Vitronectin Expression and Interaction With Receptors in Smooth Muscle Cells From Human Atheromatous Plaque

From INSERM Unité 441, Atheroclérose, Pessac, France.

Correspondence to Pascale Dufourcq, INSERM Unité 441, Atheroclérose, Avenue du Haut-Lévêque, 33600 Pessac, France.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Vitronectin (VN) is a plasma glycoprotein that promotes cell attachment and induces migration of human smooth muscle cells (SMCs) in culture. VN has been observed to accumulate in human atherosclerotic plaques, although its origin and role in atherosclerosis are not yet established. In the present experiments, synthesis of VN by intimal cells and its colocalization with receptors, vß3 and vß5, were studied by in situ hybridization and immunohistochemistry on 15 human atherosclerotic plaques from carotid arteries obtained after surgery. Strong VN protein and mRNA expression was observed in the intima and in the media. In the intima, VN mRNA expression was colocalized with SMCs, indicating that these cells produce VN, which may account for its accumulation in atherosclerotic plaques. In SMCs in culture, immunoprecipitation after metabolic labeling demonstrated that human SMCs do synthesize vitronectin. Confocal microscopic examination showed that VN colocalized with its receptors, vß3 and vß5, in the atherosclerotic intima. However, the distribution of the VN receptors on SMCs in culture in contact with VN was different. These observations suggest that VN plays various parts in atherogenesis via different SMC membrane receptors. (Arterioscler Thromb Vasc Biol. 1998;18:168-176.)

Key Words: vitronectin • vitronectin receptors • integrin • smooth muscle cells • atherosclerosis

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Atherosclerosis is characterized by the development of an intimal thickening, which contain monocytes, T lymphocytes, and SMCs with an accumulation of lipid and extracellular matrix proteins.¹ Medial SMCs during this process are activated, lose their differentiated phenotype, proliferate, and migrate into the intima. A number of reports have documented the major role of extracellular matrix proteins, particularly glycoproteins, in these pathological processes.^{2 3 4} VN is one of the glycoproteins accumulated in atherosclerotic plaques,^{5 6} although its origin and role in atherosclerosis have yet to be elucidated.

VN is present in plasma and serum at about 200 to 300 µg/mL,⁷ but in common with other adhesive proteins, it is localized in the extracellular matrices of various tissues, including the vascular wall.⁸ The sites of VN synthesis in vivo are now being identified, with the liver emerging as a major site, although other normal⁹ and pathological tissues may synthesize VN.¹⁰ In the atherosclerotic plaques, the origin of VN could be due to the diffusion of plasmatic VN into the vascular wall, to VN release by activated platelets through damaged endothelium, or to the synthesis of cells participating in the atherosclerotic plaques.

VN is a multifunctional protein with a multiple binding domain that is thought to interact with a variety of plasma and cell proteins.⁸ VN has been shown to be involved in adhesion and migration of SMCs, neural crest cells, and keratinocytes.^{10 11 12} VN has also been shown to induce neurite outgrowth and differentiation¹³ and to promote myocyte differentiation in Drosophilia embryos.¹⁴ In addition, VN may interact with several critical coagulation and fibrinolysis proteins. VN binds and stabilizes PAI-1 in its active conformation^{15 16} and binds to u-PA receptor,¹⁷ suggesting an additional role for VN in the control of protease activity. It has also been suggested that VN interacts with the complement activation system.⁸

VN contains an RGD sequence⁸ that intervenes in binding to integrins, cell surface receptors composed of noncovalently linked and ß subunits.¹⁸ VN recognizes the integrins of the v-dependent system (vß3, vß5, vß1, and vß8 and the platelet receptor IIbß3).¹⁹ It has been demonstrated that VN induces migration of SMCs in vitro, which depends on vß3 expression in these cells.¹¹ vß3 expression has recently been described in human arterial wall in vivo.²⁰ Cellular contacts with extracellular matrix components via various integrins activate signal transduction pathways.²¹ These ultimately lead to alterations in gene expression, which underpin the changes in phenotype, state of differentiation, and migratory behavior of cells.²² Each of these events are thought to play a part in the development of atherosclerotic plaques¹ and point to a role for VN and its receptors in this pathological process.

The present study was designed to find out which cell type produces VN in atherosclerotic plaques and to pinpoint the colocalizations between VN and its receptors, vß3 and vß5. We present evidence that SMCs express and synthesize VN in human carotid plaques. In addition, the distribution of VN was colocalized with its receptors, vß3 and vß5. In vitro studies showed that these receptors bound to VN were not distributed in the same patterns on the surface of SMCs, pointing to a diversity of VN-integrin–triggered mechanisms in these cells.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Tissue Collection
Fifteen specimens of plaque from the internal carotid arteries of patients who underwent surgery for transient ischemic attacks were obtained at surgery. Specimens of radial and mammary arteries obtained during coronary artery surgery and from two aortas obtained during heart transplantation were used as control tissues. All tissues were frozen in isopentane, prechilled in liquid nitrogen, embedded in OCT compound, and stored at -70°C.

Antibodies and Adhesive Ligands
mAbs against human VN (VIT-2) were obtained from Sigma Chemical Company, and the vß5 integrin (P1F6) was obtained from Gibco-BRL. Anti-v (CLB-706) and anti-ß1 (DF5) subunits were purchased from Tebu. Antibodies against human vß3 integrin (LM609) were kindly provided by Dr Cheresh, and anti-vinculin was a gift from Dr M. Glukhova. Human VN and human fibronectin were purchased from Gibco-BRL and Sigma, respectively.

Immunohistochemistry
Seven-micron-thick sections were cut on a cryostat for immunohistochemistry and in situ hybridization. They were dried in air, stored at -70°C, and used within 24 hours. Immunohistochemistry was performed by the indirect immunoperoxidase method as previously described.²³ Serial sections placed on 3-aminopropyl triethoxysilane-coated slides (Sigma) were fixed in 2% PFA for 10 minutes at room temperature. Endogenous peroxidase activity was blocked by incubating the sections in 0.3% hydrogen peroxide. Before staining, cryosections were preincubated for 20 minutes in a blocking solution containing 5% BSA in PBS. Sections were first incubated with primary antibody at appropriate dilutions for 1 hour at room temperature, rinsed with PBS, incubated with biotinylated sheep anti-mouse Ig (Amersham) for 1 hour at room temperature, rinsed in PBS, and covered with streptavidin-horseradish peroxidase complex. After 30 minutes at room temperature, the sections were rinsed in PBS and revealed by incubation with 10% (vol/vol) 3,3'-diaminobenzidine tetrahydrochloride dihydrate in stable peroxide substrate buffer (Interchim). A counterstain of 10% Harris hematoxylin was applied before cover-slipping. The following immunohistochemical controls were performed in each tissue: (1) no primary antibody and (2) preimmune mouse serum as primary monoclonal antibody. The following antibodies were used as cell markers on sections: anti-smooth muscle -actin (1/1000, IA4, Immunotech) to identify SMCs and HAM-56 (1/100, Becton Dickinson) to identify macrophages. An irrelevant isotype-matched immunoglobulin (Sigma) was used as negative control.

