Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:493-498

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ariyoshi, H.
Right arrow Articles by Monden, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ariyoshi, H.
Right arrow Articles by Monden, M.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:493-498.)
© 1998 American Heart Association, Inc.


Original Contributions

Possible Involvement of m-Calpain in Vascular Smooth Muscle Cell Proliferation

Hideo Ariyoshi; Kazuhiro Okahara; Masato Sakon; Jun-ichi Kambayashi; Sei-ichi Kawashima; Tomio Kawasaki; ; Morito Monden

From the Second Department of Surgery, Osaka University Medical School (H.A., K.O., M.S., J.K., T.K., M.M.); and the Department of Enzyme Biochemistry, Tokyo Metropolitan Institute of Gerontology (S.K.), Japan.

Correspondence to Hideo Ariyoshi, MD, PhD, The Second Department of Surgery, Osaka University Medical School, 2–2 Yamada-oka, Suita, Osaka 565, Japan.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Vascular smooth muscle cell (VSMC) proliferation still remains a poorly understood process, although it is believed to play a critical role in pathological states, including atherosclerosis and hypertension. Several reports have suggested that proteases may be directly involved in this process; however, it was still unclear which protease is responsible for VSMC proliferation. In this study, by use of a cell-permeable calpain inhibitor (calpeptin; benzyloxycarbonyl-Leu-nLeu-H), its analogue (benzyloxycarbonyl-Leu-Met-H), the cell-impermeable serine protease inhibitor leupeptin, and antisense oligonucleotide against m-calpain to inhibit proliferation of primarily cultured human VSMCs, we investigated whether calcium-activated neutral protease (calpain) is involved in VSMC proliferation. Calpeptin and its analogue, more specific for m-calpain, equally inhibited the proliferation of VSMCs in a dose-related manner, whereas a more limited antiproliferative effect was observed in leupeptin-treated VSMCs. Antisense oligonucleotide against m-calpain, but not scrambled antisense, dose-dependently inhibited m-calpain expression and proliferation of VSMCs. Maximal inhibition was an {approx}50% reduction of cell number and m-calpain antigen observed at 50 µmol/L of antisense oligonucleotide. Calpeptin or antisense oligonucleotide against m-calpain increased the expression of the endogenous calpain substrate pp125FAK (focal adhesion kinase), whereas the expression of the endogenous calpain inhibitor calpastatin was not affected. These results suggest that the proliferation of VSMCs requires protease activity, some of which is due to m-calpain.


Key Words: calpain • vascular smooth muscle cells • proliferation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Several reports have suggested the role of [Ca2+]i in regulating transitions of the cell cycle, not only in mitosis1 2 3 4 5 6 7 but also in the G1-to-S transition.8 9 10 Although the phenomenon of a rise in [Ca2+]i and the mechanisms to induce this rise have been intensively studied,2 3 8 9 10 the mode of cell cycle regulation by [Ca2+]i has been poorly documented. It is likely that the [Ca2+]i-dependent signal transduction pathway, including calmodulin-dependent reactions,1 the protein kinase C–mediated pathway,11 and the calcium-activated neutral protease (calpain)–mediated pathway,12 plays an important role as an effector for elevated [Ca2+]i, but the exact mechanisms integral to cell proliferation are still unclear.

Calpains (EC 3.4.22.17) are Ca2+-requiring intracellular cysteine proteases that are ubiquitously distributed in mammalian and avian cells.13 There are at least two major calpain isozymes: m-calpain, which requires millimolar Ca2+ for its activation, and µ-calpain, which requires 10 to 100 µmol/L Ca2+.14 There are also tissue-specific forms of calpain,15 and most cells contain an endogenous inhibitor protein, calpastatin,16 which is specific for the calpains.17 Although their exact physiological function has not been established, a variety of substrate proteins, including enzymes, surface glycoproteins, and cytoskeletal proteins,18 19 20 21 22 23 24 25 have suggested the possible involvement of this enzyme-inhibitor system in Ca2+-dependent signal transduction pathways.18 19 20 21 22 23 24 25

