Binding of Human Urokinase-Type Plasminogen Activator to Its Receptor

Residues Involved in Species Specificity and Binding

From the Gaubius Laboratory, TNO-PG, Leiden, the Netherlands (P.H.A.Q., J.M.G., M.L., A.H.F.B., V.W.M. van H., J.H.V.); the Department of Pathology, Centre Medical Universitaire, Geneva, Switzerland (M.-C.B., D.B.); and the Institute for Cardiovascular Research, Free University Amsterdam, Amsterdam, the Netherlands (V.W.M. van H.).

Correspondence to Dr P.H.A. Quax, Gaubius Laboratory, TNO-PG, PO Box 2215, 2301 CE Leiden, the Netherlands. E-mail PHA.Quax{at}pg.tno.nl

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Urokinase-type plasminogen activator (UPA), particularly when bound to its receptor (UPAR), is thought to play a major role in local proteolytic processes, thus facilitating cell migration as may occur during angiogenesis, neointima and atherosclerotic plaque formation, and tumor cell invasion. To facilitate understanding of the need and function of the UPA/UPAR interaction in cell migration and vascular remodeling, we changed several amino acid residues in UPA so as to interfere with its interaction with its receptor. The receptor-binding domain of UPA has been localized to a region in the growth factor domain between residues 20 and 32. Since the binding of UPA to UPAR appears to be species specific, we used the differences in amino acid sequences in the growth factor domain of UPA between various species to construct a human UPA variant that does not bind to the human UPAR. We substituted Asn22 for its mouse equivalent Tyr by site-directed mutagenesis. This mutant UPA had similar plasminogen activator characteristics as wild-type UPA, including its specific activity and interaction with plasminogen activator inhibitor-1. However, no UPA/UPAR complexes could be observed in cross-linking experiments using DFP-treated ¹²⁵I-labeled mutant UPA and lysates of various cells, including U937 histiocytic lymphoma cells, phorbol myristate acetate—treated human ECs, and mouse LB6 cells transfected with human UPAR cDNA. In direct binding experiments, DFP-treated¹²⁵I-labeled mutant UPA could not bind to phorbol myristate acetate–treated ECs, whereas wild-type UPA did bind. Furthermore, a 25-fold excess of wild-type UPA completely prevented the binding of DFP-treated ¹²⁵I-labeled wild-type UPA to the human receptor on transfected LB6 cells, whereas an equal amount of mutant UPA had only a very small effect. In ligand blotting assays, very weak binding of mutant UPA to human UPAR could be observed. Changing Asn22 into the other amino acid residues alanine or glutamine had no effect on binding to UPAR on human ECs. The functional integrity of the growth factor domain in the non–receptor binding Asn22Tyr mutant is suggested by the fact that binding of this mutant to a murine UPAR can be restored after additional mutations in the growth factor domain, Asn27,His29,Trp30 to Arg27,Arg29,Arg30. We conclude that Asn22 and Asn27,His29,Trp30 in human UPA are key determinants in the species-specific binding of the enzyme to its receptor and that changing Asn22 into Tyr results in a UPA mutant with strongly reduced binding to UPAR.

Key Words: urokinase-type plasminogen activator • urokinase-type plasminogen activator receptor • site-directed mutagenesis

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Limited proteolytic degradation of the surrounding extracellular matrix is an important step in cell migration during tissue remodeling and invasion. Several proteolytic systems are thought to play a role in these processes, including the plasminogen activation system and the matrix metalloproteinases. At least two distinct plasminogen activators have been described in eukaryotic cells: tissue-type plasminogen activator and UPA. UPA is thought to play a major role in local pericellular proteolysis, since it can bind to a specific cell surface receptor, the UPAR.^{1 2 3} The human UPAR has been cloned.⁴ It has a molecular weight of 55 to 65 kDa⁵ and its structure is related to that of members of the Ly-6 superfamily. UPAR consists of three internally homologous domains of 90 amino acids each, with a characteristic pattern of Cys residues.⁶ UPAR is linked to the cell membrane via a glycosylphosphatidylinositol anchor attached to the C-terminal hydrophobic domain.⁷ Although it is not yet known exactly which structural elements of UPAR participate in the interaction with UPA, it is clear that the NH₂-terminal domain I of UPAR has a primary role in this binding. However, interaction with the other two domains, II and III, is required for high-affinity binding of UPA.⁸ UPA can bind to the UPAR in either its inactive proenzyme form (pro-UPA) or active two-chain form without affecting its proteolytic activity.⁹ Binding of UPA to its receptor localizes the proteolytic activity to the cell surface. Moreover, the UPA activity may be focused at specific areas of the cell surface due to polarized expression of the UPAR.^{10 11} In addition, it has been reported that UPA, by binding of UPA or its fragments to the UPAR, is involved in cell signaling pathways^{12 13 14} and cellular adhesion.^{15 16}

Binding of UPA to its receptor and subsequent UPA-mediated pericellular proteolysis are involved in many process in which cell migration occurs, including tumor cell invasion,¹ monocyte infiltration,¹¹ and migration of vascular cells in arterial remodeling.¹⁷ In vitro studies have shown that migration of smooth muscle cells can be reduced by inhibition of plasminogen activation,¹⁸ by inhibition of UPA activity, and by interfering with the binding of UPA to its receptor.¹⁹ On migrating vascular smooth muscle cells, UPARs are polarized after injury in vitro.²⁰ Also, in other vascular cells, ie, monocytes^{11 21} and ECs,^{22 23 24} migration and invasion into fibrin require UPA and UPAR. The increased expression of UPA and UPAR in human atherosclerotic plaque^{25 26 27} and in arterial aneurysms²⁸ adds to the suggestion that UPA activity may also be involved in vascular remodeling in vivo. This suggestion is further strengthened by the observation that in UPA-deficient mice, intimal thickening after vascular trauma is markedly reduced.²⁹ Mice deficient in UPAR, however, do not show reduced neointima formation after vascular trauma,³⁰ in contrast to what was anticipated on the basis of experiments with cultured smooth muscle cells^{19 20} and ECs^{22 23 24} and on the observation that in peritoneal macrophages derived from UPAR-deficient mice, the normally occurring stimulation of plasminogen activation at the cell surface^{31 32} does not occur.³³ These phenomena indicate once more that the role and function of the UPA/UPAR interaction in vascular remodeling are not fully understood and need further analysis.

UPA consists of three distinct domains: a region with homology to EGF (referred to as the growth factor domain), a kringle domain, and the serine protease domain. Binding of UPA to the UPAR is mediated by its growth factor domain. Synthetic peptides of human UPA (residues 12 to 32) block the binding of UPA to its receptor. EGF itself, however, does not inhibit UPA binding, suggesting that the region with the highest homology between UPA and EGF, ie, residues 13 to 19 of human UPA, is not directly involved in the binding of UPA to UPAR.³⁴ This region is thought to be essential for the proper conformation and folding of the EGF-like domains.³⁵ In the EGF-like domains, the ligand binding sites are usually located in the region corresponding to residues 20 to 30 in UPA, which shares only little homology between the various proteins. The ligand-binding site in EGF itself³⁶ and in tissue-type plasminogen activator³⁷ and UPA^{8 34 38} has been located within this region. The three-dimensional protein structure of the amino-terminal fragment of UPA has been determined.³⁹ Further analysis of the sites of interaction between the growth factor domain of UPA and the UPAR revealed an important role for amino acid residues Tyr24, Phe25, and Trp30 in its binding to the UPAR.^{8 38} The binding of UPA to its receptor is rather species specific, since human UPA cannot bind to mouse UPAR and vice versa.⁴⁰ Moreover, comparison of the species-specific binding of UPA to UPAR with the amino acid sequence of the presumed binding sites in mouse, pig, and human UPA reveals that this species specificity must be mediated by very minor differences in amino acid sequence, most likely at positions 22, 27, 29, and 30, which are structurally close to each other³⁹ and wherein human and murine UPA have different amino acid residues.