To define the colocalization of the VN with its receptors, samples were examined by confocal microscopy. Briefly, the slides were labeled with anti-integrin mAbs identified by anti-Ig mAb coupled with fluorescein isothiocyanate. After several washes and saturation, the slides were sequentially incubated with anti-VN polyclonal antibody, biotinylated sheep anti-mouse Ig, and finally with streptavidin-Texas Red complex (Amersham). The cover slips were mounted in mounting medium for fluorescence H-1000 (Vectashield, Vector Laboratories). Each image was taken at 0.4-µm intervals with a x40 oil-immersion objective on a Diaphot THD microscope. Each section was the average of five scans. The typical Z series is composed of optical sections in the x-y optical plane, while the Z series images were projected simultaneously to obtain the final image.

Cloning of VN cDNA and cRNA Preparation for In Situ Hybridization
Total cellular RNA was prepared from confluent human SMC monolayer and was reverse-transcribed. VN-cDNA was amplified by PCR for 35 cycles at 62°C for annealing using primer sets according to the published cDNA sequence for VN²⁴ (CAAGAAGTGCCAGTGTGA at position 166 and GAAGCTCGAAGATGTCCTCC at position 1019). The 854-bp PCR product obtained was purified, digested into a 650-bp fragment, and subcloned into pBluescript according to standard procedures. The specificity of the PCR product was verified by the DNA sequence of the insert determined using the dideoxy chain-termination method with modified T7 DNA polymerase. It corresponded to the published VN sequence.^{24 25} To construct the riboprobe, pBluescript containing the 650-bp-long human VN cDNA insert was linearized and in vitro-transcribed using T7 and T3 RNA polymerase for sense and antisense, respectively, in the presence of digoxigenin-labeled UTP.

In Situ Hybridization
Seven-micron cryosections were transferred to 3-aminopropyl triethoxysilane-coated slides. Sections were fixed in 4% PFA for 20 minutes, washed, and treated with proteinase K (1 µg/mL) in 0.1 M Tris-HCl and 0.05 M EDTA for 20 minutes. The slides were then rinsed in PBS, treated with glycine (2 mg/mL) for 2 minutes, then incubated in triethanolamine buffer, pH 8, for 5 minutes. After several washes, prehybridization buffer was applied for 30 minutes at 37°C. For hybridization, digoxigenin-labeled riboprobes were added, and hybridization was allowed to proceed overnight at 50°C. After hybridization, sections were incubated twice with 50% formamide and 2x SSC at 55°C for 1 hour, washed twice in 2x SSC, treated with RNase A (20 mg/mL) for 30 minutes, and washed twice in 2x SSC, followed by two 1x SSC washes. The slides were immediately processed for immunohistochemical staining with anti-digoxigenin alkaline phosphatase for 90 minutes. After several washes and saturation, the slides were incubated in 100 mM Tris-HCl, with 100 mM NaCl, 50 mM MgCl₂, and 1 mM levamisole for 5 minutes and overnight at 37°C with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate solution in the same buffer. After washes, the slides were counterstained with Kernechtrot.

Cell Culture
SMCs were isolated from human adult aorta media by enzyme digestion as previously described²³ and cultured in Ham's F10 medium supplemented with 10% fetal calf serum, 5 mM HEPES, 50 U/mL penicillin, and 50 mg/mL streptomycin at 37°C in a 5% CO₂/95% air atmosphere. The experiments were conducted on SMCs at the first passage.

Immunofluorescence Microscopy
Cellular adhesion assays were performed in eight-chamber slides coated with either human purified VN (10 µg/mL) or fibronectin (20 µg/mL) in PBS at 4°C overnight. The wells were then washed with PBS, and nonspecific adherence to the coat wells was blocked with 5% BSA in PBS for 2 hours at 37°C.

Primary human SMCs were removed from the culture plates by brief incubation at 37°C with 0.5 mM EDTA, washed in PBS with Ca²⁺ and Mg²⁺, and resuspended in serum-free medium. The cells were placed in coated wells at a density of 50 000 cell/cm² in serum-free medium. Synthesis of extracellular matrix proteins was inhibited by cycloheximide (25 µg/mL) 2 hours before and during adhesion assays. After 2 hours of adhesion on extracellular matrix proteins, the cells were fixed (2% PFA) and permeabilized with 0.2% Triton X-100. After saturation with 5% BSA in PBS, the cells were immunolabeled with anti-vß3, -vß5, -ß1, -v subunit, or -vitronectin mAbs. The samples were then incubated for 1 hour with anti-Ig mAb coupled with fluorescein isothiocyanate. For double immunofluorescence, after application and labeling of the first mAbs as above, the samples were then incubated for 1 hour with a focal contact marker, anti-vinculin (1/50) mAb, followed by biotinylated sheep anti-mouse Ig and finally with streptavidin-Texas Red complex for 30 minutes. The coverslips were mounted in mounting medium for fluorescence H-1000 and examined with a Microphot-FXA microscope.

Immunoprecipitation and Immunoblotting
For immunoprecipitation experiments, primary SMCs were preincubated for 24 hours in serum-free medium, for 1 hour in methionine-free medium, and metabolically labeled with (³⁵S) methionine and (³⁵S) cysteine (100 µCi/mL) for 18 hours in serum-free medium. The cell supernatants were collected and clarified by centrifugation. The cells were lysed in RIPA buffer (0.05 M Tris-HCl, pH 7.5, 0.15 M NaCl, 1% Triton X-100, 1% deoxycholate, 1 mM EDTA, and proteinase inhibitors) at 4°C. Both culture media and cell lysates were precleared and immunoprecipitated with polyclonal or monoclonal antibodies anti-VN in a rotary shaker overnight, followed by absorption with protein A-Sepharose for 3 hours at 4°C. As control, VN antibodies were preabsorbed on purified VN (10 µg/mL). The Sepharose particles were collected by centrifugation and washed three times in RIPA buffer and twice in PBS and water. The immunocomplexes were eluted from protein A-Sepharose by boiling in Laemmli buffer and analyzed by 7.5% SDS-polyacrylamide gel electrophoresis under reducing conditions. The gel was either dried and exposed for autoradiography or electrophoretically transferred onto nitrocellulose membranes for protein immunoblotting. In this case, the membranes were saturated with 5% BSA and incubated with anti-VN mAb for 1 hour. After several washes, the bound antibody was detected with biotinylated sheep anti-mouse Ig and finally with streptavidin-horseradish peroxidase complex. The immunoblots were developed with the chemiluminescence detection system according to the manufacturer's recommendations (Renaissance, DuPont New England Nuclear). Relative mass was determined using high molecular mass standards (Biolabs, New England).