Earlier studies using protease inhibitors have suggested the involvement of protease activity in vascular smooth muscle cell proliferation.26 This hypothesis has been strengthened by the observations in other cell types; Schollmeyer27 reported the acceleration of anaphase by microinjection of m-calpain in PtK1 cells, Zhang et al28 reported the growth inhibition of HeLa and WI-38 cells induced by treatment with a calpain small-subunit antisense oligonucleotide, and Mellgren et al29 observed reduced proliferation of Chinese hamster ovary cells with decreased µ-calpain content after treatment with calpain inhibitors. Although these observations strongly suggested the roles of calpains in VSMC proliferation, the exact relationships between proteolytic activity of calpain and VSMC proliferation is still unclear, partly because of a lack of knowledge about calpain activity without a small subunit or the exact inhibitory spectra of protease inhibitors.30 In this study, we used several protease inhibitors with different inhibitory characteristics and an antisense oligonucleotide against a large subunit of m-calpain to clarify the exact roles of m-calpain in VSMC proliferation.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
Primary human vascular smooth muscle cells (VSMCs) were prepared from human gastroduodenal artery as previously outlined and were used in the third passage.31 Cells were cultured in DMEM supplemented with 10% FBS (10% FBS-DMEM). The characteristics of monoclonal antibodies specific for µ-calpain (1A8A2), m-calpain (1C6D1), and calpastatin are described elsewhere.32 Monoclonal antibody specific for pp125FAK was purchased from Transduction Laboratories.24 FITC-conjugated rabbit anti-mouse IgG (secondary antibody) was purchased from Cappel. Purified antisense phosphorothiolate oligonucleotides were synthesized by Vector Research. The sequence for the antisense m-calpain oligonucleotide was CGCGATGCCCGCCCGCCATGCT. A corresponding scrambled sequence (GGCTGCCGCGAGCCCCACTCT) was used as control. Calpeptin (benzyloxycarbonyl-Leu-nLeu-H) and its analogue (benzyloxycarbonyl-Leu-Met-H) were synthesized as we described previously.33 Other reagents were of the highest analytical grade available.

Growth Assay
VSMCs were seeded in six-well plates in 10% FBS-DMEM. The following day, the cells were washed twice with PBS, and the medium was replaced with 0.5% FBS-DMEM (growth-arrest medium). The cells were kept in growth-arrest medium for 96 hours for synchronization to minimize artifacts due to the heterogeneous cell-cycle stage during the growth assay. The medium was then changed to 10% FBS-DMEM, and several protease inhibitors or synthetic oligonucleotides were added. The cells were permitted to grow for 72 hours and then trypsinized and counted on a Coulter counter.

Immunofluorescence Microscopic Examination of VSMCs for Calpains and Calpastatin
VSMCs were fixed with 2% paraformaldehyde/PBS at room temperature for 15 minutes, permeated with 0.2% Triton X-100/PBS, washed three times with 1% BSA/PBS, and exposed for 2 hours to anti–µ-calpain, anti–m-calpain, or anti-calpastatin monoclonal anti-body diluted to 5 µg/mL in 1% BSA/PBS. The cells were washed three times with 1% BSA/PBS to remove excess primary antibody, followed by incubation for 2 hours with secondary antibodies diluted 1:100 in 1% BSA/PBS. After the cells were washed three times with 1% BSA/PBS, they were examined by confocal laser scanning microscopy (Zeiss).

DNA Flow Cytometry
Flow cytometric analysis of the cell cycle was carried out in VSMCs loaded with Hoechst 33342 (Molecular Probes). The loading was carried out by addition of 4 mL of a 10 mmol/L solution of dye to 4 mL of cell culture and incubation of the cells for 1 hour at 37°C. The cells were analyzed by a FACStar flow cytometer as described previously.10

