): 534 - 541.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Ledmyr, A. D. McMahon, E. Ehrenborg, L. B. Nielsen, M. Neville, H. Lithell, P. W. MacFarlane, C. J. Packard, F. Karpe, and on behalf of the WOSCOPS executive;
The Microsomal Triglyceride Transfer Protein Gene-493T Variant Lowers Cholesterol But Increases the Risk of Coronary Heart Disease
Circulation, May 18, 2004; 109(19): 2279 - 2284.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
C. Phillips, K. Mullan, D. Owens, and G.H. Tomkin
Microsomal triglyceride transfer protein polymorphisms and lipoprotein levels in type 2 diabetes
QJM, April 1, 2004; 97(4): 211 - 218.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. J. Geesaman, E. Benson, S. J. Brewster, L. M. Kunkel, H. Blanche, G. Thomas, T. T. Perls, M. J. Daly, and A. A. Puca
Haplotype-based identification of a microsomal transfer protein marker associated with the human lifespan
PNAS, November 25, 2003; 100(24): 14115 - 14120.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kang, N. J. Spann, T. Y. Hui, and R. A. Davis
ARP-1/COUP-TF II Determines Hepatoma Phenotype by Acting as Both a Transcriptional Repressor of Microsomal Triglyceride Transfer Protein and an Inducer of CYP7A1
J. Biol. Chem., August 15, 2003; 278(33): 30478 - 30486.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S.-H. H. Juo, L. Colangelo, Z. Han, J. D. Smith, and K. Liu
Confirmation of the Microsomal Triglyceride Transfer Protein Genetic Effect on Lipids in Young African American Men From the CARDIA Study
Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 912 - 913.
[Full Text] [PDF]


Home page
DiabetesHome page
E. D. Bartels, M. Lauritsen, and L. B. Nielsen
Hepatic Expression of Microsomal Triglyceride Transfer Protein and In Vivo Secretion of Triglyceride-Rich Lipoproteins Are Increased in Obese Diabetic Mice
Diabetes, April 1, 2002; 51(4): 1233 - 1239.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. Lundahl, A. Hamsten, and F. Karpe
Postprandial Plasma ApoB-48 Levels Are Influenced by a Polymorphism in the Promoter of the Microsomal Triglyceride Transfer Protein Gene
Arterioscler Thromb Vasc Biol, February 1, 2002; 22(2): 289 - 293.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
H. Ledmyr, F. Karpe, B. Lundahl, M. McKinnon, C. Skoglund-Andersson, and E. Ehrenborg
Variants of the microsomal triglyceride transfer protein gene are associated with plasma cholesterol levels and body mass index
J. Lipid Res., January 1, 2002; 43(1): 51 - 58.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Bjorn Lundahl, T. P. Leren, L. Ose, A. Hamsten, and F. Karpe
A Functional Polymorphism in the Promoter Region of the Microsomal Triglyceride Transfer Protein (MTP -493G/T) Influences Lipoprotein Phenotype in Familial Hypercholesterolemia
Arterioscler Thromb Vasc Biol, July 1, 2000; 20(7): 1784 - 1788.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S.-H. H. Juo, Z. Han, J. D. Smith, L. Colangelo, and K. Liu
Common Polymorphism in Promoter of Microsomal Triglyceride Transfer Protein Gene Influences Cholesterol, ApoB, and Triglyceride Levels in Young African American Men : Results From the Coronary Artery Risk Development in Young Adults (CARDIA) Study
Arterioscler Thromb Vasc Biol, May 1, 2000; 20(5): 1316 - 1322.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
G. F. Watts, F. M. Riches, S. E. Humphries, P. J. Talmud, and F. M. van Bockxmeer
Genotypic associations of the hepatic secretion of VLDL apolipoprotein B-100 in obesity
J. Lipid Res., March 1, 2000; 41(3): 481 - 488.
[Abstract] [Full Text]


Home page
J. Lipid Res.Home page
E. Voyiaziakis, C. Ko, S. M. O'Rourke, and L.-S. Huang
Genetic control of hepatic apoB-100 secretion in human apoB transgenic mouse strains
J. Lipid Res., November 1, 1999; 40(11): 2004 - 2012.
[Abstract] [Full Text]


Home page
J. Lipid Res.Home page
P. Couture, J. D. Otvos, L. A. Cupples, P. W. F. Wilson, E. J. Schaefer, and J. M. Ordovas
Association of the A-204C polymorphism in the cholesterol 7{alpha}-hydroxylase gene with variations in plasma low density lipoprotein cholesterol levels in the Framingham Offspring Study
J. Lipid Res., October 1, 1999; 40(10): 1883 - 1889.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. L. Rainwater, L. Almasy, J. Blangero, S. A. Cole, J. L. VandeBerg, J. W. MacCluer, and J. E. Hixson
A Genome Search Identifies Major Quantitative Trait Loci on Human Chromosomes 3 and 4 That Influence Cholesterol Concentrations in Small LDL Particles
Arterioscler Thromb Vasc Biol, March 1, 1999; 19(3): 777 - 783.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karpe, F.
Right arrow Articles by Hamsten, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karpe, F.
Right arrow Articles by Hamsten, A.