Flow Cytometry
Expression of v, ß1 subunits, and vß3 and vß5 integrins on human primary SMCs was determined by flow cytometry. Confluent SMCs were harvested by brief incubation in buffer (6 mM glucose, 5.3 mM KCl, 125 mM NaCl, 18 mM HEPES, 0.1x PBS) with 0.5 mM EDTA. After washes in PBS (with Ca²⁺ and Mg²⁺), the cells were incubated with mAbs in PBS for 1 hour at 4°C, washed three times in cold PBS, and resuspended in fluorescein isothiocyanate-conjugated goat anti-mouse Ig for 1 hour at 4°C. After three additional washes, the samples were fixed in 1% PFA. Measurements were made in a Coulter type XL flow cytometer. The mean of the fluorescence channels was evaluated by the computer for each sample. The x axis represents the fluorescence intensity, and the y axis represents the cell number; 10 000 events were analyzed for each sample.

	Results

Top Abstract Introduction Methods Results Discussion References

 
VN Expression in Human Carotid Plaques
We analyzed VN expression on human atherosclerotic plaques obtained from specimens of internal carotid artery after endarteriectomy. Fig 1 shows two human plaques at different stages of progression: a fibrotic plaque comprising SMCs and some macrophages (Fig 1, A through D) and a fibroatheroma lesion with macrophage infiltration and a lipid core (Fig 1, E through G). Serial sections of endarteriectomy fragments were stained for both VN and cell-specific markers for SMCs, smooth muscle -actin (Fig 1, A and E), macrophages (HAM-56) (Fig 1, C and G), and T lymphocytes (anti-CD3 UCHT1, Immunotech) (data not shown). VN labeling was distributed throughout the media of normal and atherosclerotic arteries (Fig 1, B, F, and H). A punctiform VN staining was observed in the intimal thickening of cellular fibrotic plaques (Fig 1, B and F), contrasting with large diffuse masses of VN in the necrotic core of fibroatheroma lesions (Fig 1, F). We found the same labeling with a second antibody, a polyclonal anti-VN. Moreover, preabsorption of mAb anti-VN with purified VN eliminated the pattern observed on carotids arteries (data not shown). It can be seen on Fig 1, B and F, that the intimal VN was mainly expressed on -actin-positive areas, suggesting an association with intimal and medial SMCs. In the fibrous cap, VN labeling was colocalized with HAM-56 staining (Fig 1, F). These results indicated that VN expression was associated with SMCs and sometimes with macrophages in the intimal thickening. On control radial and mammary arteries and normal aorta, a punctiform staining of VN was observed in normal media (Fig 1, H).

View larger version (115K): [in this window] [in a new window]   Figure 1. Expression of VN in carotid artery plaques. Immunohistochemistry on serial sections of carotid arteries. A and E, -actin, B and F, VN, and HAM-56 (G), and C, and negative control (D). A through D, Atherosclerotic plaque with cellular intimal thickening. E through H, Atherosclerotic plaque with extracellular matrix accumulation and necrotic core. VN staining (B and F) was observed in the media and in the intima, associated with -actin (A and E) and HAM-56 staining (G). In advanced plaque, VN was accumulated in the necrotic core (F). As a control, VN expression was studied on specimens of radial artery (H). i indicates intima; m, media; nc, necrotic core; and arrows, internal elastic lamina.

VN mRNA Expression in Human Carotid Plaques
We and others⁵ have detected VN protein in atherosclerotic plaques, although its cellular origin has yet to be established. We therefore wished to find out whether intimal cells synthesize VN in situ. After hybridization with an antisense VN probe, strong mRNA labeling was observed in the intima and media of specimens of human atherosclerotic carotid arteries (Fig 2, A). To identify which cells expressed VN mRNA in the plaques, serial sections were processed for immunohistochemistry with SMCs (Fig 2, C) and macrophage markers (Fig 2, D). In several cases, the plaques were composed of SMCs (Fig 2, C) with occasional macrophages (Fig 2, D). VN mRNA expression colocalized with -actin staining and, in rare instances, with HAM-56 staining. Most of the VN mRNA labeling in the intima was found in SMCs. However, in the plaque, whole SMCs did not express VN mRNA. As shown in Fig 2, A and C, medial SMCs also expressed VN mRNA. A sense VN riboprobe failed to hybridize to carotid arteries, confirming the specificity of the antisense riboprobe (Fig 2, B).

View larger version (161K): [in this window] [in a new window]   Figure 2. Expression of VN mRNA in carotid artery plaques. Cryosections of human carotid arteries were hybridized to antisense (A) and sense (B) VN riboprobe. Hybridization revealed a strong expression of VN mRNA in both intima and media. No staining was observed after hybridization with sense probe. The slides were counterstained with Kernechtrot. On serial sections, immunohistochemical tests were performed with -actin (C) and HAM-56 (D) mAbs, and sections were counterstained with Harris hematoxylin. VN mRNA colocalized with strong SMC expression and rarely with macrophage expression (original magnification x20).

VN Synthesis by SMCs In Vitro
Total RNA of human cultured SMCs was isolated and reverse transcribed, and VN cDNA was amplified by PCR with specific primers. The specificity of the amplified transcripts was confirmed by cloning and sequencing. To find out whether SMCs synthesized and deposited their own VN protein at the cell surface, immunoprecipitation after metabolic labeling was performed. Primary human SMCs were cultured until confluence on medium supplemented with serum. At confluence, SMCs were maintained for 24 hours in serum-free medium, for an additional hour in methionine-free medium, then labeled with 100 µCu/mL of ³⁵S-methionine/³⁵S-cysteine medium. The supernatants of cultured SMCs and the cell lysates were immunoprecipitated with a polyclonal anti-VN antibody. On autoradiography (Fig 3, A), two bands identified at 65 and 75 kd were detected. The same results were obtained when the immunoprecipitation was performed with mAb anti-VN. Moreover, the precipitation of 75- to 65-kd polypeptides was inhibited by preabsorption of the antibody with purified VN (data not shown). Immunoblotting with mAb anti-VN on the same membrane revealed two bands that migrated at the same positions as purified human VN (Fig 3, B). The majority of VN protein was immunoprecipitated from the cell lysate, while only a small amount was found in SMC supernatant. Low-molecular-weight polypeptides were detected, suggesting that VN was proteolytically cleaved from the larger form. On immunofluorescence with mAb anti-VN, a fibrillary pattern of VN deposits was observed on surface membranes of SMCs (Fig 3, C).

View larger version (55K): [in this window] [in a new window]   Figure 3. VN synthesis by SMCs in vitro. Immunoprecipitation of SMCs labeled with 35S-methionine with polyclonal anti-VN antibody on total cell lysate (lane 1) and on total supernatant of SMCs (lane 2). The autoradiograph (A) of SDS-polyacrylamide gel electrophoresis protein separation and the immunoblot (B) exhibit two bands at 65 to 75 kd that migrated at the same position as human purified VN (B, lane 3). Immunofluorescence labeling of cultured SMCs by mAb anti-VN revealed a strong VN staining (C, left). This staining disappeared when mAb was preabsorbed on purified VN (C, right).