Electrophoresis and Western Blots
VSMCs were solubilized in sample buffer (0.05 mol/L Tris-HCl, pH 6.80, 10% SDS, 0.01% bromphenol blue, 30% glycerol, 1% DTT, and 5 mmol/L EDTA) and boiled for 5 minutes. Proteins were separated by SDS-PAGE in a gradient polyacrylamide gel (5% to 20%) as described by Laemmli34 and were then transferred onto nitrocellulose sheets. After the sheets were incubated with monoclonal antibody specific for m-calpain (1C6D1), calpastatin, or pp125FAK, the bound antibody was visualized by a secondary antibody coupled to horseradish peroxidase.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Expression of µ-Calpain, m-Calpain, and Calpastatin in Primary VSMCs
To confirm the presence of the calpain-calpastatin system in human VSMCs, we first examined the immunoreactivity of µ-calpain, m-calpain, and calpastatin by immunofluorescent staining using specific monoclonal antibodies.32 As shown in Fig 1Down, VSMCs showed strong immunoreactivity to anti–m-calpain and anti-calpastatin monoclonal antibodies but failed to show clear immunoreactivity to anti–µ-calpain monoclonal antibody. Although these observations cannot exclude the existence of µ-calpain or suggest a lower expression of calpastatin than of m-calpain, they clearly confirm the existence of m-calpain and calpastatin in VSMCs. Because of the lack of methods to detect the µ-calpain molecule in VSMCs, we tested the effect of antisense oligonucleotide against m-calpain in further studies.



View larger version (101K):
[in this window]
[in a new window]
 
Figure 1. Expression of µ-calpain, m-calpain, and calpastatin in primary VSMCs. The indirect immunofluorescence technique was used to assess µ-calpain, m-calpain, and calpastatin protein levels primarily in cultured VSMCs. VSMCs were immunostained with nonimmune IgG (top left), anti–µ-calpain (top right), anti–m-calpain (bottom left), or anti-calpastatin (bottom right) monoclonal antibody and were examined by confocal laser scanning microscopy as described in "Methods." Results shown are from one representative of four different experiments.

Influence of m-Calpain Antisense Oligonucleotide on the Immunoreactivity of m-Calpain in VSMCs
As shown in Fig 2Down, treatment with antisense oligonucleotide against m-calpain caused a marked decrease in m-calpain detected by immunofluorescent technique, whereas control oligonucleotide did not cause a remarkable decrease in m-calpain in VSMCs.



View larger version (129K):
[in this window]
[in a new window]
 
Figure 2. Influence of m-calpain antisense (As) oligonucleotide on the immunoreactivity of m-calpain in VSMCs. VSMCs growth-arrested by incubation in 0.5% FBS-DMEM (growth-arrest medium) for 96 hours were then incubated in 10% FBS-DMEM containing control saline (left panels), scramble antisense oligonucleotide (middle panels), or m-calpain antisense oligonucleotide (right panels) for 72 hours. VSMCs were immunostained with anti–m-calpain monoclonal antibody. Differential interference contrast (DIC) images (top panels) and immunofluorescence images were examined by confocal laser scanning microscopy as described in "Methods." Results shown are from one representative of four different experiments.

Influence of m-Calpain Antisense Oligonucleotide or Calpeptin on the Immunoreactivity of m-Calpain, Calpastatin, and pp125FAk in VSMCs
The effect of antisense oligonucleotide against m-calpain was further confirmed by Western blot analysis, as shown in Fig 3ADown and 3BDown. Although neither control oligonucleotide nor the cell-permeable calpain inhibitor calpeptin caused any change in m-calpain, m-calpain antisense oligonucleotide caused a significant decrease in m-calpain in a dose-related manner in VSMCs. Maximal decrease of m-calpain was observed at 50 µmol/L antisense oligonucleotide. To estimate the activity of calpain in VSMCs treated with m-calpain antisense oligonucleotide or calpeptin, the expression of the endogenous calpain inhibitor calpastatin or the endogenous calpain substrate pp125FAK24 was also examined. As shown in Fig 3BDown, calpeptin as well as m-calpain antisense oligonucleotide increased pp125FAK, whereas calpastatin was not affected. Although we failed to detect the cleavage products of pp125FAK, this may be a result of the long incubation time for the growth assay.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Western blot analysis of m-calpain, calpastatin, or pp125FAK in VSMCs treated with calpeptin and m-calpain antisense oligonucleotide. VSMCs growth-arrested by incubation in 0.5% FBS-DMEM (growth-arrest medium) for 96 hours were then incubated in 10% FBS-DMEM containing control saline, calpeptin, scramble antisense oligonucleotide, or indicated concentrations of m-calpain antisense (As) oligonucleotide. Cells were solubilized in SDS sample buffer and subjected to Western blot analysis as described in "Methods." The contents of m- calpain were densitometrically examined, and the content of m-calpain in VSMCs treated with control saline was considered to be 100% (A). Data represent mean±SD. n=5; *P<.05. B, Typical Western blot using specific antibody against m-calpain, calpastatin, or pp125FAK. C, Typical densitometric analysis of Western blot of m-calpain. Results shown are from one representative of four different experiments.

