Original Contributions |
From the Atherosclerosis Research Unit, King Gustaf V Research Institute, Karolinska Hospital, Stockholm, Sweden.
Correspondence to Fredrik Karpe, Atherosclerosis Research Unit, King Gustaf V Research Institute, Karolinska Hospital, S-171 76, Stockholm, Sweden. E-mail karpe{at}instmed.ks.se
| Abstract |
|---|
|
|
|---|
Key Words: gene regulation cardiovascular disease apolipoprotein B lipoprotein assembly triglycerides
| Introduction |
|---|
|
|
|---|
The promoter region of the MTP gene is highly conserved between species and shows signs of both cell typespecific expression and response to metabolic regulators. The activity of the human MTP promoter is suppressed by insulin and enhanced by cholesterol.10 The insulin response has been confirmed in HepG2 cells.11 It has also been shown that hamsters fed either a high-fat or a cholesterol-enriched diet have higher concentrations of MTP mRNA.
Against this background we hypothesized that genetic variation in MTP expression might influence the plasma concentrations of apoB-containing lipoproteins in humans. We report herein a common functional polymorphism in the promoter region of the MTP gene, of which the rarer allele is linked to low plasma LDL cholesterol concentrations.
| Methods |
|---|
|
|
|---|
Blood Sampling, DNA Procedures, and Lipoprotein Analyses
Blood sampling, preparation of plasma, and quantification of
major fasting plasma lipoproteins were performed as described
previously.12 For DNA procedures, nucleated cells
from frozen whole blood were prepared according to Sambrook et
al,13 and DNA was extracted by a salting-out
method.14 All subjects were also
genotyped for the apoE
polymorphism.15 VLDL subfractions were
isolated from fasting plasma, and the content of apoB-100 was
quantified by analytical SDSpolyacrylamide gel
electrophoresis as described.16
Gene Sequencing
DNA for direct sequencing of the MTP promoter was amplified in a
two-step nested PCR reaction. Approximately 100 ng of genomic DNA was
used for each individual PCR reaction. Primers were designed from the
published promoter sequence (-743 bp in the 5'
direction).7 First, a round of PCR was performed
by using the primer 5'-CCCTCTTAATCTCTTTCCTAGAA (MTP-1) together with
5'-AAGAATCATATTGACCAGCAATC (MTP-2). Second, 1 µL of this PCR reaction
mixture was used for a second PCR that utilized one unlabeled and one
biotin-labeled primer at concentrations of 0.1 µmol/L each.
These primers were MTP-1 and 5'-CCAGCTAGGAGTCACTGAGA (biotinylated).
All amplifications were performed for 30 cycles at 96°C for 1 minute,
60°C for 30 seconds, and 72°C for 90 seconds in a buffer containing
1.0 mmol/L MgCl2, 0.2 mmol/L dNTP,
10 mmol/L Tris-HCl, pH 8.4 at 70°C, 0.1% Tween 20, and 0.2 U
Taq polymerase. The biotinylated PCR fragments were
immobilized by binding to streptavidin-coated magnetic
beads (Dynabeads, Dynal), and the nonbiotinylated strands were removed
by incubation in 50 µL of 0.15 mol/L NaOH for 5 minutes at room
temperature. The bound DNA was rinsed three times and resuspended in 13
µL distilled water. Gene sequencing was performed with the
chain-termination method using fluorescence-labeled primers
distributed within the 750-bp promoter region. These were 5'-TAGAAATG
AGATTCAGAAAGGAC (MTP-3fl), 5'-CAATCATCTATGTTTC ATCAA (MTP-7fl), and
5'-AAGTTTCCTCATTGGGTGA (MTP-8fl). The products were
analyzed by using a Pharmacia ALF DNA sequencer. All primers
were synthesized on a Gene Assembler Plus (Pharmacia). Labeling of
primers with biotin or fluorescein was performed by
incorporating BioDite or FluorePrime Fluorescein Amidite (Pharmacia),
respectively, during synthesis. Fluorescence-labeled primers
were purified by reverse-phase chromatography on a
PepRPC column (Pharmacia FPLC). Normally, the sequences could be read,
with a considerable overlap, thus confirming the sequence.