Integrin Expression in Human Carotid Plaques
Because VN interacts with different membrane integrin receptors, we looked for vß3 and vß5 on human carotid plaques. Both vß3 and vß5 integrins were expressed in intimal thickening and media (Fig 4, A and B, respectively). On serial sections, vß3 colocalized with -actin staining in the intima (Fig 4, D). Expression of vß5 was less pronounced than that of vß3 in media but stronger in intima of human atherosclerotic plaques (Fig 4, B). Interestingly, vß5 staining colocalized with both -actin and HAM-56 staining (Fig 4, D and E, respectively). In normal arteries, SMCs expressed both vß3 and vß5 (data not shown). On serial sections, VN expression (Fig 4, C) was observed in both the fibrotic acellular part of atherosclerotic plaques and in cellular areas. At higher magnification, VN was clearly colocalized with vß3 on the internal side of the cellular rim of the necrotic core (Fig 4, A), contrasting with the more external expression of vß5 on the rim (Fig 4, B). VN thus appeared to interact with both vß3 and vß5 in human atherosclerotic plaques.

View larger version (86K): [in this window] [in a new window]   Figure 4. Integrin expression on carotid artery plaques. Serial sections of human carotid arteries were immunostained with mAb anti-vß3 (A), vß5 (B), VN (C), -actin (D), and HAM-56 (E) (original magnification: A through E, x5; F through H, x20). i indicates intima; m, media; nc, necrotic core; and arrows, internal elastic lamina.

To pinpoint the interactions between VN and its receptors in situ, carotid plaques were double immunostained for VN and integrins and examined by confocal microscopy. Colocalization of red-labeled VN with green-labeled receptors was indicated by a yellow coloration. It can be seen in Fig 5 that VN was colocalized with both vß3 (Fig 5, A) and vß5 (Fig 5, B) integrins on 0.4-µm-sections of carotid tissue specimens. In contrast, the colocalization between VN and the ß1 subunit in the same area was sparse and scattered in comparison with the massive vß3/VN and vß5/VN colocalization (Fig 5, C).

View larger version (95K): [in this window] [in a new window]   Figure 5. Confocal analysis. Colocalization of VN (red) and VN receptors (green), vß3 (A), vß5 (B), and ß1 (C) were studied after double immunofluorescence on intimal thickening of human carotid arteries. VN and its receptors were visualized on tissue sections by confocal microscopy. All fluorescence images are the average of five frames per 0.4 µm optical section. The colocalization of VN and its receptor was observed in yellow from superimposition of the red and green staining.

Integrin Expression In Vitro
Integrin expression on human aortic SMCs in culture was analyzed by flow cytometry (Fig 6). It can be seen in Fig 6, B, that SMCs strongly expressed the v subunit. Analysis of the ß integrin subunit associated with v showed a higher expression of the vß5 than the vß3 integrin. We did not obtain any direct evidence for vß1 complex expression, although a moderate expression of the ß1 subunit was observed, comparable to that of vß3, indicating a relationship between vß1 and v expression.

View larger version (21K): [in this window] [in a new window]   Figure 6. VN receptor expression on cultured SMCs. Human SMCs were immunolabeled with either primary antibody (A) or antibody against the v (B), vß3 (C), vß5 (D), ß1 (E), or 5 (F) subunits. A fluorescent secondary antibody was applied, and 10 000 cells were analyzed by flow cytometry. The x axes represent fluorescent intensity, and the y axes number of cells. Identical results were obtained in three independent experiments.

To determine the distribution of SMC receptors on the membrane surface, cells were placed on VN-coated plates in the presence of cycloheximide to inhibit the synthesis of extracellular matrix proteins. After 2 hours, the cells were immunostained with a focal contact marker, anti-vinculin mAb (Fig 7, E through G), along with mAb against the v subunit (Fig 7, A), vß3 (Fig 7, B), or vß5 (Fig 7, C) complexes. In the presence of cycloheximide, SMCs were seen to organize focal contacts, as shown by vinculin staining (Fig 7, E through G). As described by Burridge et al,²⁶ we observed an exclusion of the ligand-specific antibody, anti-VN mAb, from focal contacts on cells attached to the VN coat (Fig 7, D). This pointed to an involvement of VN in focal contact organization.

View larger version (67K): [in this window] [in a new window]   Figure 7. Distribution of VN receptors on SMCs. Integrin distribution on human SMCs adherent to VN. Slides were precoated with 10 mg/mL VN, and SMCs were plated and incubated for 2 hours in the presence of cycloheximide. Cells were fixed, permeabilized, and double immunofluorescence labeled with anti-v (A), vß3 (B), vß5 (C), and anti-vinculin (E through G). An exclusion experiment with mAb anti-VN (D) shows focal contact in negative. Arrows point to focal contact organization.

Furthermore, the two VN receptors were distributed differently on SMC surface membranes in contact with VN. vß3 expression was low and punctiform (Fig 7, B) and not associated with focal contact, evidenced by mAb to vinculin (Fig 7, F). In contrast, vß5 staining was both punctiform and in focal contact (Fig 7, C) and codistributed with vinculin staining (Fig 7, G). The v subunit pattern revealed a strong focal contact staining (Fig 7, A) as well as a punctate nonfocal staining on some cells. In control experiments with SMCs placed on fibronectin, vß3 expression was in focal contact in association with vinculin staining, whereas vß5 staining was diffuse (data not shown). No labeling was detected in the absence of primary antibody.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
VN is a multifunctional glycoprotein that appears to play roles in the migration, attachment, and differentiation of cells.^{11 13} The immunohistochemical and hybridization study presented here provides evidence for the expression of VN in human atherosclerotic arteries. VN protein deposits were observed in fibrous plaques and arterial media. Strong labeling was observed deep in the intimal thickening, near the internal elastic lamina. Moreover, VN seemed to be localized around and sometimes within the necrotic core. In the cellular areas of intimal thickening, most VN protein colocalized with the SMC marker -actin, suggesting that much of the VN was associated with SMCs in both atherosclerotic plaques and normal media. In addition, some VN protein was colocalized with macrophage HAM-56 staining. Although VN protein was present in normal media, its expression was markedly elevated in the intima of human atherosclerotic plaques. These results are in line with the accumulation of VN observed by numerous authors in human atherosclerotic plaques associated with cell debris, collagen, and elastin and with an activation of complement.^{6 27} In experimental models, an accumulation of VN expression in arterial wall with no increase in plasma VN has been described in both hypercholesterolemic and mechanically injured aortas²⁸ as well as in Watanabe heritable hyperlipidemic rabbits.²⁹