To facilitate understanding of the need and function of the UPA interaction with its receptor in cell migration and vascular remodeling, we constructed a UPA mutant that lacked the capacity to bind to the UPAR but had a minimally changed structural conformation. In this study, we then analyzed the contribution of amino acid residues at position 22 in UPA to the interaction with UPAR.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cell Culture
Mouse LB6 cells transfected with the human UPAR under control of the simian virus 40 promoter and expressing human UPAR at their surface have already been described; these were designated clone 19⁴ and were kindly provided by Dr F. Blasi (Dept. of Molecular Genetics, DIBIT, Milan, Italy). ECs from HUVs and aortas were isolated by the method of Jaffe et al⁴¹ and characterized as described before.⁴² Mouse resident peritoneal macrophages were collected from BALB/c mice as described.⁴⁰ CHO cells⁴³ and the human cell lines WISH,⁴⁴ HeLa (cervix carcinoma),⁴⁰ U937 (histiocytic lymphoma),⁴⁵ HT29 (colon carcinoma),⁴⁵ HT1080 (fibrosarcoma),⁴⁵ and BLM (melanoma)⁴⁶ have been described previously. The human osteosarcoma cell line Saos2.M1 was kindly provided by Dr C. Löwik (Dept of Endocrinology, Leiden University Medical Center, Leiden, the Netherlands). A murine endothelioma cell line derived from UPA-deficient mice⁴⁷ was kindly provided by Dr E. Wagner (Research Institute of Molecular Pathology, University of Vienna, Vienna, Austria).

All cell lines were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (vol/vol) heat-inactivated fetal calf serum, 2 mmol/L glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. LB6 clone 19 and transfected CHO cells were cultured in medium containing 0.8 and 1.0 g/L geneticin, respectively. The ECs were grown on fibronectin-coated tissue culture dishes in medium 199, supplemented with 10% (vol/vol) human serum, 10% (vol/vol) heat-inactivated newborn calf serum, 5 U/mL heparin, 2 mmol/L glutamine, 150 µg/mL crude EC growth factor, 100 U/mL penicillin, and 100 µg/mL streptomycin. All cells were grown at 37°C in a humid atmosphere with 5% (vol/vol) CO₂.

Production of Various Mouse UPA Mutants
Mutations were introduced by oligonucleotide-directed mutagenesis using subclones of murine UPA⁴⁸ in uracil-substituted M13.⁴⁹ The oligonucleotides used for the Tyr23 mutation, 5'-GGTGTATGCGT GTCGAACAAGTACTTCTCCA, also introduced a "silent" substitution in the adjacent Ser codon, thereby creating a new TaqI site. The oligonucleotide used to generate a triple mutation in murine UPA changing Arg 27,29,30 into Asn27,His29,Trp30 was 5'-CAAGTACTTCTCCAACATTCACTGGTGCAGC. The resulting mutant lost the EcoRI site at position 203 of murine UPA. The mutants were identified by restriction analysis and confirmed by sequencing the entire inserts, which were then reintroduced in the murine expression vector pSPHSneo.⁵⁰ Transfection of WISH cells, which do not produce detectable amounts of plasminogen activators or their inhibitors, selection of UPA-producing clones, and analysis of the conditioned media were performed as described.⁴⁴

Binding of Wild-Type and Mutant Murine UPA to Human and Murine Cells
Mouse resident macrophages and human HeLa cells were seeded at low density and incubated with culture media from transfected WISH cells containing the various UPA proteins at 0.6 U/mL (1 nmol/L), and cell-associated activity was revealed by the single-cell proteolytic plaque assay as described before.⁴⁰

Construction of Human UPA Expression Plasmid
The complete protein-coding region of human UPA cDNA was isolated from polyA⁺ mRNA from the UPA-producing fibrosarcoma cell line HT1080⁴⁵ by reverse transcriptase and PCR. The oligonucleotides 5'-TAGCGCCCCGGGCTCGCCACCAT and 5'-ACGGGTCTGGGGAGACCGGT were used as primers to amplify a cDNA fragment spanning nucleotides 99 to 1620 in human UPA cDNA. This fragment was cloned into the eukaryotic expression plasmid pEV2tPA⁵¹ by replacing the tissue-type plasminogen activator cDNA fragment. To accomplish this task, pEV2tPA was digested with BglII, and the UPA cDNA fragment was cloned into the pEV2 vector using the specific linker oligonucleotides 5'-AGCTTCCCGGGAGGCCTGTCGACA and 5'-GATCTGTCGACAGGCCTCCCGGGA. The DNA sequence of the UPA cDNA cloned into plasmid pEV2UK1.1 was determined by using the T7 DNA polymerase sequence system (Promega) according to the chain-termination procedure of Sanger et al.⁵²

Site-Directed Mutagenesis of Human UPA by Recombinant PCR
Construction of Human Asn22Tyr UPA

The UPA molecule was site-specific mutated according to the recombinant circle PCR method as described by Jones and Howard.⁵³ The primers used to introduce the mutation UPA Asn22Tyr into the expression plasmid of UPA (pEV2UK1.1) were 5'-CATGTGTGTC CTACAAATACTTCTCCAACA (UK.1, top strand; positions 229 to 258 of human UPA cDNA), 5'-TTTAGACAGTCACAGTTCGA (UK.2, bottom strand; positions 201 to 220), 5'-AGAAGTATTTG TAGGACACACATGTTCCTC (UK.3, bottom strand; positions 223 to 252), and 5'-CGGAGGGCAGCACTGTGAAA (UK.4, top strand; positions 287 to 306). The italicized nucleotides are the mutations to be introduced. The AAC-to-TAC mutation (position 240 of the UPA cDNA) changes the Asn at position 22 in UPA into a Tyr, whereas changing AAG to AAA at position 245 does not affect the amino acid sequence but leads to the loss of an ScaI site and simplifies screening. Twenty cycles of the PCR were performed with a Perkin Elmer–Cetus DNA thermal amplifier. To produce the mutant plasmid, equimolar amounts of the different linear PCR products were denatured at 100°C and reannealed in 10 mmol/L Tris-HCl, 1 mmol/L EDTA, and 100 mmol/L NaCl, pH 8.0, by gradually lowering the temperature to 55°C in 2 hours. Escherichia coli JM109 was transformed with the reaction products by using the PEG/DMSO method.⁵⁴ The loss of an ScaI restriction site in the mutant plasmid was used for screening.