Genotyping
Primers MTP-1 and MTP-2 were used for genotyping of the -400
A/T polymorphism. First, a single-step PCR reaction was optimized
further by increasing the MgCl2 concentration to
2.0 µmol/L and by changing the procedure to 35 cycles at 94°C
for 30 seconds, 55°C for 60 seconds, and 72°C for 3 minutes. The
PCR product was then incubated with the restriction enzyme
Ssp1 (4 U). The -400 T allele gave rise to a cutting
site. The restriction fragment length polymorphism was inspected
after agarose gel (1.5%) electrophoresis of the incubate. The -400 A
allele gave rise to the full-length fragment (838 bp), whereas the
-400 T allele gave rise to two shorter fragments (494 and 344
bp, respectively).
The -493 G/T polymorphism does not give rise to a cutting site with any common restriction enzyme. However, a mutation in the 5' primer used for PCR of a gene product including the -493 site gave rise to an Hph1 cutting site for the -493 G allele. The PCR (5'-GGA TTTAAATTTAAACTGTTAATTCATATCAC and 5'-AGTTTCACACA TAAGGACAATCATCTA) gave rise to a 109-bp fragment, and the gene product was cleaved by Hph1. For this second round of PCR, the MgCl2 concentration was increased to 5 mmol/L and the number of cycles was changed to 35 at 94°C for 30 seconds, 57°C for 60 seconds, and 72°C for 2 minutes. The PCR product was incubated with Hph1 and the restriction fragment length polymorphism was studied after high-resolution 3% agarose gel electrophoresis (Metaphor-agarose). The -493 T allele gave rise to a full-length fragment (109 bp), whereas the -493 G allele gave rise to two fragments of 89 and 20 bp. HepG2 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% newborn calf serum.
DNA Constructs
For the EMSA, four sets of complementary
oligonucleotides were designed: -400, 5'-GTCCAT
ACAAGAAAAATTAAAATTTGGTTAG and 5'-GTCCATACAAG
AAATATTAAAATTTGGTTAG; and -493,
5'-TTGAAGTGATTGGTGGT GGTATGAATTAACAG and
5'-TTGAAGTGATTGGTTGTGGTATGAATTAACAG. One set of
double-stranded oligonucleotides containing the same
sequences as above but flanked by BamHI and BglII
ends was constructed for the CAT assay. Two double-stranded
oligonucleotides were ligated head to tail into a
BamHI-restricted HIV-chloramphemicol acetyl-transferase
(HCAT) vector.17 The correct sequence and
orientation of the inserts were tested by DNA sequencing.
EMSA
Nuclear extracts were prepared according to Alksnis et
al.18 All buffers were freshly supplemented with
leupeptin (0.7 µg/mL), aprotinin (16.6 µg/mL), PMSF (0.2
µmol/L), and 2-mercaptoethanol (0.33 µL/mL). The protein
concentration in the extracts was estimated by the method of Kalb and
Bernlohr.19 Incubation for EMSA was conducted as
described20 and the reaction products were
applied to a 7% (wt/vol) polyacrylamide gel (80:1 wt/wt of
acrylamide/N,N'-methylene
bisacrylamide), whereafter electrophoresis was performed in
22.5 mmol/L Tris22.5 mmol/L boric acid0.5 mmol/L
EDTA buffer for 2.5 hours at 200 V. Nonradioactive competitor DNAs,
either identical, of the opposite allelic variant, or of nonspecific
origin, were added.
Transfection Assay
Twenty-four hours before transfection, cells were plated in
Dulbecco's modified Eagle's medium supplemented with 10% newborn
calf serum. Two to 4 hours before transfection, the dishes received
fresh medium. Cells were incubated for 16 hours with calcium
phosphateprecipitated DNAs (15 µg of plasmid per 90-mm
dish).13 After a 2-minute 15% glycerol shock,
fresh medium was added. Cells were harvested for assay of transient
expression 36 hours later. The pSV ß-galactosidase gene (Promega) was
cotransfected as an internal control.
Statistics
Conventional methods were used for calculation of means and SDs.
Coefficients of skewness and kurtosis were calculated to test
deviations from a normal distribution. Logarithmic transformation was
performed on the individual values of skewed variables, and a
normal distribution of transformed values was confirmed before
statistical computations and significance testing. Statview II 4.0 and
JMP 3.1 software was used for statistical analysis.