Effects of Protease Inhibitors and m-Calpain Antisense Oligonucleotide on VSMC Growth
As shown in Fig 4Down, a dose-dependent inhibition of cell growth was observed in VSMCs incubated with calpeptin, a cell-permeable calpain inhibitor that is potent against both µ- and m-calpain.33 This inhibitory effect of calpeptin was not due to the toxicity of this compound, because VSMCs could grow after the removal of calpeptin in culture medium (data not shown). Comparable growth inhibition with calpeptin was also observed in VSMCs treated with benzyloxycarbonyl-Leu-Met-H, which is 17 times more potent as an inhibitor against m-calpain than against µ-calpain.33 The serine protease inhibitor leupeptin, which is less permeable and less specific for calpain, also showed mild but significant inhibition of VSMC growth. Antisense oligonucleotide against m-calpain also inhibited VSMC growth in a dose-related manner, whereas control oligonucleotide showed no inhibitory effect on VSMC growth.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Effects of protease inhibitors and m-calpain antisense oligonucleotide on VSMC growth. VSMCs growth-arrested by incubation in 0.5% FBS-DMEM (growth-arrest medium) for 96 hours were then incubated in 10% FBS-DMEM containing control saline, calpeptin, its analogue (BOC-Leu-Met-H), scramble antisense oligonucleotide, or m-calpain antisense (As) oligonucleotide. The cells were permitted to grow for 72 hours and then were trypsinized and counted on a Coulter counter. Data represent mean±SD. n=5; *P<.05. Results shown are from one representative of four different experiments.

DNA Flow Cytometry
We then carried out DNA flow cytometric studies at the G1/S interface 24 hours after the addition of antisense oligonucleotide against m-calpain or calpeptin. As shown in Fig 5Down, the admixture of antisense oligonucleotide against m-calpain or calpeptin, but not control oligonucleotides, leads to a 50% reduction in the numbers of cells entering the S phase.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 5. Effect of m-calpain antisense (As) and calpeptin on cell-cycle progression in VSMCs. VSMCs growth-arrested by incubation in 0.5% FBS-DMEM (growth-arrest medium) for 96 hours were then incubated in 10% FBS-DMEM containing control saline, calpeptin, scramble antisense oligonucleotide, or m-calpain antisense oligonucleotide. VSMCs were loaded with Hoechst 33342 by addition of 4 mL of 10 mmol/L solution of dye to 4 mL of cell culture and incubation of the cells for 1 hour at 37°C. The cells were analyzed by FACStar flow cytometer after trypsinization. Results shown are from one representative of four different experiments.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
It has been well established through the direct examination of [Ca2+]i in the cell cycle that [Ca2+]i transients are involved in cell growth.1 2 3 4 5 6 7 8 9 10 Although several studies have also suggested possible mechanisms to increase the [Ca2+]i integral to cell proliferation,2 3 8 9 10 it is still controversial how [Ca2+]i transients contribute to cell cycle progression.8 9 10 In addition to [Ca2+]i transients, a possible role of protease in cell growth has been suggested by several studies using protease inhibitors; however, those studies failed to specify the protease responsible for cell growth, partly because of a lack of specific inhibitors. Through this knowledge on the role of [Ca2+]i transients and protease in cell growth, one can easily hypothesize that calpain, a calcium-activated neutral protease, may possess important roles as an effector of [Ca2+]i rise in cell growth, and this hypothesis has been strengthened by the recent findings of important transcription factors as calpain substrate, such as nuclear factor-{kappa}B, c-fos, fra-2, fos-b, jun-b, c-jun, and jun-d.35 36 However, several attempts have failed to clarify the exact roles of calpain in cell growth. Schollmeyer27 microinjected m-calpain into PtK1 cells to observe progression in mitosis, whereas March et al26 used several protease inhibitors to inhibit cell growth at the G1/S interface. This discrepancy has not been explained. Although some of the inhibitors could abolish the activity of calpain, none were specific for calpains. Zhang et al28 used a new strategy of antisense oligonucleotide against calpain, which inhibited cell growth, but their results were insufficient because they used antisense oligonucleotide against a 30-kD small subunit of calpain. Although their approach may have the benefit of affecting both µ- and m-calpain molecules, Meyer et al37 recently reported that an 80-kD large subunit of calpain expressed without a 30-kD small subunit showed proteolytic activity, suggesting that modification of the 80-kD large subunit responsible for proteolytic activity is essential to clarify the exact roles of calpains. In this study, in conjunction with specific calpain inhibitors with unique inhibitory spectra, we used antisense oligonucleotide against m-calpain because our results showed, by means of immunoreactivity, that the predominant isozyme of calpain in VSMCs is m-calpain, and we could successfully present the results confirming the involvement of m-calpain in VSMC growth.