To verify the presence of the mutation at position 22 of human UPA (from Asn to Tyr) and the absence of other mutations, the DNA sequence coding for the complete growth factor domain of the mutant plasmid was determined by using the T7 DNA polymerase sequence system (Promega) according to the dideoxy chain-termination procedure of Sanger et al.⁵²

Construction of Additional Mutants of Human UPA
The mutations Asn22Ala, Asn22Gln, Asn27Arg,His29Arg, Trp30Arg, and Asn22Tyr,Asn27Arg,His29Arg,Trp30Arg were introduced in the pEV2UK1.1 expression plasmid by using a so-called inverse PCR procedure in which the complete expression plasmid pEV2UK1.1 is amplified by using primers carrying the specific mutations. The primers used to introduce the Asn22Ala mutation were 5' GAGAAGTACTTGGCGGACAC-3' (positions 252 to 234, bottom strand) and 5'-CAACATTCACTGGTGCAAC-3' (positions 253 to 271, top strand). The Asn22Gln mutation was introduced by using the primers 5'-GAGAAGTACTTTTGGGACAC-3' (positions 252 to 234, bottom strand) and 5'-CAACATTCACTGGTGCAAC-3' (positions 253 to 271, top strand). The mutations Asn27Arg,His29Arg,Trp30Arg, and Asn22Tyr,Asn27Arg,His29Arg,Trp30Arg were introduced in both wild-type pEV2UK1.1 and Asn22Tyr mutated pEV2UK1.1 by using the primers 5'-GTTGCACCGGCGAATGCGGGAGAAG-3' (positions 271 to 241, bottom strand) and 5'-TGCCCAAAGAAATTCGGAG-3' (positions 272 to 291, top strand). After PCR (Expand Long Template, Boehringer Mannheim), the products were ligated and JM109 was transformed with the reaction products as described above. The presence of the mutations was verified by sequencing of the growth factor domain as described above.

Transfection of CHO Cells With Mutant Human UPA
CHO cells were transfected with the mutant plasmid by calcium phosphate coprecipitation as previously described,^{55 56} with 20 µg/mL plasmid DNA and 2 µg/mL pSV2neo, a plasmid containing the neomycin resistance gene under control of a simian virus promoter. After transfection, the cells were incubated in medium containing geneticin (1 g/L) to select for transfected cells. Transformed neomycin-resistant cell lines were tested for their UPA production with a UPA ELISA or fibrin zymography.

Purification of Mutant Human UPA
A transfected CHO cell line with high mutant UPA production was selected and grown in Dulbecco's modified Eagle's medium in a roller bottle. Mutant UPA was collected in serum-free medium for 48 hours; this step was repeated several times. The mutant UPA was purified from conditioned media by immunoaffinity chromatography as described previously,⁵⁶ with a 500-µL aliquot of anti-human UPA monoclonal antibody (1 mg/mL in PBS) coupled to Sepharose (No. 396, American Diagnostica Inc, kindly provided by Dr R. Hart).

UPA ELISA and UPA Activity Assay
Antigen levels of mutant UPA were determined with a sandwich ELISA.⁵⁷ The activity of the purified mutant UPA was determined with a spectrophotometric assay using the chromogenic substrate S-2444 (Chromogenix). In brief, a 1000-fold dilution of purified mutant UPA was converted to the active two-chain form by activation with 0.2 µmol/L plasmin for 1 hour at 37°C. In a final volume of 250 µL, 0.1 mol/L Tris, 0.01% (vol/vol) Tween-80, pH 7.4, 50 µL activated sample, 100 U/mL aprotinin, and 0.4 mmol/L S-2444 were mixed. The samples were incubated at 37°C and at regular intervals, the absorbance at 405 nm was measured. Plasminogen activation activity was determined by calculating the change in absorbance with incubation time. Activities were converted into IU of UPA by using a reference line prepared with a standard preparation of UPA (a specific activity of 1x10⁵ IU/mg UPA was assumed, World Health Organization preparation c66/46⁵⁸ ). A spectrophotometric assay with the chromogenic substrate S-2251 and plasminogen as described⁵⁹ was used to measure UPA activity.

Radiolabeling of UPA and UPA/UPAR Cross-linking
DFP-treated wild-type UPA (Ukidan) or DFP-treated mutant UPA was radiolabeled with Na¹²⁵I according to the IodoGen procedure (Pierce Chemical Co). Binding of mutant UPA to the receptor was determined by incubating 0.4 ng of ¹²⁵I-labeled mutant UPA or¹²⁵I-labeled wild-type UPA (as a control) with extracts of several different cell lines in 35 µL PBS and 0.1% (vol/vol) Tween-80 by cross-linking with disuccinimidyl octanedioate (DSO) as described.⁵

Western Blotting
For nonradioactive analysis of UPA/UPAR complexes, 10 µL of extracts of LB6 clone 19 cells was incubated with 0.1 µg/mL DFP-treated wild-type or mutant UPA for 1 hour at 4°C. Samples were cross-linked with DSO as described above. Samples were subjected to SDS-PAGE and subsequently blotted to a nitrocellulose membrane in 25 mmol/L Tris, 200 mmol/L glycine, 1% (vol/vol) SDS, and 20% (vol/vol) methanol by using a semi-dry blotting device (Pharmacia). The membrane was incubated overnight in 20% (wt/vol) nonfat dry milk in PBS. UPA was visualized by the use of rabbit anti-human UPA polyclonal antibodies⁵⁷ and a BM chemoluminescence western blot kit (Boehringer Mannheim) according to the manufacturer's protocol.

For ligand blotting, cell extracts of LB6 clone 19 HUVECs or murine endothelioma cells incubated with medium supplemented with 10 nmol/L PMA for 18 hours, were subjected to SDS-PAGE electrophoresis and blotted to a nitrocellulose membrane as described. The membranes were incubated with 4 nmol/L wild-type or mutant UPA in 1% (wk/v) nonfat dry milk in PBS for 2 hours at room temperature. The bound UPA was visualized after incubation with rabbit anti-human UPA polyclonal antibodies⁵⁷ and a BM chemoluminescence western blot kit as described above.

UPA Binding Assay
The binding of wild-type UPA or Asn22Tyr UPA to ECs (HUVECs) was determined. Before the start of the experiment, the cells were incubated with medium supplemented with 10 nmol/L PMA for 18 hours to increase UPAR expression.⁶⁰ Before binding analysis, the cells were treated with 50 mmol/L glycine-HCl buffer (pH 3.0) for 10 minutes to remove endogenous UPA. Subsequently the cells were washed twice with ice-cold medium and incubated with increasing concentrations (0.5 to 16 nmol/L) of ¹²⁵I-labeled DFP-treated UPA or mutant UPA in EC-conditioned medium for 3 hours on ice. Incubation was performed in EC-conditioned medium to exclude the binding of UPA to cell-associated PAI. In parallel incubations, a 25-fold excess of unlabeled UPA was included to assess nonspecific binding. Unbound ligand was removed by extensive washing with 0.03% (wk/v) human serum albumin in PBS. Cell-bound ligand was solubilized with 0.3 mol/L NaOH, and the radioactivity was determined. Specific binding was calculated by subtracting nonspecific binding from total binding.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Sequence Comparison of the UPAR Binding Domain of Human, Mouse, and Porcine UPA
Sequence comparison of the UPAR binding domain of human, mouse, and porcine UPA (amino acids 12 to 32, Table 1) reveals that eight amino acids are not conserved between the different species (ie, 12, 14, 18, 22, 27, 29, 30, and 32). The binding of UPA to its receptor is species specific. Estreicher et al⁴⁰ have studied this species specificity for human, porcine, and mouse UPA by using human HeLa cells, murine peritoneal macrophages, and porcine kidney–derived LLC-PK₁ cells. Human UPA can bind to both human and porcine cells. Mouse UPA can bind to murine and porcine cells. Porcine UPA, however, can bind to mouse and porcine cells only and not to human cells. This finding indicates that the nonconserved amino acid residues, which differ between the mouse and the pig (ie, 14, 18, 27, and 29) are most likely not involved in the species specificity of binding. The residues that are identical between mice and pigs but differ from human UPA (ie, 12, 22, 30, and 32) may determine why porcine and murine UPA cannot bind to the human UPAR. By using competing peptides based on the sequence of EGF, Appella et al³⁴ have demonstrated that region 12 to 19 of UPA, which shares the highest homology with EGF, is not involved in UPAR binding. This leaves three residues in region 20 to 32 in human UPA as candidates for mutation: Asn22, Trp30, and Asn32, to construct a nonreceptor-binding UPA that most likely will be without major structural changes in the growth factor domain.

Binding of Mouse UPA Mutants to Murine and Human Cells
Binding of mouse UPA mutants to murine resident macrophages and human HeLa cells was used to further analyze the residues involved in UPAR binding. For mouse UPA, a change of Tyr22 to the human equivalent Asn (N-RRR mUPA) resulted in a severe reduction of binding to mouse UPAR on mouse macrophages (Fig 1) without gaining the capacity to bind to human UPAR on human HeLa cells, whereas the triple mutation Arg27,Arg29,Arg30 to the human equivalents Asn,His,Trp (Y-NHW mUPA) abolished binding to both mouse and human UPAR (Fig 1). Wild-type mouse UPA did not bind to human cells and wild-type human UPA as well as mutant UPA containing all human equivalents, ie, Asn22,Asn27,His29,Trp30 (N-NHW mUPA), did not bind to the murine cells. These data show that the combination of the (murine) Tyr residue at position 22 with the (human) Asn, His, and Trp residues at positions 27, 29, and 30 results in a UPA molecule that binds to neither mouse nor human UPAR. By combining these data, it appears that changing Asn22 to Tyr in human UPA is the most promising approach to construct a nonreceptor-binding human UPA.

View larger version (88K): [in this window] [in a new window]   Figure 1. Binding of wild-type and mutant murine UPA to human and murine cells. Mouse resident macrophages (mouse cells) and human HeLa cells (human cells) were seeded at low density and incubated with culture media containing the various UPA proteins at 0.6 u/mL (1 nmol/L for murine UPA and 0.1 nmol/L for human UPA due to differences in specific activity) as described, and cell-associated activity was revealed by the single-cell proteolytic assay.40 - Indicates no additives; mUPA, wild-type murine UPA; hUPA, wild-type human UPA; Y-NHW mUPA, triple mutation in murine UPA changing Arg27,29,30 to Asn27,His29,Trp30, which prevents binding to both human and murine cells; N-RRR mUPA, single Tyr22 to Asn mutation, which severely decreases binding to murine cells without allowing binding to the human UPAR; and N-NHW mUPA, quadruple mutation, which confers binding to the human UPAR.

Production, Purification, and Characterization of Human Asn22Tyr UPA
The Asn22Tyr UPA plasmid was transfected into CHO cells by the calcium phosphate precipitation method. Geneticin-resistant clones were isolated and UPA production analyzed by ELISA. The clone producing the highest amounts of Asn22Tyr UPA was subsequently cultured in roller bottle cultures and produced 7 µg UPA/mL in 48 hours. This Asn22Tyr UPA was isolated from the medium with affinity chromatography by using immobilized monoclonal antibodies against human UPA.

The molecular characteristics of the Asn22Tyr UPA were analyzed and compared with wild-type UPA (Ukidan). The change of amino acid 22 from Asn to Tyr did not affect the proteolytic activity or the electrophoretic mobility in SDS-PAGE gels, since both wild-type and Asn22Tyr UPA showed lysis zones at similar positions in zymography experiments after SDS-PAGE (data not shown). Quantitative analysis of Asn22Tyr UPA revealed a specific activity, calculated as enzyme activity per amount of UPA, of 0.7±0.1 IU/10 ng. The specific activity for the international standard UPA (World Health Organization preparation c66/46) is defined as 1 IU/10 ng.

Analysis of the interaction with PAI-1 showed that PAI-1 was able to inhibit wild-type and mutant UPA at identical rates. The inhibition rate constant was calculated from the time course of inhibition of wild-type UPA and plasmin-activated mutant UPA by PAI-1 at equal molar concentrations of enzyme and inhibitor.⁶¹ The k values for inhibition of UPA were calculated from the slopes ([E₀]xk) of the curves and were 3.3±0.4x10⁶ mol · L^-1 · s^-1 and 3.2±0.1x10⁶ mol · L^-1 · s^-1 for wild-type and mutant UPA, respectively.

Binding Characteristics of Human Asn22Tyr UPA
Lysates of different cells, known to express UPAR, were incubated with comparable amounts of DFP-treated ¹²⁵I-labeled wild-type UPA and Asn22Tyr UPA. Incubation of ¹²⁵I-labeled DFP-treated Asn22Tyr UPA did not result in formation of UPA/UPAR complexes in any of the cell lines after cross-linking. After incubation with DFP-treated ¹²⁵I-labeled wild-type UPA, UPA/UPAR complexes were detectable in all cell lines except the osteosarcoma cell line Saos2.M1, although the intensity of the signal differed in the various cell lines (Fig 2). The most prominent complex band could be observed in LB6 clone 19, a mouse cell line in which human UPAR cDNA is cloned, and BLM- and PMA-treated human aorta endothelial cells. These results indicate that the mutated UPA is no longer able to form stable complexes with human UPAR.

View larger version (63K): [in this window] [in a new window]   Figure 2. Binding of DFP-treated 125I-labeled Asn22Tyr or wild-type human UPA to cell lysates of different cell lines. Lysates of 2.5x104 cells were incubated with 0.4 ng of DFP-treated 125I-labeled Asn22Tyr UPA (right panel) or wild-type (wt) UPA (left panel) and after chemical cross-linking, were separated by SDS-PAGE. Specific activity of 125I-labeled wild-type UPA was somewhat higher than that of 125I-labeled Asn22Tyr UPA, as shown in the reduced amount of labeled free ligand in the right panel. The 125I–UPA/UPAR complexes were visualized by autoradiography. As a control, DFP-treated 125I-labeled UPA was incubated with PBS in the absence of a cell lysate.

Human UPA Binding to ECs
Quantitative analysis of the binding of wild-type or Asn22Tyr UPA to PMA-treated HUVECs demonstrated that Asn22Tyr UPA was not able to bind to HUVECs, even at concentrations of 16 nmol/L, whereas wild-type UPA could bind in a specific way. The binding parameters indicate 5.5x10⁵ binding sites per cell and a K_d=1.0 nmol/L (Fig 3).

View larger version (16K): [in this window] [in a new window]   Figure 3. Specific binding of DFP-treated125I-labeled wild-type (wt) and Asn22Tyr UPA to PMA-treated ECs. HUVECs were incubated for 24 hours with 10 nmol/L PMA and then treated with 50 mmol/L glycine-HCl (pH 3.0) buffer for 10 minutes. Subsequently, cells were incubated with increasing concentrations of 125I-labeled wild-type or Asn22Tyr UPA for 3 hours at 0°C in the presence or absence of a 25-fold excess of unlabeled wild-type UPA. Specific binding was determined by subtracting nonspecific binding, as assessed by incubation with a 25-fold excess of wild-type UPA and expressed as mean±SD of triplicate dishes.

Competition of Binding With Unlabeled Asn22Tyr Human UPA
The cross-linking and binding studies were all performed with radiolabeled UPA and Asn22Tyr UPA. The mutation of Asn22 to Tyr introduces an extra Tyr in the binding region of UPA, which might become iodinated during the labeling procedure. To study whether radiolabeling UPA or Asn22Tyr UPA affected the binding characteristics of the molecules, cross-linking experiments were performed in the presence of excess unlabeled wild-type UPA and Asn22Tyr UPA with lysates of LB6 clone 19 cells. Excess unlabeled wild-type UPA completely inhibited binding of¹²⁵I-UPA to UPAR, whereas excess Asn22Tyr UPA prevented this binding only to a small extent (Fig 4).

View larger version (84K): [in this window] [in a new window]   Figure 4. Binding of DFP-treated 125I-labeled wild-type (WT) UPA to cell lysates of LB6 clone 19 in the presence of excess unlabeled wild-type or Asn22Tyr UPA. DFP-treated125I-labeled wild-type UPA (0.4 ng) was incubated with lysates of 2.5x104 LB6 clone 19 cells. Binding was competed with a 25-fold excess of unlabeled wild-type UPA or Asn22Tyr UPA. After chemical cross-linking, the samples were separated by SDS-PAGE, and 125I–UPA/UPAR complexes were visualized by autoradiography.

To study the binding of unlabeled UPA to its receptor, lysates of LB6 clone 19 cells were incubated with unlabeled DFP-treated wild-type UPA or Asn22Tyr UPA (2 nmol/L). After cross-linking, the complexes of UPA and UPAR were analyzed by gel electrophoresis and blotting with anti-UPA antibodies. As shown in Fig 5, no UPA/UPAR complexes were detected when no cross-linking was performed. After cross-linking, the complex between wild-type UPA and UPAR was observed clearly. For Asn22Tyr UPA, hardly any UPA/UPAR complexes were observed. These data confirm that unlabeled Asn22Tyr UPA has a severely impaired binding to UPAR (Fig 5).

View larger version (52K): [in this window] [in a new window]   Figure 5. Binding of unlabeled DFP-treated UPA to its receptor in LB6 clone 19 cell lysates. Lysates of 2x104 LB6 clone 19 cells were incubated with 2 nmol/L DFP-treated Asn22Tyr (left panel) or wild-type (WT) (right panel) UPA for 1 hour at 4°C. After chemical cross-linking and SDS-PAGE, UPA and UPA/UPAR complexes were visualized by Western blotting with antibodies against human UPA (+DSS). Parallel incubations not treated with the cross-linking reagent (-DSS) as well as wild-type or Asn22Tyr UPA incubated in the absence of cell lysates (control) were used to document specificity of the UPA/UPAR complexes. UPA and UPA/UPAR complexes were visible at 55 and 97 kDa, respectively.

Ligand Blotting
In many analyses of UPA binding to its receptor, cross-linking with DSO was crucial to detect the UPA/UPAR complexes. To exclude the possibility that differences in cross-linking behavior between wild-type and Asn22Tyr UPA led to decreased interaction with the receptor, binding of UPA to its receptor was also studied by ligand blotting. Nitrocellulose blots containing lysates of LB6 clone 19 cells were incubated with wild-type or Asn22Tyr UPA. Wild-type UPA could bind specifically to a protein of 50 to 55 kDa, similar to the molecular weight of the UPAR. Only very weak binding of Asn22Tyr UPA could be observed with the highest concentration of cell lysate (Fig 6). This indicates that the impaired binding of Asn22Tyr UPA is not due to the cross-linking procedure.

View larger version (45K): [in this window] [in a new window]   Figure 6. Ligand blotting of DFP-treated UPA to LB6 clone 19 cell lysates. Binding of DFP-treated Asn22Tyr or wild-type (WT) UPA to lysates of LB6 clone 19 was studied directly by ligand blotting. Lysates of LB6 clone 19 cells were separated on SDS-PAGE and blotted on nitrocellulose membranes. Membranes containing increasing amounts of cell lysates (ranging from 10 µL [2x104 cells] to 1 µL [2x103 cells]) were incubated with 4 nmol/L DFP-treated Asn22Tyr UPA (left panel) or wild-type UPA (right panel). UPA was visualized by Western blotting with antibodies against human UPA.

Additional Mutations of Asn22 in Human UPA
The above-mentioned data provide ample evidence that the mutation Asn22Tyr in human UPA results in disturbed binding to the human UPAR. To analyze the specificity of this mutation, the effect of other amino acid residue substitutions at position 22 in human UPA was studied. We made other mutants in which Asn22 was substituted with either Ala or Gln. Subsequently, the binding of these mutants to the UPAR on PMA-treated HUVECs was tested by using ligand blotting. Lysates of PMA-treated HUVECs were blotted to nitrocellulose, and these filters were subsequently incubated with wild-type, Asn22Tyr, Asn22Ala, or Asn22Gln UPA. The mutants Asn22Ala and Asn22Gln could bind to the UPAR on HUVECs in a fashion similar to that of wild-type UPA, in contrast to Asn22Tyr that did not bind to the UPAR on PMA-treated HUVECs (Fig 7).

View larger version (67K): [in this window] [in a new window]   Figure 7. Ligand blotting of various DFP-treated Asn22 mutant forms of UPA to lysates of human ECs. Binding of DFP-treated Asn22 UPA mutants to lysates of PMA-treated (10 nmol/L PMA, 24 hours) HUVECs was studied by ligand blotting. Lysates were separated by SDS-PAGE and blotted onto nitrocellulose membranes. Membranes containing lysates of 2.5x105 PMA-treated HUVECs were incubated with 4 nmol/L DFP-treated wild-type (WT) Asn22Ala (Ala), Asn22Gln (Gln), or Asn22Tyr (Tyr) UPA. Membrane containing PBS with no cell lysate was incubated with wild-type UPA (PBS) as a control. UPA was visualized by Western blotting with antibodies against human UPA.

Conversion of Species-Specific Binding of Human UPA to UPAR
A possible explanation for the disturbed binding of Asn22Tyr UPA might be that by this specific mutation, the conformation of the specific binding domain of UPA was altered or even severely disturbed. To demonstrate that the possible alteration in structural conformation of the growth factor domain of UPA was minimal, additional mutations in both Asn22Tyr and wild-type UPA were made. The amino acid residues Asn27,His29,Trp30 were altered into Arg27,Arg29,Arg30, the murine equivalents.

Binding of the various UPA mutants to the UPAR on PMA-treated human ECs or murine endothelioma cells was analyzed by ligand blotting (Fig 8). Wild-type UPA, Ala22 UPA, and Gln22 UPA could bind to human UPAR but not to murine UPAR. Tyr22 and Arg27,29,30 UPAs could not bind to either human or murine UPAR, whereas Tyr22,Arg27,29,30 UPA bound to the murine UPAR only. These data indicate that the species specificity of binding can be converted by additional mutations in human Asn22Tyr UPA, as also has been shown for murine UPA (Fig 1), suggesting that putative conformational effects of this specific Asn22Tyr mutation can be easily compensated for by additional mutations in the growth factor domain.

View larger version (46K): [in this window] [in a new window]   Figure 8. Ligand blotting of DFP-treated UPA mutants to lysates of human ECs and murine endothelioma cells. Lysates of 2.5x105 PMA-treated (10 nmol/L PMA, 24 hours) HUVECs (H) or murine endothelioma (M) cells were separated by SDS-PAGE and blotted onto nitrocellulose membranes. PBS with no cell lysate was used as a control (P). Filters were incubated with 4 nmol/L DFP-treated human UPA variants: wild-type (WT), Asn22Ala (Ala22), Asn22Gln (Gln22), Asn22Tyr (Tyr22), Asn22Tyr,Asn27Arg,His29Arg,Trp30Arg (Tyr22,Arg27,29,30), and Asn27Arg,His29Arg,Trp30Arg (Arg27,29,30) UPA.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
For analysis of the need and function of the UPA/UPAR interaction in cell migration and tissue remodeling processes, a better understanding of the UPA/UPAR interaction is necessary. Therefore, we made a mutant of human UPA (Asn22Tyr) that had strongly reduced binding to its receptor but was not affected in any other characteristics of UPA.

Analysis of the residues possibly involved in UPAR binding was first performed by using mouse UPA mutants. For mouse UPA, the triple mutation Arg27,Arg29,Arg30 to the human equivalents Asn, His, Trp (Y-NHW mUPA) abolished binding to both mouse and human UPAR (Fig 1). Changing both Tyr22 to Asn and Arg27,Arg29,Arg30 to Asn, His, Trp (N-NHW mUPA) resulted in a mouse UPA that could bind to the human UPAR, indicating that no major conformational changes are introduced by these mutations in the growth factor domain. These data show that the combination of the (murine) Tyr residue at position 22 with the (human) Asn, His, and Trp residues at positions 27, 29, and 30 results in a UPA molecule that binds to neither mouse UPAR nor human UPAR. Therefore, the most likely candidate for mutagenesis in human UPA to create a mutant human UPA that will not bind to the human UPAR is Asn22.

By the use of site-directed mutagenesis, an expression plasmid encoding a human UPA mutant (Asn22Tyr) UPA was constructed. The mutant UPA was produced in CHO cells, and we demonstrated that the Asn22Tyr mutation introduced in UPA did not affect its properties as a plasminogen activator.

No binding of radiolabeled DFP-treated Asn22Tyr UPA to cells or cell extracts could be observed using cross-linking analysis and direct cell-binding assays. Although these data suggest that the Asn at position 22 plays a crucial role in the binding of human UPA to its receptor, the possibility could not be excluded that the reduced binding of Asn22Tyr UPA was due to specific radiolabeling of the newly introduced Tyr22 in Asn22Tyr UPA. Therefore, experiments were performed in which the binding of wild-type UPA to its receptor was competed with an excess of unlabeled wild-type or Asn22Tyr UPA. From these experiments, it can be concluded that unlabeled Asn22Tyr UPA has severely impaired binding to UPAR. However, binding of Asn22Tyr UPA to UPAR may not be completely absent, since it was found that excess mutant UPA slightly inhibited binding (Fig 5). Mutant UPA was found to bind very weakly to lysates of LB6 clone 19 cells, blotted onto nitrocellulose, whereas wild-type UPA bound very strongly to these lysates. From these data, is not clear whether it is crucial for the binding to human UPAR to have an Asn residue at position 22 or not to have a Tyr residue at this position. For that reason, Asn22 in human UPA was substituted by an Ala or Gln residue. These mutant forms of UPA had normal binding characteristics for human UPAR (Fig 7), which indicates that the observed disturbed binding in Asn22Tyr UPA was due to the specific presence of a Tyr residue at position 22.

Putative major conformational effects of the presence of a Tyr residue at position 22 in the growth factor domain of human UPA were excluded by conversion of the species specificity of the human Asn22Tyr UPA mutant by additional mutations at residues Asn27, His29, and Trp30. After substitution of these residues by their murine counterparts Arg27,29,30, Asn22Tyr UPA could bind to the murine UPAR (Fig 8). In a similar way, the species specificity of UPAR binding of murine UPA was converted to human UPAR by mutation of Tyr22Asn in combination with Arg27,AsnArg29,HisArg30,Trp. This shows that putative conformational changes introduced in the growth factor domain by the presence of a Tyr residue at position 22 can readily be compensated for by additional changes in the growth factor domain. This indicates that the conformation is not severely disturbed by the introduction of a Tyr residue at position 22 of human UPA.

The mutants UPA described herein might provide powerful tools for further investigations of the mechanisms involved in the interaction of UPA and UPAR in vitro and in vivo.

	Selected Abbreviations and Acronyms

 

CHO = Chinese hamster ovary EC = endothelial cell EGF = epidermal growth factor HUV = human umbilical vein PAGE = polyacrylamide gel electrophoresis PAI = plasminogen activator inhibitor PCR = polymerase chain reaction PMA = phorbol myristate acetate UPAR = urokinase-type plasminogen activator receptor

	Acknowledgments

 
This work was supported by the Dutch Cancer Society (to J.H.V.) (IKW 91.13), the Netherlands Heart Foundation (to P.H.A.Q.) (M93.001), and the Fonds National Suisse de la Recherche Scientifique (to D.B.).