| Results |
|---|
|
|
|---|
T substitution at -493, and the other was
an A
T substitution at -400. Two less-common polymorphisms were
also found at -410 (A/G) and -388 (A/G). The allele frequency for
the MTP -493 G/T polymorphism was .75/.25 in the population of 184
native Swedish men. The corresponding figures for the MTP -400 A/T
polymorphism were .68/.32. The population was found to be in
Hardy-Weinberg equilibrium for the two polymorphisms. The
combination of genotypes for the -493 and -400 sites within
the group of 184 subjects is in shown in Table 1
|
Functional Studies of Polymorphic Sites
EMSA was performed to determine whether there was differential
binding of nuclear protein(s) to the polymorphic sites that might
regulate the transcriptional activity of the gene. By use of labeled,
sequence-specific and excess, unlabeled nonspecific
oligonucleotides, two factors (bands on the EMSA gel)
showed sequence-specific binding to the MTP -493 site (Fig 1
), whereas the EMSA pattern did not
differ between the two MTP -400 constructs. The first factor (factor
A) bound to the MTP -493G allele as shown by a faint extra band. A
second factor represented by a clear double band (factor B)
appeared only with the -493 G allele. The EMSA pattern did not
differ between the two MTP -400 constructs. No homology was found
between the region surrounding the -493 G/T site and the binding sites
for known transcription factors.
|
A transfection assay was conducted to assess whether the
allele-specific binding of nuclear proteins affected
transcriptional activity of the MTP promoter. Two tandem copies of a
31-bp DNA segment containing either of the -493 G or T alleles
were inserted upstream from a minimal and heterologous promoter driving
the CAT gene. The minimal promoters were used to delineate the impact
of putative transcriptional activators or repressors on the
-493 G/T sites. Fig 2
shows the
expression of the CAT gene in HepG2 cells. The promoter constructs
harboring the -493 T site had an almost twofold higher transcriptional
activity than the -493 G construct (+187±69%, P<.05).
The interpretation of this finding together with the EMSA pattern is
that factor A and/or B could act as a transcriptional repressor. There
was no difference in transcriptional activity between constructs
containing either of the two -400 A or T alleles (Fig 2
).
|
Associations With Plasma Lipoproteins
As the MTP -493 G/T polymorphism proved to be functional in
EMSA and transfection assays, associations were sought between MTP
genotype and plasma lipoprotein concentrations. Subjects who
were homozygous for the rare -493 T allele had significantly lower
LDL cholesterol and triglyceride levels than
did either heterozygotes (-493 G/T) or homozygotes for the common
allele (-493 G/G) (Table 2
). The
effect of the MTP -493 T allele therefore seemed to be recessive.
The LDL cholesterol concentration of the -493 T/T
individuals was, on average, 22% lower than the LDL
cholesterol concentration in carriers of one or two copies
of the -493 G allele. Similarly, men who were homozygous for the
-493 T allele also tended to have lower plasma total
cholesterol values (P=.06, compared with
individuals with either the -493 G/G or G/T genotype).
Otherwise, there were no differences in VLDL or HDL lipid
concentrations according to MTP -493 genotype. Because body
mass index may influence lipid and lipoprotein levels, they were
recalculated according to genotype and after adjustment for
body mass index in an ANCOVA. These latter results did not change from
those found earlier, and we concluded that body mass index was not a
confounder. The lipoprotein lipid levels were almost identical when
subjects were grouped according to the MTP -400 A/T polymorphism
(data not shown).
|
The apoE polymorphism exerts a major influence on plasma LDL
cholesterol levels. A potential confounding effect of apoE
genotype on the association between MTP genotype and
LDL cholesterol level was eliminated by confining the MTP
genotypelipoprotein phenotype association studies to
subjects homozygous for the E3 allele. In this group of 94
subjects, the respective mean LDL cholesterol
concentrations for the three MTP genotypes were 3.70±0.73
mmol/L for -493 G/G (n=52), 3.83±0.95 mmol/L for -493 G/T (n=37),
and 2.90±0.42 mmol/L for -493 T/T (n=5). These figures are very
similar to those encountered for the whole group (Table 2
), suggesting
that the -493 G/T polymorphism influences the LDL
cholesterol concentration independently of apoE
genotype.
The apoB content in VLDL subfractions was determined in five subject
homozygous for the MTP -493 T allele and 10 subjects homozygous
for the MTP -493 G allele. This procedure revealed marked
differences in the relative amounts of apoB in large versus small VLDL
despite a fairly unchanged total VLDL triglyceride level
(Table 3
). The apoB level in large VLDL
was 50% lower in MTP -493 T/T subjects than in MTP -493 G/G
subjects. The corresponding VLDL apoB reduction was even more prominent
in the fraction containing small VLDL, in both absolute and relative
terms (-60%). The lowering of apoB was more pronounced than the
lowering of triglycerides, indicating that each VLDL
particle carried more triglyceride molecules. There was no
difference in apoB content of the IDL fraction. The LDL apoB level was
lower in MTP -493 T/T subjects, but this reduction was proportional to
the initial observation of a lower LDL cholesterol
level.
|
| Discussion |
|---|
|
|
|---|
.25, confers significantly higher transcriptional activity. Healthy
homozygotes for this genetic variant, comprising
6% of healthy,
white, middle-aged Swedish men, have a low LDL cholesterol
concentration in plasma.