An accumulation of VN protein within the plaque was demonstrated immunohistochemically, although the source of the arterial VN was not clear. It may have diffused from plasma, been secreted by activated platelets or been synthesized by cells in the plaque. To determine whether cells in atherosclerotic lesions synthesize VN and whether intimal SMCs remodel their extracellular matrix via VN, we carried out an immunolabeling and in situ hybridization study of human atheromatous carotid arteries. We found that a large population of SMCs and a few macrophages expressed VN mRNA. It is of interest that the VN mRNA expression was not restricted to pathological intimal SMCs, because some expression was also observed in medial SMCs. Therefore, normal medial SMCs as well as SMCs in the intima appear to synthesize VN, which would account for its presence in the arterial wall. Some of the VN in atherosclerotic plaques may be derived from increased VN synthesis by SMCs induced by cytokines or growth factors secreted by cells in the plaques. In this respect, in vitro studies have shown that TGF-ß, like IL-6, upregulates VN mRNA and protein in Hep G2 cells.³⁰ In our study, we did not find any induction of VN mRNA in cultured human SMCs after treatment with TGF-ß (data not shown). However, we cannot rule out a diffusion of VN from plasma into the arterial wall. Indeed, plasmatic VN may be trapped and internalized by endothelial cells.³¹ This suggested that VN binds to the endothelial surface and may be involved in receptor-ligand endocytosis.

The expression of VN by SMCs was supported by the in vitro findings on cultured human SMCs. VN mRNA was detected in these cells, and we showed by immunoprecipitation after metabolic labeling that they synthesized and deposited their own VN protein. Primary cultured SMC expressed the two VN forms at 65 and 75 kd, corresponding to the two well-characterized forms of human VN.³² Smaller polypeptides were also detected and were thought to be proteolytic fragments. In this respect, it has been reported that VN can be cleaved and degraded by various enzymes. For example, plasmin cleaves VN into 61- to 63-, 56-, 42-, and 35-kd polypeptides.³³ The small amounts of VN protein detected in SMC supernatant suggested that most of the synthesized VN was associated with cells. The immunofluorescence labeling studies showed that it was anchored on the membrane surface in a fibrillary distribution. We therefore concluded that SMCs produce and deposit their own VN.

With respect to cell-matrix interactions, VN interacts with the cell surface via integrins containing the v subunit.^{34 35} This integrin subunit is associated with multiple ß chains, including ß1, ß3, ß5, and ß8. Among these heterodimers, vß3, vß5, and vß1 are expressed on SMCs.^{36 37} We examined the localization of VN-binding integrins, vß3 and vß5, on human carotid arteries, and we present evidence that both receptors are expressed in human atherosclerotic plaques. The intimal and medial expression of vß3 in human arteries has been reported by Hoshiga et al.²⁰ We present here the first evidence of vß5 expression in atherosclerotic lesions. On serial sections in situ, vß5 integrin appeared to be expressed by both SMCs and macrophages, which is consistent with the demonstration of vß5 expression by macrophages³⁸ and SMCs in vitro.⁴ Interestingly, vß3 and vß5 staining was observed in VN-positive areas. To obtain more evidence of a colocalization of VN with its receptors, sections of artery were examined by confocal microscopy. VN was observed together with vß3 and vß5 receptors in the fibrous cap of atherosclerotic lesions. These results were supported by the in vitro findings that human cultured SMCs express both vß3 and vß5 and adhere to VN. However, it can be seen in Figure that not all vß3 and vß5 integrins were associated with VN ligand. It is known that vß3 and vß5 interact with several ligands, including fibronectin and osteopontin,^{4 39 40} These extracellular matrix proteins are all expressed in atherosclerotic plaques.^{41 42} We found that the VN receptors vß3 and vß5 and the v integrin subunit exhibited different patterns of expression in contact with VN on the surface of SMCs. The vß3 integrin was observed in a punctiform and diffuse distribution on VN and was not concentrated in focal contacts. This is not in agreement with the findings of Clyman et al,³⁶ but they used a mAb against ß3 subunit and ductal SMCs rather than the arterial SMCs used in the present study. In contrast to the distribution of vß3, vß5 was observed in both punctiform and in focal adhesion sites of the SMC-VN interactions, contrasting with the diffuse distribution on fibronectin. So, SMC vß5 can be organized in focal adhesion plaque in contact with VN. Similarly, the v and ß1 subunits (data not shown) were distributed in focal contact, suggesting that vß1 was abundant in focal adhesion sites, although we were unable to precisely localize the complex vß1 itself. The participation of ß1 subunit integrin in focal adhesion sites on SMCs has been reported by others.³⁶ vß3 expression on SMCs has been demonstrated to be involved in SMC migration.^{11 37 43} The functional roles of the vß5 integrins on SMCs are as yet unknown. For instance, it has been demonstrated that keratinocytes migrate on VN via vß5 only after activation by growth factors.⁴⁴ Many extracellular matrix proteins have been shown to transmit signals via integrins, giving rise to a variety of intracellular processes, including tyrosine phosphorylation, an increase in intracellular pH, and calcium flux.^{21 45 46 47} The distributions of VN receptors on the cell surface as well as in atherosclerotic plaques suggest that various functional changes may be induced by VN in SMCs via different signal transducers.

The pathophysiological significance of VN in atherosclerotic plaques is still unclear, although several lines of evidence point to a role for VN in the cellular processes involved in atherogenesis. Migration of SMCs into the intima layer is an important contributor to the intimal thickening in atherosclerotic lesions,¹ and it has been shown that VN mediates chemotactic and haptotatic activities of SMC in vitro.¹¹ Furthermore, the migration on VN is dependent on the vitronectin receptor, vß3,¹¹ which is strongly expressed in human atherosclerotic plaques. VN could thus play a role in the recruitment of SMCs from the media to the intima. Peptides that bind to vß3 receptor have been found to reduce neointima formation after balloon injury in rabbit and hamster arteries.^{48 49} Although vß3 binds several extracellular matrix proteins, VN could be involved in the regulation of cellular recruitment. Interestingly, PAI-1, which is highly expressed in human atherosclerotic plaques,⁵⁰ may block SMC migration on VN by hindering its access to the VN receptor.⁴³ Indeed, PAI-1-binding sites for VN overlap the region containing RGD cell attachment sites for the VN receptor.¹⁶ The VN synthesized and secreted by SMCs may thus modulate its effect on migration as a function of its affinities for the two substrates, PAI-1 or the integrin vß3. Moreover, because VN stabilizes PAI-1 in extracellular matrix proteins,¹⁵ thereby protecting them from plasminogen activator-mediated degradation, it may help stabilize plaques.

In conclusion, we show here that (1) VN protein and mRNA are expressed in human carotid artery plaques; (2) SMCs synthesize VN in the plaque, which may account for its accumulation; (3) vß3 and vß5 integrins are expressed in these plaques and colocalize with VN in the intima; and (4) these integrins were differently distributed on the membrane surface. Comprehension of the true functions of VN and its interactions with its receptors in atherosclerotic lesions will have to await the results of further studies.

	Selected Abbreviations and Acronyms

 

Ig = immunoglobulin IL = interleukin mAb = monoclonal antibody PAI = plasminogen activator inhibitor PCR = polymerase chain reaction PFA = paraformaldehyde RIPA = radioimmunoprecipitation assay RGD = Arg-Gly-Asp SMC = smooth muscle cell SSC = sodium chloride/sodium citrate TGF = tumor growth factor VN = vitronectin

	Acknowledgments

 
We thank Dr Francis Belloc for his excellent technical assistance in the experiments with flow cytometry. This study was supported by the Conseil Regional d'Aquitaine and the Reseau de Recherche Clinique INSERM No. 494014.

Received June 11, 1997; accepted September 6, 1997.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol.. 1995;57:791-804.[Medline] [Order article via Infotrieve]

2. Hedin U, Bottger BA, Forsberg E, Johansson S, Thyberg J. Diverse effects of fibronectin and laminin on phenotypic properties of cultured arterial smooth muscle cells. J Cell Biol.. 1988;107:307-319.[Abstract/Free Full Text]

3. Thyberg J, Hedin U, Sjölund M, Palmberg L, Bottger BA. Regulation of differentiated properties and proliferation of arterial smooth muscle cells. Arteriosclerosis.. 1990;10:966-990.[Free Full Text]

4. Liaw L, Skinner MP, Raines EW, Ross R, Cheresh D, Schwaertz SM. The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins. J Clin Invest.. 1995;95:713-724.

5. Niculescu F, Rus HG, Vlaicu R. Immunohistochemical localization of C5b-9, S-protein, C3d and apolipoprotein B in human arterial tissues with atherosclerosis. Atherosclerosis.. 1987;65:1-11.[Medline] [Order article via Infotrieve]

6. Guettier C, Hinglais N, Bruneval P, Kazatchkine M, Bariety J. Immunohistochemical localisation of S protein/vitronectin in human atherosclerotic versus atherosclerotic arteries. Virchows Arch A Pathol Anat Histopathol.. 1989;414:309-313.[Medline] [Order article via Infotrieve]

7. Preissner K, Wassmuth R, Muller-Berghaus G. Physiochemical characterisation of human S protein and its function in the blood coagulation system. Biochem J.. 1985;231:349-355.[Medline] [Order article via Infotrieve]

8. Preisner KT. Structure and biological role of vitronectin. Annu Rev Cell Biol.. 1991;7:275-310.

9. Seiffert D, Iruelaarispe M, Sage E, Loskutoff D. Distribution of vitronectin mRNA during murine development. Dev Dyn.. 1995;203:71-79.[Medline] [Order article via Infotrieve]

10. Gladson C, Wilcox J, Sanders L, Gillespie G, Cheresh D. Cerebral microenvironment influences expression of the vitronectin gene in astrocytic tumors. J Cell Sci.. 1995;108:947-956.[Abstract]

11. Brown SL, Lundgren CH, Nordt T, Fujii S. Stimulation of migration of human aortic smooth muscle cells by vitronectin: implications for atherosclerosis. Cardiovasc Res.. 1994;28:1815-1820.[Abstract/Free Full Text]

12. Delannet M, Martin F, Bossy B, Cheresh D, Reichardt L, Duband J. Specific roles of the alpha V beta 1, alpha V beta 3 and alpha V beta 5 integrins in avian neural crest cell adhesion and migration on vitronectin. Development.. 1994;120:2687-2702.[Abstract/Free Full Text]

13. Martinez-Morales J, Marti E, Frade J, Rodrigueztebar A. Developmentally regulated vitronectin influences cell differentiation, neuron survival and process outgrowth in the developing chicken retina. Neuroscience.. 1995;68:245-253.[Medline] [Order article via Infotrieve]

14. Gullberg D, Fessler LI, Fessler JH. Differentiation, extracellular matrix synthesis, and integrin essembly by Drosophilia embryo cells cultured on vitronectin and laminine substrates. Dev Dyn.. 1994;199:116-128.[Medline] [Order article via Infotrieve]

15. Sigurdardottir O, Wiman B. Identification of a PAI-1 binding site in vitronectin. Biochim Biophys Acta.. 1994;1208:104-110.[Medline] [Order article via Infotrieve]

16. Seiffert D, Ciambrone G, Wagner N, Binder B, Loskotoff D. The somatomedin B domain of the vitronectin. J Biol Chem.. 1994;269:2659-2666.[Abstract/Free Full Text]

17. Wei Y, Waltz D, Rao N, Drummond RJ, Rosenberg S, Chapman HA. Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem.. 1994;269:32380-32388.[Abstract/Free Full Text]

18. Ruoslahti E. Integrins. J Clin Invest.. 1991;87:1-5.

19. Hynes RO. Integrins: versatility, modulation, and sygnaling in cell adhesion. Cell.. 1992;69:11-25.[Medline] [Order article via Infotrieve]

20. Hoshiga M, Alpers CE, Smith LL, Giachelli CM, Schwartz SM. vß3 integrin expression in normal and atherosclerotic artery. Circ Res.. 1995;77:1129-1135.[Abstract/Free Full Text]

21. Juliano RL, Haskill S. Signal transduction from the extracellular matrix. J Cell Biol.. 1993;120:577-585.[Free Full Text]

22. Adams JC, Watt FM. Regulation of development and differentiation by the extracellular matrix. Development.. 1993;117:1183-1198.[Medline] [Order article via Infotrieve]

23. Duplàa C, Couffinhal T, Dufourcq P, Llanas B, Moreau C, Bonnet J. The integrin very late antigen-4 is expressed in human smooth muscle cell. Circ Res.. 1997;80:159-169.[Abstract/Free Full Text]

24. Jenne D, Stanley KK. Nucleotide sequence and organization of the human S-protein gene: repeating peptide motifs in the pexin family and a model for their evolution. Biochemistry.. 1987;26:6737-6742.

25. Suzuki S, Oldberg A, Hayman EG, Pierschbacher MD, Ruoslahti E. Complete amino acid sequence of human vitronectin deduced from cDNA. EMBO J.. 1985;4:2519-2524.[Medline] [Order article via Infotrieve]

26. Burridge K, Fath K, Kelly TN, Nuckolls G, Turner C. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu Rev Cell Biol.. 1988;4:487-525.