Received October 15, 1997; accepted November 4, 1997.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Danø K, Behrendt N, Brunner N, Ellis V, Ploug M, Pyke C. The urokinase receptor: protein structure and role in plasminogen activation and cancer invasion. Fibrinolysis. 1994;8:189–203.
2. Vassalli JD. The urokinase receptor. Fibrinolysis. 1994;8:172–181.
3. Blasi F, Conese M, Moller LB, Pedersen N, Cavallaro U, Cubellis MV, Fazioli F, Hernandezmarrero L, Limongi P, Munozcanoves P, Resnati M, Riittinen L, Sidenius N, Soravia E, Soria MR, Stoppelli MP, Talarico D, Teesalu T, Valcamonica S. The urokinase receptor: structure, regulation and inhibitor-mediated internalization. Fibrinolysis. 1994;8:182–188.
4. Roldan AL, Cubellis MV, Masucci MT, Behrendt N, Lund LR, Danø K, Appella E, Blasi F. Cloning and expression of the receptor for human urokinase plasminogen activator, a central molecule in cell surface, plasmin dependent proteolysis. EMBO J. 1990;9:467–474.[Medline] [Order article via Infotrieve]
5. Nielsen LS, Kellerman GM, Behrendt N, Picone R, Danø K, Blasi F. A 55,000–60,000 Mr receptor protein for urokinase-type plasminogen activator: identification in human tumor cell lines and partial purification. J Biol Chem. 1988;263:2358–2363.[Abstract/Free Full Text]
6. Ploug M, Kjalke M, Rønne E, Weidle U, Høyer-Hansen G, Danø K. Localization of the disulfide bonds in the NH₂-terminal domain of the cellular receptor for human urokinase-type plasminogen activator: a domain structure belonging to a novel superfamily of glycolipid-anchored membrane proteins. J Biol Chem. 1993;268:17539–17546.[Abstract/Free Full Text]
7. Møller LB, Ploug M, Blasi F. Structural requirements for glycosyl-phosphatidylinositol anchor attachment in the cellular receptor for urokinase plasminogen activator. Eur J Biochem. 1992;208:493–500.[Medline] [Order article via Infotrieve]
8. Ploug M, Ellis V, Dano K. Ligand interaction between urokinase-type plasminogen activator and its receptor probed with 8-anilino-1-naphthalenesulfonate: evidence for a hydrophobic binding site exposed only on the intact receptor. Biochemistry. 1994;33:8991–8997.[Medline] [Order article via Infotrieve]
9. Stoppelli MP, Tachetti C, Cubellis MV, Corti A, Hearing VJ, Cassani G, Appella E, Blasi F. Autocrine saturation of pro-urokinase receptors on human A431 cells. Cell. 1986;45:675–684.[Medline] [Order article via Infotrieve]
10. Pöllänen J, Hedman K, Nielsen LS, Danø K, Vaheri A. Ultrastructural localization of plasma membrane associated urokinase type plasminogen activator at focal contacts. J Cell Biol. 1988;106:87–95.[Abstract/Free Full Text]
11. Estreicher A, Muhlhauser J, Carpentier JL, Orci L, Vassalli JD. The receptor for urokinase type plasminogen activator polarizes expression of the protease to the leading edge of migrating monocytes and promotes degradation of enzyme inhibitor complexes. J Cell Biol. 1990;111:783–792.[Abstract/Free Full Text]
12. Rabbani SA, Mazar AP, Bernier SM, Haq M, Bolivar I, Henkin J, Goltzman, D. Structural requirements for the growth factor activity of the amino-terminal domain of urokinase. J Biol Chem. 1992;267:14151–14156.[Abstract/Free Full Text]
13. Bohuslav J, Horejsi V, Hansmann C, Stockl J, Weidle UH, Majdic O, Bartke I, Knapp W, Stockinger H. Urokinase plasminogen activator receptor, ß2-integrins, and src-kinases within a single receptor complex of human monocytes. J Exp Med. 1995;181:1381–1390.[Abstract/Free Full Text]
14. Rao NK, Shi GP, Chapman HA. Urokinase receptor is a multifunctional protein: influence of receptor occupancy on macrophage gene expression. J Clin Invest. 1995;96:465–474.
15. Waltz DA, Chapman HA. Reversible cellular adhesion to vitronectin linked to urokinase receptor occupancy. J Biol Chem. 1994;269:14746–14750.[Abstract/Free Full Text]
16. Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA. Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem. 1994;269:32380–32388.[Abstract/Free Full Text]
17. Clowes AW, Clowes MM, Au YPT, Reidy MA, Belin D. Smooth muscle cells express urokinase during mitogenesis and tissue-type plasminogen activator during migration in injured rat carotid artery. Circ Res. 1990;67:61–67.[Abstract/Free Full Text]
18. Schleef RR, Birdwell CR. The effects of proteases on endothelial cell migration in vitro. Exp Cell Res. 1981;141:503–508.
19. Wijnberg MJ, Quax PHA, Nieuwenbroek NME, Verheijen JH. The migration of human smooth muscle cells in vitro is mediated by plasminogen activation and can be inhibited by ₂-macroglobulin receptor associated protein. Thromb Haemost. 1997;78:880–886.[Medline] [Order article via Infotrieve]
20. Okada SS, Tomaszewski JE, Barnathan ES. Migrating vascular smooth muscle cells polarize cell surface urokinase receptors after injury in vitro. Exp Cell Res. 1995;217:180–187.[Medline] [Order article via Infotrieve]
21. Gyetko MR, Todd RF, Wilkinson CC, Sitrin RG. The urokinase receptor is required for human monocyte chemotaxis in vitro. J Clin Invest. 1994;93:1380–1387.
22. Pepper MS, Vassalli JD, Montesano R, Orci L. Urokinase-type plasminogen activator is induced in migrating capillary endothelial cells. J Cell Biol. 1987;105:2535–2541.[Abstract/Free Full Text]
23. Pepper MS, Sappino AP, Stocklin R, Montesano R, Orci L, Vassalli JD. Upregulation of urokinase receptor expression on migrating endothelial cells. J Cell Biol. 1993;122:673–684.[Abstract/Free Full Text]
24. Koolwijk P, van Erck MGM, De Vree WJA, Vermeer MA, Weich HA, Hanemaaijer R, van Hinsbergh VWM. Cooperative effect of TNF, bFGF, and VEGF on the formation of tubular structures of human microvascular endothelial cells in a fibrin matrix: role of urokinase activity. J Cell Biol. 1996;132:1177–1188.[Abstract/Free Full Text]
25. Noda-Heiny H, Daugherty A, Sobel BE Augmented urokinase receptor expression in atheroma. Arterioscler Thromb Vasc Biol. 1995;15:37–43.[Abstract/Free Full Text]
26. Padro T, Emeis JJ, Steins M, Schmid KW, Kienast J. Quantification of plasminogen activators and their inhibitors in the aortic vessel wall in relation to the presence and severity of atherosclerotic disease. Arterioscler Thromb Vasc Biol. 1995;15:893–902.[Abstract/Free Full Text]
27. Lupu F, Heim DA, Bachmann F, Hurni M, Kakkar VV, Kruithof EKO. Plasminogen activator expression in human atherosclerotic lesions. Arterioscler Thromb Vasc Biol. 1995;15:1444–1455.[Abstract/Free Full Text]
28. Schneiderman J, Bordin GM, Engelberg I, Adar R, Seiffert D, Thinnes T, Berstein EF, Dilley RB, Loskutoff DJ. Expression of fibrinolytic genes in atherosclerotic abdominal aortic aneurysm wall. J Clin Invest. 1995;96:639–645.
29. Carmeliet P, Collen D. Gene targetting and gene transfer studies of the plasminogen/plasmin system: implications in thrombosis, hemostasis, neointima formation, and atherosclerosis. FASEB J. 1995;9:934–938.[Abstract]
30. Carmeliet P, Collen D. Genetic analysis of the plasminogen and coagulation system in mice. Haemostasis. 1996;26:132–153.
31. Quax PHA, Pedersen N, Masucci MT, Weening-Verhoeff EJD, Danø K, Verheijen JH, Blasi F. Complementation between urokinase-producing and receptor-producing cells in extracellular matrix degradation. Cell Regul. 1991;2:793–803.[Medline] [Order article via Infotrieve]
32. Ellis V, Behrendt N, Danø K. Plasminogen activation by receptor-bound urokinase: a kinetic study with both cell-associated and isolated receptor. J Biol Chem. 1991;266:12752–12758.[Abstract/Free Full Text]
33. Bugge TH, Suh TT, Flick MJ, Daugherty CC, Romer J, Solberg H, Ellis V, Danø K, Degen JL. The receptor for urokinase-type plasminogen activator is not essential for mouse development or fertility. J Biol Chem. 1995;270:16886–16894.[Abstract/Free Full Text]
34. Appella E, Robinson EA, Ullrich SJ, Stoppelli MP, Corti A, Cassani G, Blasi F. The receptor binding sequence of urokinase. J Biol Chem. 1987;262:4437–4440.[Abstract/Free Full Text]
35. Heath WF, Merrifield RB. A synthetic approach to structure-function relationships in the murine epidermal growth factor molecule. Proc Natl Acad Sci U S A. 1986;83:6367–6371.[Abstract/Free Full Text]
36. Komoriya A, Hortsch M, Meyers C, Smith M, Kanety H, Schlessinger J. Biologically active synthetic fragments of epidermal growth factor: localization of a major receptor-binding region. Proc Natl Acad Sci U S A. 1984;81:1351–1355.[Abstract/Free Full Text]
37. Basselduby R, Jiang NY, Bittick T, Madison E, McGookey D, Orth K, Shohet R, Sambrook J, Gething MJ. Tyrosine-67 in the epidermal growth factor-like domain of tissue-type plasminogen activator is important for clearance by a specific hepatic receptor. J Biol Chem. 1992;267:9668–9677.[Abstract/Free Full Text]
38. Magdolen V, Rettenberger P, Koppitz M, Goretzki L, Kessler H, Weidle UH, Konig B, Graeff H, Schmitt M, Wilhelm O. Systematic mutational analysis of the receptor-binding region of the human urokinase-type plasminogen activator. Eur J Biochem. 1996;237:743–751.[Medline] [Order article via Infotrieve]
39. Hansen AP, Petros AM, Meadows RP, Nettesheim DG, Mazar AP, Olejniczak ET, Xu RX, Pederson TM, Henkin J, Fesik SW. Solution structure of the amino-terminal fragment of urokinase-type plasminogen activator. Biochemistry. 1994;33:4847–4864.[Medline] [Order article via Infotrieve]
40. Estreicher A, Wohlwend A, Belin D, Schleuning WD, Vassalli JD. Characterization of the cellular binding site for the urokinase type plasminogen activator. J Biol Chem. 1989;264:1180–1189.[Abstract/Free Full Text]
41. Jaffe EA, Nachmann RL, Becker CG, Minick CR. Culture of endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745–2756.
42. van Hinsbergh VWM, Binnema D, Scheffer MA, Sprengers ED, Kooistra T, Rijken DC. Production of plasminogen activators and inhibitor by serially propagated endothelial cells from adult human blood vessels. Arteriosclerosis. 1987;7:389–400.[Abstract/Free Full Text]
43. Verheijen JH, Caspers MPM, Chang GTG, De Munk GAW, Pouwels PH, Enger-Valk BE. Involvement of finger domain and kringle 2 domain of tissue-type plasminogen activator in fibrin binding and stimulation of activity by fibrin. EMBO J. 1986;5:3525–3530.[Medline] [Order article via Infotrieve]
44. Ragno P, Estreicher A, Gos A, Wohlwend A, Belin D, Vassalli JD. Polarized secretion of urokinase-type plasminogen activator by epithelial cells. Exp Cell Res. 1992;203:236–243.[Medline] [Order article via Infotrieve]
45. Quax PHA, van Leeuwen RTJ, Verspaget HW, Verheijen JH. Protein and messenger RNA levels of plasminogen activators and inhibitors analyzed in 22 human tumor cell lines. Cancer Res. 1990;50:1488–1494.[Abstract/Free Full Text]
46. Quax PHA, van Muijen GNP, Weening-Verhoeff EJD, Lund LR, Danø K, Ruiter DJ, Verheijen JH. Metastatic behavior of human melanoma cell lines in nude mice correlates with urokinase-type plasminogen activator, its type-1 inhibitor, and urokinase-mediated matrix degradation. J Cell Biol. 1991;115:191–199.[Abstract/Free Full Text]
47. Sabapathy KT, Pepper MS, Kiefer F, Möhle-Steinlein U, Tacchini-Cottier F, Fetka I, Breier G, Risau W, Carmeliet P, Montesano R, Wagner EF. Polyoma middle T-induced vascular tumor formation: the role of the plasminogen activator/plasmin system. J Cell Biol. 1997;137:953–963.[Abstract/Free Full Text]
48. Belin D, Vassalli JD, Combépine C, Godeau F, Nagamine Y, Reich E, Kocher HP, Duvoisin RM. Cloning, nucleotide sequencing and expression of cDNAs encoding mouse urokinase type plasminogen activator. Eur J Biochem. 1985;148:225–232.[Medline] [Order article via Infotrieve]
49. Kunkel TA. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci U S A. 1985;82:488–492.[Abstract/Free Full Text]
50. Dreano M, Fouillet X, Brochot J, Vallet JM, Michel ML, Rungger D, Bromley P. Heat-regulated expression of the hepatitis B virus surface antigen in the human WISH cell line. Virus Res. 1987;8:43–56.[Medline] [Order article via Infotrieve]
51. De Munk GAW, Caspers MPM, Chang GTG, Pouwels PH, Enger-Valk BE, Verheijen JH. Binding of tissue-type plasminogen activator to lysine, lysine analogues, and fibrin fragments. Biochemistry. 1989;28:7318–7325.[Medline] [Order article via Infotrieve]
52. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463–5467.[Abstract/Free Full Text]
53. Jones DH, Howard BH. A rapid method for site-specific mutagenesis and directional subcloning by using the polymerase chain reaction to generate recombinant circles. Biotechniques. 1990;8:178–183.[Medline] [Order article via Infotrieve]
54. Chung CT, Miller RH. A rapid and convenient method for the preparation and storage of competent bacterial cells. Nucleic Acids Res. 1988;16:3580–3584.[Free Full Text]
55. Graham FL, Van der Eb AJ. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 1973;52:456–467.[Medline] [Order article via Infotrieve]
56. Weening-Verhoeff EJD, Quax PHA, van Leeuwen RTJ, Rehberg EF, Marotti KR, Verheijen JH. Involvement of aspartic and glutamic residues in kringle-2 of tissue-type plasminogen activator in lysine binding, fibrin binding and stimulation of activity as revealed by chemical modification and oligonucleotide-directed mutagenesis. Protein Eng. 1990;4:191–198.[Abstract/Free Full Text]
57. Binnema DJ, van Iersel JJL, Dooijewaard G. Quantitation of urokinase antigen in plasma and culture media by use of an ELISA. Thromb Res. 1986;43:569–577.[Medline] [Order article via Infotrieve]
58. Gaffney PJ, Heath AB. A collaborative study to establish a standard for high molecular weight urinary-type plasminogen activator (HMW/u-PA). Thromb Haemost. 1990;64:398–401.[Medline] [Order article via Infotrieve]
59. Verheijen JH, Mullaart E, Chang GTC, Kluft C, Wijngaards G. A simple, sensitive spectrophotometric assay for extrinsic (tissue-type) plasminogen activator applicable to measurements in plasma. Thromb Haemost. 1982;48:266–269.[Medline] [Order article via Infotrieve]
60. Langer DJ, Kuo A, Kariko K, Ahuja M, Klugherz BD, Ivanics KM, Hoxie JA, Williams WV, Liang BT, Cines DB, Barnathan ES. Regulation of the endothelial cell urokinase-type plasminogen activator receptor: evidence for cyclic AMP-dependent and protein kinase-C dependent pathways. Circ Res. 1993;72:330–340.[Abstract/Free Full Text]
61. Thorsen S, Philips M, Selmer J, Lecander I, Åstedt B. Kinetics of inhibition of tissue-type and urokinase-type plasminogen activator by plasminogen activator inhibitor type 1 and type 2. Eur J Biochem. 1988;175:33–39.[Medline] [Order article via Infotrieve]