The difference in LDL cholesterol concentrations between
carriers of the MTP -493 G/G or G/T genotype and carriers of
the MTP -493 T/T genotypes is
0.8 mmol/L. The impact
of homozygosity for the MTP -493 T allele on
cardiovascular risk is therefore likely to be of major
significance. Law and colleagues21 calculated
that a 0.6 mmol/L reduction in the serum cholesterol
level would correspond to a 50% lowering of the risk of future
ischemic heart disease in 40-year-old men. According to the
Framingham score, the 10-year risk of developing
cardiovascular disease would be 25% lower in subjects
with an MTP -493 T/T genotype.22
MTP has a pivotal role in controlling the secretion of apoB-containing lipoproteins, as MTP fills the immature VLDL particle with lipids before it is secreted.1 Poor lipidation of VLDL leads to intracellular degradation instead of secretion.23 Suppression of MTP function by specific MTP inhibitors leads to reduced secretion of VLDL,4 5 and it is likely that a major proportion of apoB is degraded under such circumstances. However, inhibition of MTP must be quite extensive to have an effect in vivo, as obligate heterozygotes for MTP deficiency (fathers or mothers of patients with abetalipoproteinemia) have a fairly normal plasma lipid and lipoprotein pattern.8 24 25
It is more difficult to speculate about the physiological effects of stimulated MTP function. In the present work, we describe a common variant of the MTP promoter leading to enhanced transcriptional activity of the gene. Furthermore, healthy human homozygotes for the rare allele had a considerably lower LDL cholesterol concentration. Which mechanisms could link increased MTP expression to lower plasma LDL cholesterol levels in humans? The LDL cholesterol concentration depends on the balance between the rate of LDL synthesis and the rate of removal of LDL particles from plasma. The regulation of the secretion of apoB-containing lipoproteins from the human liver is not completely understood. ApoB synthesis seems to be almost constant, irrespective of metabolic status.23 In contrast, increased availability of lipid substrate (mostly triglycerides) leads to increased secretion of preferentially large and lipid-rich VLDL and to decreased intracellular degradation of immature VLDL particles.23 Once in the circulation, the larger VLDL species are lipolyzed by lipoprotein lipase, and most of the remnant particles formed in this process are removed from the circulation before reaching a particle size or density corresponding to LDL.26 Small VLDL particles, on the other hand, seem to be direct precursors of LDL, as the secretion rate of small VLDL is tightly linked to the LDL cholesterol concentration in plasma.27 It could thus be speculated that enhanced function of MTP, as would occur with the rare MTP -493 T promoter variant we have described, acts by shifting the balance between secretion of large and small VLDLs. If MTP activity is increased, then lipidation of immature VLDL particles will be more efficient, and it is likely that an increased proportion of larger VLDL species will be secreted. These particles are, however, not direct precursors of LDL, and the input from the VLDL to the LDL fraction will decrease, thus accounting for the lower LDL cholesterol levels seen in individuals with the MTP -493 T/T genotype. The distribution of apoB within the VLDL subfractions argues in favor of this concept. The marked reduction of small VLDL apoB could reflect lowered secretion of this VLDL species, which would lead to diminished production of LDL. The higher VLDL particle content of triglycerides indicates that larger VLDL particles are secreted. Obviously, the secretion pattern of VLDL cannot be elucidated from a single analysis of fasting plasma levels of VLDL, but the relative triglyceride enrichment of the VLDL particles argues in favor of hepatic secretion of larger but fewer VLDL particles in the situation with high MTP expression.
Although the hypothesis of ascribing to MTP a role in the secretion of VLDL that regulates the LDL level in plasma is attractive, it must be borne in mind that the plasma LDL cholesterol level in humans is very much dependent on the expression of hepatic LDL receptors and by them, the removal pathway of LDL. This effect is clearly demonstrated in familial hypercholesterolemia, in which half of the functional LDL receptors are lacking in the heterozygous patient. As a consequence, the LDL cholesterol level in plasma is twofold to threefold above normal levels. The question arises whether high expression of MTP could lead to an alteration of intracellular cholesterol homeostasis. As MTP is also transferring cholesterol,28 an elevated MTP activity would lead to a depletion of cholesterol from intracellular stores. This would, in turn, be sensed by sterol-regulated binding proteins acting on the promoter of the LDL receptor gene.29 Perturbation of intracellular cholesterol homeostasis secondary to elevated MTP activity is likely to be sensed in a fashion similar to 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibition, in which upregulation of LDL receptors is the key mechanism underlying the lowering of LDL cholesterol in plasma.