27. Niculescu F, Rus HG, Porutiu D, Ghiurca V, Vlaicu R. Immunoelectron-microscopic localisation of S-protein/vitronectin in human atherosclerotic wall. Atherosclerosis.. 1989;78:197-203.[Medline] [Order article via Infotrieve]

28. Sawa H, Sobel BE, Fujii S. Potentiation by hypercholesterolemia of the induction of aortic intramural synthesis of plasminogen activator inhibitor type-1 by endothelial injury. Circ Res.. 1993;73:671-680.[Abstract/Free Full Text]

29. Sato R, Komine Y, Imada T, Takano T. Monoclonal antibody EMR 1a/212D recognizing site of deposition of extracellular lipid in atherosclerosis: isolation and characterisation of a cDNA clone for the antigen. J Biol Chem.. 1990;265:21232-21236.[Abstract/Free Full Text]

30. Koli K, Lohi J, Hautanen A, Keski-Oja J. Enhancement of vitronectin expression in human HepG2 hepatoma cells by transforming growth factor-ß1. Eur J Biochem.. 1991;199:337-345.[Medline] [Order article via Infotrieve]

31. Deboer HC, Preissner KT, Bouma BN, Degroot PG. Internalization of vitronectin-thrombin-antithrombin complex by endothelial cells leads to deposition of the complex into the subendothelial matrix. J Biol Chem.. 1995;270:30733-30740.[Abstract/Free Full Text]

32. Barnes DW, Silnutzer J, See C, Shaffer M. Characterization of human serum spreading factor with monoclonal antibody. Proc Natl Acad Sci U S A.. 1983;80:1362-1366.[Abstract/Free Full Text]

33. Kost C, Benner K, Stockmann A, Linder D, Preissner KT. Limited plasmin proteolysis of vitronectin. Eur J Biochem.. 1996;236:682-688.[Medline] [Order article via Infotrieve]

34. Felding-Habermann B, Mueller BM, Romerdahl CA, Cheresh DA. Involvement of integrin av gene expression in human melanoma tumorigenicity. J Clin Invest.. 1992;89:2018-2022.

35. Leavesley DI, Ferguson GD, Wayner EA, Cheresh DA. Requirement of the integrin b3 subunit for carcinoma cell spreading or migration on vitronectin and fibrinogen. J Cell Biol.. 1992;117:1101-1107.[Abstract/Free Full Text]

36. Clyman RI, Mauray F, Kramer RH. ß1 and ß3 integrins have different roles in the adhesion and migration of vascular smooth muscle cells on extracellular matrix. Exp Cell Res.. 1992;200:272-284.[Medline] [Order article via Infotrieve]

37. Jones JI, Prevette T, Gockerman A, Clemmons DR. Ligand occupancy of the vß3 integrin is necessary for smooth muscle cells to migrate in response to insulin-like growth factor I. Proc Natl Acad Sci U S A.. 1996;93:2482-2487.[Abstract/Free Full Text]

38. De Nichilo MO, Yamada KM. Integrin avb5-dependent serine phosphorylation of paxillin in cultured human macrophages adherent to vitronectin. J Biol Chem.. 1996;271:11016-11022.[Abstract/Free Full Text]

39. Cheresh D. Human endothelial cells synthesized and expressed an Arg-Gly-Asp directed adhesion receptor involved in attachment to fibrinogen and von Willebrand factor. Proc Natl Acad Sci U S A.. 1987;84:6471-6475.[Abstract/Free Full Text]

40. Smith J, Vestal D, Irwin S, Burke T, Cheresh D. Purification and functional characterisation of integrin vß5. J Biol Chem.. 1990;265:11008-11013.[Abstract/Free Full Text]

41. Clausell N, Delima V, Molossi S, et al. Expression of tumour necrosis factor alpha and accumulation of fibronectin in coronary artery restenotic lesions retrieved by atherectomy. Br Heart J.. 1995;73:534-539.[Abstract/Free Full Text]

42. Giachelli C, Bae N, Almeida M, Denhardt D, Alpers C, Schwartz S. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest.. 1993;92:1686-1696.

43. Stefansson S, Lawrence DA. The serpin PAI-1 inhibits cell migration by blocking integrin vß3 binding to vitronectin. Nature.. 1996;383:441-443.[Medline] [Order article via Infotrieve]

44. Yebra M, Filardo E, Bayna E, Kawahara E, Becker J, Cheresh D. Induction of carcinoma cell migration on vitronectin by NF-kappa B-dependent gene expression. Mol Biol Cell.. 1995;6:841-850.[Abstract]

45. Rosales C, Obrien V, Kornberg L, Juliano R. Signal transduction by cell adhesion receptors. Biochim Biophys Acta.. 1995;1242:77-98.[Medline] [Order article via Infotrieve]

46. Schwartz MA. Integrins as signal transducing receptors. In: Tanaka Y, ed. Integrins. Boca Raton, Fla: CRC Press, 1994:33–47.

47. Guan J, Shalloway D. Regulation of focal adhesion-associated protein tyrosine kinase by both cellular adhesion and oncogenic transformation. Nature.. 1992;358:690-692.[Medline] [Order article via Infotrieve]

48. Choi ETM, Engel LP, Callow ADMP, et al. Inhibition of neointimal hyperplasia by blocking vß3 integrin with a small peptide antagonist GpenGRGDSPCA. J Vasc Surg.. 1994;19:125-134.[Medline] [Order article via Infotrieve]

49. Matsumo H, Stassen JM, Vermylen J, Deckmyn H. Inhibition of integrin function by a cyclic RGD-containing peptide prevents neointima formation. Circulation.. 1994;90:2203-2206.[Abstract/Free Full Text]

50. Lupu F, Heim DA, Bachmann F, Hurni M, Kakkar VV, Kruithof EKO. Plasminogen activator expression in human atherosclerotic lesions. Arterioscler Thromb.. 1995;15:1444-1455.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. Wu, L. Peng, G. A. McMahon, D. A. Lawrence, and W. P. Fay Recombinant Plasminogen Activator Inhibitor-1 Inhibits Intimal Hyperplasia Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1565 - 1570. [Abstract] [Full Text] [PDF]

				W. Derer, E. S. Barnathan, E. Safak, P. Agarwal, H. Heidecke, M. Mockel, M. Gross, C. Oezcelik, R. Dietz, and R. Dechend Vitronectin Concentrations Predict Risk in Patients Undergoing Coronary Stenting Circ Cardiovasc Interv, February 1, 2009; 2(1): 14 - 19. [Abstract] [Full Text] [PDF]

				R. Robert, M.-J. Jacobin-Valat, D. Daret, S. Miraux, A. T. Nurden, J.-M. Franconi, and G. Clofent-Sanchez Identification of Human scFvs Targeting Atherosclerotic Lesions: SELECTION BY SINGLE ROUND IN VIVO PHAGE DISPLAY J. Biol. Chem., December 29, 2006; 281(52): 40135 - 40143. [Abstract] [Full Text] [PDF]

				H. Ekmekci, O. B. Ekmekci, H. Sonmez, Z. Ozturk, N. Domanic, and E. Kokoglu Evaluation of Fibronectin, Vitronectin, and Leptin Levels in Coronary Artery Disease: Impacts on Thrombosis and Thrombolysis Clinical and Applied Thrombosis/Hemostasis, January 1, 2005; 11(1): 63 - 70. [Abstract] [PDF]

				S. M. Kanse, R. L. Matz, K. T. Preissner, and K. Peter Promotion of Leukocyte Adhesion by a Novel Interaction Between Vitronectin and the {beta}2 Integrin Mac-1 ({alpha}M{beta}2, CD11b/CD18) Arterioscler Thromb Vasc Biol, December 1, 2004; 24(12): 2251 - 2256. [Abstract] [Full Text] [PDF]

				P. Stawowy, H. Kallisch, J. P. Veinot, A. Kilimnik, W. Prichett, S. Goetze, N. G. Seidah, M. Chretien, E. Fleck, and K. Graf Endoproteolytic Activation of {alpha}v Integrin by Proprotein Convertase PC5 Is Required for Vascular Smooth Muscle Cell Adhesion to Vitronectin and Integrin-Dependent Signaling Circulation, February 17, 2004; 109(6): 770 - 776. [Abstract] [Full Text] [PDF]

				S. M. Kanse, T. Chavakis, N. Al-Fakhri, K. Hersemeyer, D. Monard, and K. T. Preissner Reciprocal regulation of urokinase receptor (CD87)-mediated cell adhesion by plasminogen activator inhibitor-1 and protease nexin-1 J. Cell Sci., January 22, 2004; 117(3): 477 - 485. [Abstract] [Full Text] [PDF]

				S. Konstantinides, K. Schafer, and D. J. Loskutoff Do PAI-1 and Vitronectin Promote or Inhibit Neointima Formation?: The Exact Role of the Fibrinolytic System in Vascular Remodeling Remains Uncertain Arterioscler Thromb Vasc Biol, December 1, 2002; 22(12): 1943 - 1945. [Full Text] [PDF]

				U. Kintscher, C. Lyon, S. Wakino, D. Bruemmer, X. Feng, S. Goetze, K. Graf, A. Moustakas, B. Staels, E. Fleck, et al. PPAR{alpha} Inhibits TGF-{beta}-Induced {beta}5 Integrin Transcription in Vascular Smooth Muscle Cells by Interacting With Smad4 Circ. Res., November 29, 2002; 91 (11): e35 - e44. [Abstract] [Full Text] [PDF]

				A. C. Newby Vitronectin is implicated as the matrix takes control of neointima formation Cardiovasc Res, March 1, 2002; 53(4): 779 - 781. [Full Text] [PDF]

				P. Dufourcq, T. Couffinhal, P. Alzieu, D. Daret, C. Moreau, C. Duplaa, and J. Bonnet Vitronectin is up-regulated after vascular injury and vitronectin blockade prevents neointima formation Cardiovasc Res, March 1, 2002; 53(4): 952 - 962. [Abstract] [Full Text] [PDF]

				E. P. Moiseeva Adhesion receptors of vascular smooth muscle cells and their functions Cardiovasc Res, December 1, 2001; 52(3): 372 - 386. [Abstract] [Full Text] [PDF]

				F. Paulhe, C. Racaud-Sultan, A. Ragab, C. Albiges-Rizo, H. Chap, N. Iberg, O. Morand, and B. Perret Differential Regulation of Phosphoinositide Metabolism by alpha Vbeta 3 and alpha Vbeta 5 Integrins upon Smooth Muscle Cell Migration J. Biol. Chem., November 2, 2001; 276(45): 41832 - 41840. [Abstract] [Full Text] [PDF]

				S. Konstantinides, K. Schafer, T. Thinnes, and D. J. Loskutoff Plasminogen Activator Inhibitor-1 and Its Cofactor Vitronectin Stabilize Arterial Thrombi After Vascular Injury in Mice Circulation, January 30, 2001; 103(4): 576 - 583. [Abstract] [Full Text] [PDF]

				J. H Baron, E. P Moiseeva, D. P de Bono, K. R Abrams, and A. H Gershlick Inhibition of vascular smooth muscle cell adhesion and migration by c7E3 Fab (abciximab): a possible mechanism for influencing restenosis Cardiovasc Res, December 1, 2000; 48(3): 464 - 472. [Abstract] [Full Text] [PDF]

				A. A. Stoop, F. Lupu, and H. Pannekoek Colocalization of Thrombin, PAI-1, and Vitronectin in the Atherosclerotic Vessel Wall : A Potential Regulatory Mechanism of Thrombin Activity by PAI-1/Vitronectin Complexes Arterioscler Thromb Vasc Biol, April 1, 2000; 20(4): 1143 - 1149. [Abstract] [Full Text] [PDF]

				J. G. Pickering, L. H. Chow, S. Li, K. A. Rogers, E. F. Rocnik, R. Zhong, and B. M. C. Chan {alpha}5{beta}1 Integrin Expression and Luminal Edge Fibronectin Matrix Assembly by Smooth Muscle Cells after Arterial Injury Am. J. Pathol., February 1, 2000; 156(2): 453 - 465. [Abstract] [Full Text] [PDF]

				E. P Moiseeva, Q. Javed, E. L Spring, and D. P de Bono Galectin 1 is involved in vascular smooth muscle cell proliferation Cardiovasc Res, January 14, 2000; 45(2): 493 - 502. [Abstract] [Full Text] [PDF]

				K. R. Coleman, G. A. Braden, M. C. Willingham, and D. C. Sane Vitaxin, a Humanized Monoclonal Antibody to the Vitronectin Receptor ({alpha}vß3), Reduces Neointimal Hyperplasia and Total Vessel Area After Balloon Injury in Hypercholesterolemic Rabbits Circ. Res., June 11, 1999; 84(11): 1268 - 1276. [Abstract] [Full Text] [PDF]

				E. Tahvanainen, P. Pajukanta, K. Porkka, S. Nieminen, L. Ikavalko, I. Nuotio, M.-R. Taskinen, L. Peltonen, and C. Ehnholm Haplotypes of the ApoA-I/C-III/A-IV Gene Cluster and Familial Combined Hyperlipidemia Arterioscler Thromb Vasc Biol, November 1, 1998; 18(11): 1810 - 1817. [Abstract] [Full Text] [PDF]

				P. Pajukanta, K. V.K. Porkka, M. Antikainen, M.-R. Taskinen, M. Perola, S. Murtomaki-Repo, S. Ehnholm, I. Nuotio, L. Suurinkeroinen, A.-T. Lahdenkari, et al. No Evidence of Linkage Between Familial Combined Hyperlipidemia and Genes Encoding Lipolytic Enzymes in Finnish Families Arterioscler Thromb Vasc Biol, May 1, 1997; 17(5): 841 - 850. [Abstract] [Full Text]

				H. Chaulet, C. Desgranges, M.-A. Renault, F. Dupuch, G. Ezan, F. Peiretti, G. Loirand, P. Pacaud, and A.-P. Gadeau Extracellular Nucleotides Induce Arterial Smooth Muscle Cell Migration Via Osteopontin Circ. Res., October 26, 2001; 89(9): 772 - 778. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dufourcq, P. Articles by Bonnet, J. Search for Related Content PubMed PubMed Citation Articles by Dufourcq, P. Articles by Bonnet, J.