Consistent with previous studies using protease inhibitors,26 the cell-permeable calpain inhibitor calpeptin inhibited cell growth at the G1/S interface, and the comparable inhibitory effect was attained by the analogue of calpeptin, which is {approx}17 times more potent against m-calpain than against µ-calpain.33 Although a mild inhibitory effect of leupeptin on VSMC growth might suggest a possible contribution of extracellular protease activities on cellular functions, it is impossible to speculate on the exact inhibitory mode of leupeptin, because the possibility exists that the cell-impermeable inhibitor leupeptin was incorporated into the cytosol after prolonged incubation at high extracellular concentrations. Thus, in this study, we focused on intracellular proteases. These observations strongly suggested the involvement of m-calpain, not µ-calpain, in VSMC growth; however, these inhibitors still have cross-inhibitory reactivity against other cytoplasmic proteases, such as cathepsin B, H, and L.33 Thus, we used antisense strategy to confirm the role of m-calpain. Consistent with inhibitor assays, m-calpain antisense oligonucleotide inhibited cell growth at the G1/S interface, which was well correlated with the inhibition of m-calpain expression in VSMCs. However, decreased expression of m-calpain cannot be directly interpreted as decreased activity of m-calpain inside living cells, because the activity of m-calpain is regulated primarily by Ca2+ and the endogenous calpain inhibitor calpastatin. Thus, we further examined the level of calpastatin. Because the level of calpastatin was not affected by calpeptin or m-calpain antisense oligonucleotide, it was suggested that the decreased m-calpain in m-calpain antisense oligonucleotide–treated VSMCs might be integral to a decrease in the activity of m-calpain. This speculation was further confirmed by the observation of the expression of the calpain substrate pp125FAK, which was increased by m-calpain antisense oligonucleotide as well as by calpeptin. Taking these results together, we conclude that the activity of m-calpain, not that of µ-calpain, is essential in VSMC growth.

Although several proteins, including transcription factors,35 36 enzymes,18 19 20 21 and cytoskeleton-related proteins,23 have been reported to be cleaved by calpains and we confirmed that the activity of m-calpain estimated by the expression of pp125FAK is required for VSMC growth, the possibility exists that other calpain substrates are also involved in VSMC growth. Further study will be necessary to clarify the full signal transduction pathway from a rise in [Ca2+]i to cell growth.

Received May 13, 1997; accepted December 4, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Anraku Y, Ohya Y, Iida H. Cell cycle control by calcium and calmodulin in Saccharomyces cerevisiae. Biochim Biophys Acta. 1991;1093:169–177.

2. Steel-Perkins G, Turner J, Edman JC, Hari J, Pierce SB, Stover C, Rutter WJ, Roth RA. Expression and characterization of functional human insulin-like growth factor I receptor. J Biol Chem. 1988;263:11486–11492.[Abstract/Free Full Text]

3. Twigg J, Patel R, Whitaker M. Translational control of InosP3-induced chromatin condensation during the early cell cycles of sea urchin embryos. Nature. 1988;332:366–369.[Medline] [Order article via Infotrieve]

4. Poenie M, Alderton J, Tsien RY, Steinhardt RA. Changes of free calcium levels with stages of the cell division cycle. Nature. 1985;315:147–149.[Medline] [Order article via Infotrieve]

5. Richard A, Alderton J. Intracellular free calcium rise triggers nuclear envelope breakdown in the sea urchin embryo. Nature. 332: 364–366.

6. Poenie M, Alderton J, Steinhardt R, Tsien R. Calcium rises abruptly and briefly throughout the cell at the onset of anaphase. Science. 1986;233:886–889.[Abstract/Free Full Text]

7. Pardee A, Dubrow BR, Hamlin JL, Kletzien RF. Animal cell cycle. Annu Rev Biochem. 1978;47:715–750.[Medline] [Order article via Infotrieve]

8. Paul D, Riston HJJ. Cell cycle control by Ca++ ions in mouse 3T3 cells and in transformed 3T3 cells. J Cell Physiol. 1979;98:31–40.[Medline] [Order article via Infotrieve]

9. Simons M, Morgan KGM, Parker C, Collins E, Rosenberg RD. Proto-oncogene c-myb mediates late G1 calcium rise in vascular smooth muscle cells. J Chem. 1993;268:627–632.

10. Simons M, Ariyoshi H, Salzman EW, Rosenberg RD. c-myb affects intracellular calcium handling in vascular smooth muscle cells. Am J Physiol. 1995;268:C856–C868.[Abstract/Free Full Text]

11. Nishizuka Y. Studies and perspectives of protein kinase C. Science. 1986;233:305–312.[Abstract/Free Full Text]

12. Kambayashi J, Sakon M. Calcium-dependent proteases and their inhibitors in human platelets. Methods Enzymol. 1989;169:442–455.[Medline] [Order article via Infotrieve]

13. Murachi T. Calpain and calpastatin. Trends Biochem Sci. 1983;8:167–169.

14. Sakon M, Kambayashi J, Ohno H, Kosaki G. Two forms of Ca2+-activated neutral protease in platelets. Thromb Res. 1981;24:207–214.[Medline] [Order article via Infotrieve]

15. Sorimachi H, Saido T, Suzuki K. New era of calpain research: discovery of tissue-specific calpains. FEBS Lett. 1994;343:1–5.[Medline] [Order article via Infotrieve]

16. Murachi T, Tanaka K, Hatanaka M, Murakami T. Intracellular Ca2+-dependent protease (calpain) and its high-molecular-weight endogenous inhibitor (calpastatin). Adv Enzyme Regul. 1981;19:407–424.

17. Shiba E, Tsujinaka T, Kambayashi J, Kosaki G. Purification and characterization of Ca2+-activated neutral protease inhibitor from human platelet. Thromb Res. 1983;32:207–214.[Medline] [Order article via Infotrieve]

18. Kishimoto A, Mikawa K, Hashimoto K, Yasuda I, Tanaka S, Tominaga M, Kuroda T, Nishizuka Y. Limited proteolysis of protein kinase C by calcium-activated neutral protease (calpain). J Biol Chem. 1989;264:4088–4092.[Abstract/Free Full Text]

19. Kambayashi J, Kajiwara Y, Sakon M, Ohshiro T, Mori T. Possible participation of calpain in myosin light chain phosphorylation of human platelets. Biochem Int. 1986;13:571–578.[Medline] [Order article via Infotrieve]

20. Ariyoshi H, Shiba E, Kambayashi J, Sakon M, Kawasaki T, Yoshida K, Mori T. Stimulation of human platelet Ca2+-ATPase and Ca2+ restoration by calpain. Cell Calcium. 1993;14:455–463.[Medline] [Order article via Infotrieve]

21. Oda A, Drucker BJ, Ariyoshi H, Smith M, Salzman EW. pp60src is an endogenous substrate for calpain in human blood platelets. J Biol Chem. 1993;268:12603–12608.[Abstract/Free Full Text]

22. Phillips R, Jakabova M. Ca2+-dependent protease in human platelets: specific cleavage of platelet polypeptides in the presence of added Ca2+. J Biol Chem. 1977;252:5602–5605.[Abstract/Free Full Text]

23. Tsujinaka T, Sakon M, Kambayashi J, Kosaki G. Cleavage of cytoskeletal proteins by two forms of Ca2+-activated neutral proteases in human platelets. Thromb Res. 1982;28:149–156.[Medline] [Order article via Infotrieve]

24. Cooray P, Yuan Y, Schoenwaelder SM, Mitchell CA, Salem HH, Jackson SP. Focal adhesion kinase (pp125FAK) cleavage and regulation by calpain. Biochem J. 1996;318:41–47.

25. Puri RN, Zhou FX, Bradford H, Hu CJ, Colman RF. Thrombin induced platelet aggregation involves an indirect proteolytic cleavage of aggregin by calpain. Arch Biochem Biophys. 1986;271:346–358.

26. March KL, Wilensky RL, Roeske RW, Hathway DR. Effects of thiol protease inhibitors on cell cycle and proliferation of vascular smooth muscle cells in culture. Circ Res. 1993;72:413–423.[Abstract/Free Full Text]

27. Schollmeyer JE. Calpain II involvement in mitosis. Science. 1988;240:911–913.[Abstract/Free Full Text]

28. Zhang W, Lane RD, Mellgren RL. The major calpains isozymes are long-lived proteins. J Biol Chem. 1996;271:18825–18830.[Abstract/Free Full Text]

29. Mellgren RL, Lu Q, Zhang W, Lakkis M, Shaw E, Mericle MT. Isolation of Chinese hamster ovary cell clone processing decreased µ-calpain content and a reduced proliferative growth rate. J Biol Chem. 1996;271:15568–15574.[Abstract/Free Full Text]

30. Weissberg PL, Grainger DJ, Shanahan CM, Metcalfe JC. Approaches to the development of selective inhibitors of vascular smooth muscle cell proliferation. Cardiovasc Res. 1993;27:1191–1198.[Free Full Text]

31. Ross R. The smooth muscle cell, II: growth of smooth muscle in culture and formation of elastic fibers. J Cell Biol. 1971;50:172–186.[Abstract/Free Full Text]

32. Inomata M, Kasai Y, Nakamura A, Kawashima S. Activation mechanism of calcium-activated neutral protease: evidence for the existence of intramolecular and intermolecular autolysis. J Biol Chem. 1988;263:19783–19787.[Abstract/Free Full Text]

33. Tsujinaka T, Kajiwara Y, Kambayashi J, Sakon M, Higuchi N, Tanaka T, Mori T. Synthesis of a new cell penetrating calpain inhibitor (calpeptin). Biochem Biophys Res Commun. 1988;153:1201–1208.[Medline] [Order article via Infotrieve]

34. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685.[Medline] [Order article via Infotrieve]

35. Carillo S, Pariat M, Steff A, Jariel-Encontre I, Poulat F, Berta P, Picechaczyk M. PEST motifs are not required for rapid calpain-mediated proteolysis of c-fos protein. Biochem J. 1996;313:245–251.

36. Fatt F, Molloy PL. Specific cleavage of transcription factors by the thiol protease, m-calpain. Nucleic Acids Res. 1993;21:5092–5100.[Abstract/Free Full Text]

37. Meyer SL, Bozyczko-Conyne D, Mallya SK, Spasis CM, Bihovsky R, Kawooya JK, Lang DM, Scott RW, Siman R. Biologically active monomeric and heterodimeric recombinant human calpain-I produced using the baculovirus expression system. Biochem J. 1996;314:511–519.




This article has been cited by other articles:


Home page
FASEB J.Home page
D. G. Sedding, M. Homann, U. Seay, H. Tillmanns, K. T. Preissner, and R. C. Braun-Dullaeus
Calpain counteracts mechanosensitive apoptosis of vascular smooth muscle cells in vitro and in vivo
FASEB J, February 1, 2008; 22(2): 579 - 589.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Mamoune, J.-H. Luo, D. A. Lauffenburger, and A. Wells
Calpain-2 as a Target for Limiting Prostate Cancer Invasion
Cancer Res., August 1, 2003; 63(15): 4632 - 4640.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
K. Kataoka, M. Taneda, T. Asai, A. Kinoshita, M. Ito, and R. Kuroda
Structural Fragility and Inflammatory Response of Ruptured Cerebral Aneurysms : A Comparative Study Between Ruptured and Unruptured Cerebral Aneurysms
Stroke, July 1, 1999; 30(7): 1396 - 1401.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Glading, F. Uberall, S. M. Keyse, D. A. Lauffenburger, and A. Wells
Membrane Proximal ERK Signaling Is Required for M-calpain Activation Downstream of Epidermal Growth Factor Receptor Signaling
J. Biol. Chem., June 22, 2001; 276(26): 23341 - 23348.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ariyoshi, H.
Right arrow Articles by Monden, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ariyoshi, H.
Right arrow Articles by Monden, M.