Previous characterization of human and hamster MTP promoters revealed no regulatory regions upstream from -239 bp from the transcriptional start site.10 This does not, however, rule out the possibility of a regulatory region at -493, as stepwise promoter deletions may include both enhancing and repressing regions, and second, it is not known whether Hagan et al10 used a human clone with a -493 G or T.
In summary, we have shown that a novel, common polymorphism in the promoter region of MTP is of functional importance in regulating expression of the MTP gene and influences the LDL cholesterol concentration in plasma in healthy, middle-aged men. These findings add to our understanding of how the plasma LDL cholesterol level is regulated and suggest that genetic variation in MTP expression may have important implications for the development of cardiovascular disease in humans.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received October 20, 1997; accepted December 8, 1997.
| References |
|---|
|
|
|---|
2.
Gordon DA, Jamil H, Sharp D, Mullaney D, Yao Z, Gregg
RE, Wetterau J. Secretion of apolipoprotein B-containing lipoproteins
from HeLa cells is dependent on expression of the microsomal
triglyceride transfer protein and is regulated by lipid
availability. Proc Natl Acad Sci U S A. 1994;91:76287632.
3.
Leiper JM, Bayliss JD, Pease RJ, Brett DJ, Scott J,
Shoulders CC. Microsomal triglyceride transfer protein, the
abetalipoproteinemia gene product, mediates the secretion of
apolipoprotein B-containing lipoproteins from heterologous cells.
J Biol Chem. 1994;269:2195121954.
4.
Jamil H, Gordon DA, Eustice DC, Brooks CM, Dickson JK
Jr, Chen Y, Ricci B, Chu C-H, Harrity TW, Ciosek Jr CP, Biller SA,
Gregg RE, Wetterau JR. An inhibitor of the microsomal
triglyceride transfer protein inhibits apoB secretion from
HepG2 cells. Proc Natl Acad Sci U S A. 1996;93:1199111995.
5. Haghpassand M, Wilder D, Moberly JB. Inhibition of apolipoprotein B and triglyceride secretion in human hepatoma cells (HepG2). J Lipid Res. 1996;37:14681480.[Abstract]
6.
Wetterau JR, Aggerbeck LP, Bouma M-E, Eisenberg C,
Munck A, Hermier M, Schmitz J, Gay G, Rader DJ, Gregg RE. Absence of
microsomal triglyceride transfer protein in individuals
with abetalipoproteinemia. Science. 1992;258:9991001.
7. Sharp D, Blinderman L, Combs KA, Kienzle B, Ricci B, Wager-Smith K, Gil CM, Turck DJ, Aggerbeck LP, Gregg RE, Gordon DA, Wetterau JR. Cloning and gene defects in microsomal triglyceride transfer protein associated with abetalipoproteinemia. Nature. 1993;365:6569.[Medline] [Order article via Infotrieve]
8.
Shoulders CC, Brett DJ, Bayliss JD, Narcisi TME,
Jarmuz A, Grantham TT, Leoni PRD, Bhattacharya S, Pease RJ, Cullen PM,
Levi S, Byfield PGH, Purkiss P, Scott J. Abetalipoproteinemia is caused
by defects of the gene encoding the 97 kDa subunit of a microsomal
triglyceride transfer protein. Hum Mol Gen. 1993;2:21092116.
9. Narcisi TME, Shoulders CC, Chester SA, Read J, Brett DJ, Harrison DW, Muller DPR, Lloyd JK, Scott J. Mutations of the microsomal triglyceride-transfer-protein gene in abetalipoproteinemia. Am J Hum Genet. 1995;57:12981310.[Medline] [Order article via Infotrieve]
10.
Hagan DL, Kienzle B, Jamil H, Hariharan N.
Transcriptional regulation of human and hamster microsomal
triglyceride transfer protein genes. J Biol
Chem. 1994;269:2873728744.
11. Lin MCM, Gordon D, Wetterau JR. Microsomal triglyceride transfer protein (MTP) in HepG2 cells: insulin negatively regulates MTP gene expression. J Lipid Res. 1995;36:10731081.[Abstract]
12.
Tornvall P, B[ring]avenholm P, Landou C, de Faire U,
Hamsten A. Relation ot plasma levels and composition of apolipoprotein
B-containing lipoproteins to angiographically defined coronary
artery disease in young patients with myocardial infarction.
Circulation. 1993;88:21802189.
13. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989.
14.
Miller SA, Dykes DD, Polesky HF. A simple salting out
procedure for extracting DNA from human nucleated cells. Nucleic
Acids Res. 1988;16:1215.
15. van den Maagdenberg AMJM, de Knijff P, Stalenhoef AFH, Gevers Leuven JA, Havekes LM, Frants RR. Apolipoprotein E3-Leiden allele results from a partial duplication in exon 4. Biochem Biophys Res Commun. 1989;165:851857.[Medline] [Order article via Infotrieve]
16. Karpe F, Hamsten A. Determination of apolipoproteins B-48 and B-100 in triglyceride-rich lipoproteins by analytical SDS-PAGE. J Lipid Res. 1994;35:13111317.[Abstract]
17.
Lew DJ, Decker T, Strehlow I, Darnell JE. Overlapping
elements in the guanylate-binding protein gene promoter mediate
transcriptional induction by alpha and gamma interferons. Mol
Cell Biol. 1991;11:182191.
18.
Alksnis M, Barkhem T, Stromstedt PE, Ahola H, Kutoh E,
JA G, Poellinger L, Nilsson S. High level expression of functional
full length and truncated glucocorticoid receptor in Chinese hamster
ovary cells: demonstration of ligand-induced down-regulation of
expressed receptor mRNA and protein. J Biol Chem. 1991;266:1007810085.
19. Kalb VJ, Bernlohr RW. A new spectrometric assay for protein in cell extracts. Anal Biochem. 1977;82:362371.[Medline] [Order article via Infotrieve]
20. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:1079310745.
21.
Law MR, Wald NJ, Thompson SG. By how much and how
quickly does a reduction in serum cholesterol concentration
lower risk of ischaemic heart disease? BMJ. 1994;308:367373.
22.
Anderson KM, Wilson PWF, Odell PM, Kanell WB. An
updated coronary risk profile. Circulation. 1991;83:356362.
23. Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing lipoproteins: information obtained from cultured liver cells. J Lipid Res. 1993;34:167179.[Abstract]
24. Salt HB, Wolff OH, Lloyd JK, Fosbrooke AS, Cameron AH, Hubble DV. On having no beta-lipoprotein: a syndrome comprising a-beta-lipoproteinaemia, acanthocytosis and steatorrhoea. Lancet. 1960;2:325329.[Medline] [Order article via Infotrieve]
25. Talmud PJ, Lloyd JK, Muller DPR, Collins DR, Scott J, Humphries S. Genetic evidence from two families that the apolipoprotein B gene is not involved in abetalipoproteinemia. J Clin Invest. 1988;82:18031806.
26. Packard CJ, Munro A, Lorimer AR, Gotto AM, Shepherd J. Metabolism of apolipoprotein B in large triglyceride-rich very low density lipoproteins of normal and hypertriglyceridemic subjects. J Clin Invest. 1984;74:21782192.
27. Gaw A, Packard CJ, Lindsay GM, Griffin BA, Caslake MJ, Lorimer AR, Shepherd J. Overproduction of small very low density lipoproteins (Sf 2060) in moderate hypercholesterolemia: relationship between apolipoprotein B kinetics and plasma lipoproteins. J Lipid Res. 1995;36:158171.[Abstract]
28. Atzel A, Wetterau JR. Mechanism of microsomal triglyceride transfer protein catalyzed lipid transport. Biochemistry. 1993;32:1044410450.[Medline] [Order article via Infotrieve]
29. Sudhof TC, Russell DW, Brown MS, Goldstein JL. 42 bp element from LDL receptor gene confers end-product repression by sterols when inserted into viral TK promoter. Cell. 1987;48:10611069.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
M. Gastaldi, S. Diziere, C. Defoort, H. Portugal, D. Lairon, M. Darmon, and R. Planells Sex-specific association of fatty acid binding protein 2 and microsomal triacylglycerol transfer protein variants with response to dietary lipid changes in the 3-mo Medi-RIVAGE primary intervention study Am. J. Clinical Nutrition, December 1, 2007; 86(6): 1633 - 1641. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Borel, M. Moussa, E. Reboul, B. Lyan, C. Defoort, S. Vincent-Baudry, M. Maillot, M. Gastaldi, M. Darmon, H. Portugal, et al. Human Plasma Levels of Vitamin E and Carotenoids Are Associated with Genetic Polymorphisms in Genes Involved in Lipid Metabolism J. Nutr., December 1, 2007; 137(12): 2653 - 2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Musso, R. Gambino, F. De Michieli, G. Biroli, A. Premoli, G. Pagano, S. Bo, M. Durazzo, and M. Cassader Nitrosative stress predicts the presence and severity of nonalcoholic fatty liver at different stages of the development of insulin resistance and metabolic syndrome: possible role of vitamin A intake Am. J. Clinical Nutrition, September 1, 2007; 86(3): 661 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Neville, R. Clarke, J. G. Evans, D. C. Rubinsztein, and F. Karpe Absence of Relationship Between MTTP Haplotypes and Longevity J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2007; 62(2): 202 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ledmyr, L. Ottosson, M. Sunnerhagen, and E. Ehrenborg The Ile128Thr polymorphism influences stability and ligand binding properties of the microsomal triglyceride transfer protein J. Lipid Res., July 1, 2006; 47(7): 1378 - 1385. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Duez, B. Lamarche, K. D. Uffelman, R. Valero, J. S. Cohn, and G. F. Lewis Hyperinsulinemia Is Associated With Increased Production Rate of Intestinal Apolipoprotein B-48-Containing Lipoproteins in Humans Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1357 - 1363. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Beekman, G. J. Blauw, J. J. Houwing-Duistermaat, B. W. Brandt, R. G. J. Westendorp, and P. E. Slagboom Chromosome 4q25, microsomal transfer protein gene, and human longevity: novel data and a meta-analysis of association studies. J. Gerontol. A Biol. Sci. Med. Sci., April 1, 2006; 61(4): 355 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lundahl, C. Skoglund-Andersson, M. Caslake, D. Bedford, P. Stewart, A. Hamsten, C. J. Packard, and F. Karpe Microsomal triglyceride transfer protein -493T variant reduces IDL plus LDL apoB production and the plasma concentration of large LDL particles Am J Physiol Endocrinol Metab, April 1, 2006; 290(4): E739 - E745. [Abstract] [Full Text] [PDF] |
||||
![]() |
M M Richardson, E E Powell, H D Barrie, A D Clouston, D M Purdie, and J R Jonsson A combination of genetic polymorphisms increases the risk of progressive disease in chronic hepatitis C J. Med. Genet., July 1, 2005; 42(7): e45 - e45. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nebel, P. J. P. Croucher, R. Stiegeler, S. Nikolaus, M. Krawczak, and S. Schreiber No association between microsomal triglyceride transfer protein (MTP) haplotype and longevity in humans PNAS, May 31, 2005; 102(22): 7906 - 7909. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sheena, R. Hertz, J. Nousbeck, I. Berman, J. Magenheim, and J. Bar-Tana Transcriptional regulation of human microsomal triglyceride transfer protein by hepatocyte nuclear factor-4{alpha} J. Lipid Res., February 1, 2005; 46(2): 328 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Stan, M. Lambert, E. Delvin, G. Paradis, J. O'Loughlin, J. A. Hanley, and E. Levy Intestinal fatty acid binding protein and microsomal triglyceride transfer protein polymorphisms in French-Canadian youth J. Lipid Res., February 1, 2005; 46(2): 320 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Sposito, S. Gonbert, G. Turpin, M. J. Chapman, and J. Thillet Common Polymorphism in the MTP Promoter Attenuates the Dyslipidemic and Proatherogenic Effects of Excess Body Weight Arterioscler Thromb Vasc Biol, August 1, 2004; 24(8): e143 - e143. [Full Text] [PDF] |
||||
![]() |
M. A Pereira, R. M Weggemans, D. R Jacobs Jr, P. J Hannan, P. L Zock, J. M Ordovas, and M. B Katan Within-person variation in serum lipids: implications for clinical trials Int. J. Epidemiol., June 1, 2004; 33(3): 534 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ledmyr, A. D. McMahon, E. Ehrenborg, L. B. Nielsen, M. Neville, H. Lithell, P. W. MacFarlane, C. J. Packard, F. Karpe, and on behalf of the WOSCOPS executive; The Microsomal Triglyceride Transfer Protein Gene-493T Variant Lowers Cholesterol But Increases the Risk of Coronary Heart Disease Circulation, May 18, 2004; 109(19): 2279 - 2284. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Phillips, K. Mullan, D. Owens, and G.H. Tomkin Microsomal triglyceride transfer protein polymorphisms and lipoprotein levels in type 2 diabetes QJM, April 1, 2004; 97(4): 211 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Geesaman, E. Benson, S. J. Brewster, L. M. Kunkel, H. Blanche, G. Thomas, T. T. Perls, M. J. Daly, and A. A. Puca Haplotype-based identification of a microsomal transfer protein marker associated with the human lifespan PNAS, November 25, 2003; 100(24): 14115 - 14120. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kang, N. J. Spann, T. Y. Hui, and R. A. Davis ARP-1/COUP-TF II Determines Hepatoma Phenotype by Acting as Both a Transcriptional Repressor of Microsomal Triglyceride Transfer Protein and an Inducer of CYP7A1 J. Biol. Chem., August 15, 2003; 278(33): 30478 - 30486. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. H. Juo, L. Colangelo, Z. Han, J. D. Smith, and K. Liu Confirmation of the Microsomal Triglyceride Transfer Protein Genetic Effect on Lipids in Young African American Men From the CARDIA Study Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 912 - 913. [Full Text] [PDF] |
||||
![]() |
E. D. Bartels, M. Lauritsen, and L. B. Nielsen Hepatic Expression of Microsomal Triglyceride Transfer Protein and In Vivo Secretion of Triglyceride-Rich Lipoproteins Are Increased in Obese Diabetic Mice Diabetes, April 1, 2002; 51(4): 1233 - 1239. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lundahl, A. Hamsten, and F. Karpe Postprandial Plasma ApoB-48 Levels Are Influenced by a Polymorphism in the Promoter of the Microsomal Triglyceride Transfer Protein Gene Arterioscler Thromb Vasc Biol, February 1, 2002; 22(2): 289 - 293. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ledmyr, F. Karpe, B. Lundahl, M. McKinnon, C. Skoglund-Andersson, and E. Ehrenborg Variants of the microsomal triglyceride transfer protein gene are associated with plasma cholesterol levels and body mass index J. Lipid Res., January 1, 2002; 43(1): 51 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
Bjorn Lundahl, T. P. Leren, L. Ose, A. Hamsten, and F. Karpe A Functional Polymorphism in the Promoter Region of the Microsomal Triglyceride Transfer Protein (MTP -493G/T) Influences Lipoprotein Phenotype in Familial Hypercholesterolemia Arterioscler Thromb Vasc Biol, July 1, 2000; 20(7): 1784 - 1788. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. H. Juo, Z. Han, J. D. Smith, L. Colangelo, and K. Liu Common Polymorphism in Promoter of Microsomal Triglyceride Transfer Protein Gene Influences Cholesterol, ApoB, and Triglyceride Levels in Young African American Men : Results From the Coronary Artery Risk Development in Young Adults (CARDIA) Study Arterioscler Thromb Vasc Biol, May 1, 2000; 20(5): 1316 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Watts, F. M. Riches, S. E. Humphries, P. J. Talmud, and F. M. van Bockxmeer Genotypic associations of the hepatic secretion of VLDL apolipoprotein B-100 in obesity J. Lipid Res., March 1, 2000; 41(3): 481 - 488. [Abstract] [Full Text] |
||||
![]() |
E. Voyiaziakis, C. Ko, S. M. O'Rourke, and L.-S. Huang Genetic control of hepatic apoB-100 secretion in human apoB transgenic mouse strains J. Lipid Res., November 1, 1999; 40(11): 2004 - 2012. [Abstract] [Full Text] |
||||
![]() |
P. Couture, J. D. Otvos, L. A. Cupples, P. W. F. Wilson, E. J. Schaefer, and J. M. Ordovas Association of the A-204C polymorphism in the cholesterol 7{alpha}-hydroxylase gene with variations in plasma low density lipoprotein cholesterol levels in the Framingham Offspring Study J. Lipid Res., October 1, 1999; 40(10): 1883 - 1889. [Abstract] [Full Text] |
||||
![]() |
D. L. Rainwater, L. Almasy, J. Blangero, S. A. Cole, J. L. VandeBerg, J. W. MacCluer, and J. E. Hixson A Genome Search Identifies Major Quantitative Trait Loci on Human Chromosomes 3 and 4 That Influence Cholesterol Concentrations in Small LDL Particles Arterioscler Thromb Vasc Biol, March 1, 1999; 19(3): 777 - 783. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |