Original Contributions |
From INSERM Unité 441, Atheroclérose, Pessac, France.
Correspondence to Pascale Dufourcq, INSERM Unité 441, Atheroclérose, Avenue du Haut-Lévêque, 33600 Pessac, France.
| Abstract |
|---|
|
|
|---|
vß3 and
vß5,
were studied by in situ hybridization and immunohistochemistry on 15
human atherosclerotic plaques from carotid arteries obtained after
surgery. Strong VN protein and mRNA expression was observed in the
intima and in the media. In the intima, VN mRNA expression was
colocalized with SMCs, indicating that these cells produce VN, which
may account for its accumulation in atherosclerotic plaques. In SMCs in
culture, immunoprecipitation after metabolic labeling
demonstrated that human SMCs do synthesize vitronectin.
Confocal microscopic examination showed that VN colocalized with its
receptors,
vß3 and
vß5, in the atherosclerotic intima.
However, the distribution of the VN receptors on SMCs in culture in
contact with VN was different. These observations suggest that VN plays
various parts in atherogenesis via different SMC membrane receptors.
(Arterioscler Thromb Vasc Biol.
1998;18:168-176.)
Key Words: vitronectin vitronectin receptors integrin smooth muscle cells atherosclerosis
| Introduction |
|---|
|
|
|---|
VN is present in plasma and serum at about 200 to 300 µg/mL,7 but in common with other adhesive proteins, it is localized in the extracellular matrices of various tissues, including the vascular wall.8 The sites of VN synthesis in vivo are now being identified, with the liver emerging as a major site, although other normal9 and pathological tissues may synthesize VN.10 In the atherosclerotic plaques, the origin of VN could be due to the diffusion of plasmatic VN into the vascular wall, to VN release by activated platelets through damaged endothelium, or to the synthesis of cells participating in the atherosclerotic plaques.
VN is a multifunctional protein with a multiple binding domain that is thought to interact with a variety of plasma and cell proteins.8 VN has been shown to be involved in adhesion and migration of SMCs, neural crest cells, and keratinocytes.10 11 12 VN has also been shown to induce neurite outgrowth and differentiation13 and to promote myocyte differentiation in Drosophilia embryos.14 In addition, VN may interact with several critical coagulation and fibrinolysis proteins. VN binds and stabilizes PAI-1 in its active conformation15 16 and binds to u-PA receptor,17 suggesting an additional role for VN in the control of protease activity. It has also been suggested that VN interacts with the complement activation system.8
VN contains an RGD sequence8 that intervenes in binding to
integrins, cell surface receptors composed of noncovalently linked
and ß subunits.18 VN recognizes the integrins of the
v-dependent system (
vß3,
vß5,
vß1, and
vß8 and
the platelet receptor
IIbß3).19 It has been
demonstrated that VN induces migration of SMCs in vitro, which depends
on
vß3 expression in these cells.11
vß3
expression has recently been described in human arterial
wall in vivo.20 Cellular contacts with extracellular
matrix components via various integrins activate signal
transduction pathways.21 These ultimately lead to
alterations in gene expression, which underpin the changes in
phenotype, state of differentiation, and migratory behavior of
cells.22 Each of these events are thought to play a part
in the development of atherosclerotic plaques1 and point
to a role for VN and its receptors in this pathological process.
The present study was designed to find out which cell type produces
VN in atherosclerotic plaques and to pinpoint the colocalizations
between VN and its receptors,
vß3 and
vß5. We present
evidence that SMCs express and synthesize VN in human carotid plaques.
In addition, the distribution of VN was colocalized with its receptors,
vß3 and
vß5. In vitro studies showed that these receptors
bound to VN were not distributed in the same patterns on the surface of
SMCs, pointing to a diversity of VN-integrintriggered mechanisms in
these cells.
| Methods |
|---|
|
|
|---|
Antibodies and Adhesive Ligands
mAbs against human VN (VIT-2) were obtained from Sigma Chemical
Company, and the
vß5 integrin (P1F6) was obtained from Gibco-BRL.
Anti-
v (CLB-706) and anti-ß1 (DF5) subunits were purchased from
Tebu. Antibodies against human
vß3 integrin (LM609) were kindly
provided by Dr Cheresh, and anti-vinculin was a gift from Dr M.
Glukhova. Human VN and human fibronectin were purchased from Gibco-BRL
and Sigma, respectively.
Immunohistochemistry
Seven-micron-thick sections were cut on a cryostat for
immunohistochemistry and in situ hybridization. They were dried in air,
stored at -70°C, and used within 24 hours. Immunohistochemistry was
performed by the indirect immunoperoxidase method as previously
described.23 Serial sections placed on 3-aminopropyl
triethoxysilane-coated slides (Sigma) were fixed in 2% PFA for 10
minutes at room temperature. Endogenous peroxidase activity
was blocked by incubating the sections in 0.3% hydrogen peroxide.
Before staining, cryosections were preincubated for 20 minutes in a
blocking solution containing 5% BSA in PBS. Sections were first
incubated with primary antibody at appropriate dilutions for 1 hour at
room temperature, rinsed with PBS, incubated with biotinylated sheep
anti-mouse Ig (Amersham) for 1 hour at room temperature, rinsed in PBS,
and covered with streptavidin-horseradish peroxidase complex. After 30
minutes at room temperature, the sections were rinsed in PBS and
revealed by incubation with 10% (vol/vol) 3,3'-diaminobenzidine
tetrahydrochloride dihydrate in stable peroxide substrate buffer
(Interchim). A counterstain of 10% Harris hematoxylin was applied
before cover-slipping. The following immunohistochemical controls were
performed in each tissue: (1) no primary antibody and (2) preimmune
mouse serum as primary monoclonal antibody. The following antibodies
were used as cell markers on sections: anti-smooth muscle
-actin
(1/1000, IA4, Immunotech) to identify SMCs and HAM-56 (1/100, Becton
Dickinson) to identify macrophages. An irrelevant
isotype-matched immunoglobulin (Sigma) was used as negative
control.
To define the colocalization of the VN with its receptors, samples were examined by confocal microscopy. Briefly, the slides were labeled with anti-integrin mAbs identified by anti-Ig mAb coupled with fluorescein isothiocyanate. After several washes and saturation, the slides were sequentially incubated with anti-VN polyclonal antibody, biotinylated sheep anti-mouse Ig, and finally with streptavidin-Texas Red complex (Amersham). The cover slips were mounted in mounting medium for fluorescence H-1000 (Vectashield, Vector Laboratories). Each image was taken at 0.4-µm intervals with a x40 oil-immersion objective on a Diaphot THD microscope. Each section was the average of five scans. The typical Z series is composed of optical sections in the x-y optical plane, while the Z series images were projected simultaneously to obtain the final image.
Cloning of VN cDNA and cRNA Preparation for In Situ
Hybridization
Total cellular RNA was prepared from confluent human SMC
monolayer and was reverse-transcribed. VN-cDNA was amplified by PCR for
35 cycles at 62°C for annealing using primer sets according to the
published cDNA sequence for VN24 (CAAGAAGTGCCAGTGTGA at
position 166 and GAAGCTCGAAGATGTCCTCC at position 1019). The 854-bp PCR
product obtained was purified, digested into a 650-bp fragment, and
subcloned into pBluescript according to standard procedures. The
specificity of the PCR product was verified by the DNA sequence of
the insert determined using the dideoxy chain-termination method with
modified T7 DNA polymerase. It corresponded to the published VN
sequence.24 25 To construct the riboprobe, pBluescript
containing the 650-bp-long human VN cDNA insert was linearized and in
vitro-transcribed using T7 and T3 RNA polymerase for sense and
antisense, respectively, in the presence of digoxigenin-labeled
UTP.
In Situ Hybridization
Seven-micron cryosections were transferred to 3-aminopropyl
triethoxysilane-coated slides. Sections were fixed in 4% PFA for 20
minutes, washed, and treated with proteinase K (1 µg/mL) in 0.1 M
Tris-HCl and 0.05 M EDTA for 20 minutes. The slides were then rinsed in
PBS, treated with glycine (2 mg/mL) for 2 minutes, then incubated in
triethanolamine buffer, pH 8, for 5 minutes. After several washes,
prehybridization buffer was applied for 30 minutes at 37°C. For
hybridization, digoxigenin-labeled riboprobes were added, and
hybridization was allowed to proceed overnight at 50°C. After
hybridization, sections were incubated twice with 50% formamide and
2x SSC at 55°C for 1 hour, washed twice in 2x SSC, treated with
RNase A (20 mg/mL) for 30 minutes, and washed twice in 2x SSC,
followed by two 1x SSC washes. The slides were immediately processed
for immunohistochemical staining with anti-digoxigenin alkaline
phosphatase for 90 minutes. After several washes and saturation, the
slides were incubated in 100 mM Tris-HCl, with 100 mM NaCl, 50 mM
MgCl2, and 1 mM levamisole for 5 minutes and overnight at
37°C with nitroblue tetrazolium chloride and
5-bromo-4-chloro-3-indolyl phosphate solution in the same buffer. After
washes, the slides were counterstained with Kernechtrot.
Cell Culture
SMCs were isolated from human adult aorta media by enzyme
digestion as previously described23 and cultured in Ham's
F10 medium supplemented with 10% fetal calf serum, 5 mM HEPES, 50 U/mL
penicillin, and 50 mg/mL streptomycin at 37°C in a 5%
CO2/95% air atmosphere. The experiments were conducted on
SMCs at the first passage.
Immunofluorescence Microscopy
Cellular adhesion assays were performed in eight-chamber slides
coated with either human purified VN (10 µg/mL) or fibronectin (20
µg/mL) in PBS at 4°C overnight. The wells were then washed with
PBS, and nonspecific adherence to the coat wells was blocked with 5%
BSA in PBS for 2 hours at 37°C.
Primary human SMCs were removed from the culture plates by brief
incubation at 37°C with 0.5 mM EDTA, washed in PBS with
Ca2+ and Mg2+, and resuspended in serum-free
medium. The cells were placed in coated wells at a density of 50 000
cell/cm2 in serum-free medium. Synthesis of extracellular
matrix proteins was inhibited by cycloheximide (25 µg/mL) 2 hours
before and during adhesion assays. After 2 hours of adhesion on
extracellular matrix proteins, the cells were fixed (2% PFA) and
permeabilized with 0.2% Triton X-100. After saturation
with 5% BSA in PBS, the cells were immunolabeled with anti-
vß3,
-
vß5, -ß1, -
v subunit, or -vitronectin mAbs. The
samples were then incubated for 1 hour with anti-Ig mAb coupled with
fluorescein isothiocyanate. For double
immunofluorescence, after application and labeling
of the first mAbs as above, the samples were then incubated for 1 hour
with a focal contact marker, anti-vinculin (1/50) mAb, followed by
biotinylated sheep anti-mouse Ig and finally with streptavidin-Texas
Red complex for 30 minutes. The coverslips were mounted in mounting
medium for fluorescence H-1000 and examined with a
Microphot-FXA microscope.
Immunoprecipitation and Immunoblotting
For immunoprecipitation experiments, primary SMCs were
preincubated for 24 hours in serum-free medium, for 1 hour in
methionine-free medium, and metabolically labeled with
(35S) methionine and (35S) cysteine (100
µCi/mL) for 18 hours in serum-free medium. The cell supernatants were
collected and clarified by centrifugation. The cells
were lysed in RIPA buffer (0.05 M Tris-HCl, pH 7.5, 0.15 M NaCl, 1%
Triton X-100, 1% deoxycholate, 1 mM EDTA, and proteinase
inhibitors) at 4°C. Both culture media and cell lysates
were precleared and immunoprecipitated with polyclonal or monoclonal
antibodies anti-VN in a rotary shaker overnight, followed by absorption
with protein A-Sepharose for 3 hours at 4°C. As control, VN
antibodies were preabsorbed on purified VN (10 µg/mL). The Sepharose
particles were collected by centrifugation and washed
three times in RIPA buffer and twice in PBS and water. The
immunocomplexes were eluted from protein A-Sepharose by boiling in
Laemmli buffer and analyzed by 7.5% SDS-polyacrylamide
gel electrophoresis under reducing conditions. The gel was either dried
and exposed for autoradiography or electrophoretically
transferred onto nitrocellulose membranes for protein
immunoblotting. In this case, the membranes were
saturated with 5% BSA and incubated with anti-VN mAb for 1 hour. After
several washes, the bound antibody was detected with biotinylated sheep
anti-mouse Ig and finally with streptavidin-horseradish peroxidase
complex. The immunoblots were developed with the
chemiluminescence detection system according to the manufacturer's
recommendations (Renaissance, DuPont New England Nuclear). Relative
mass was determined using high molecular mass standards (Biolabs, New
England).
Flow Cytometry
Expression of
v, ß1 subunits, and
vß3 and
vß5
integrins on human primary SMCs was determined by flow cytometry.
Confluent SMCs were harvested by brief incubation in buffer (6 mM
glucose, 5.3 mM KCl, 125 mM NaCl, 18 mM HEPES, 0.1x PBS) with 0.5 mM
EDTA. After washes in PBS (with Ca2+ and Mg2+),
the cells were incubated with mAbs in PBS for 1 hour at 4°C, washed
three times in cold PBS, and resuspended in fluorescein
isothiocyanate-conjugated goat anti-mouse Ig for 1 hour at 4°C. After
three additional washes, the samples were fixed in 1% PFA.
Measurements were made in a Coulter type XL flow cytometer. The mean of
the fluorescence channels was evaluated by the computer for
each sample. The x axis represents the
fluorescence intensity, and the y axis
represents the cell number; 10 000 events were
analyzed for each sample.
| Results |
|---|
|
|
|---|
-actin (Fig 1
-actin-positive areas, suggesting an association with intimal and
medial SMCs. In the fibrous cap, VN labeling was colocalized with
HAM-56 staining (Fig 1
|
VN mRNA Expression in Human Carotid Plaques
We and others5 have detected VN protein in
atherosclerotic plaques, although its cellular origin has yet to be
established. We therefore wished to find out whether intimal cells
synthesize VN in situ. After hybridization with an antisense VN probe,
strong mRNA labeling was observed in the intima and media of specimens
of human atherosclerotic carotid arteries (Fig 2
, A). To identify which cells expressed
VN mRNA in the plaques, serial sections were processed for
immunohistochemistry with SMCs (Fig 2
, C) and macrophage
markers (Fig 2
, D). In several cases, the plaques were composed of SMCs
(Fig 2
, C) with occasional macrophages (Fig 2
, D). VN mRNA
expression colocalized with
-actin staining and, in rare instances,
with HAM-56 staining. Most of the VN mRNA labeling in the intima was
found in SMCs. However, in the plaque, whole SMCs did not express VN
mRNA. As shown in Fig 2
, A and C, medial SMCs also expressed VN mRNA. A
sense VN riboprobe failed to hybridize to carotid arteries, confirming
the specificity of the antisense riboprobe (Fig 2
, B).
|
VN Synthesis by SMCs In Vitro
Total RNA of human cultured SMCs was isolated and reverse
transcribed, and VN cDNA was amplified by PCR with specific primers.
The specificity of the amplified transcripts was confirmed by cloning
and sequencing. To find out whether SMCs synthesized and deposited
their own VN protein at the cell surface, immunoprecipitation after
metabolic labeling was performed. Primary human SMCs were
cultured until confluence on medium supplemented with serum. At
confluence, SMCs were maintained for 24 hours in serum-free medium, for
an additional hour in methionine-free medium, then labeled with 100
µCu/mL of 35S-methionine/35S-cysteine medium.
The supernatants of cultured SMCs and the cell lysates were
immunoprecipitated with a polyclonal anti-VN antibody. On
autoradiography (Fig 3
, A), two bands identified at 65 and 75 kd were detected. The same
results were obtained when the immunoprecipitation was performed with
mAb anti-VN. Moreover, the precipitation of 75- to 65-kd polypeptides
was inhibited by preabsorption of the antibody with purified VN (data
not shown). Immunoblotting with mAb anti-VN on the same
membrane revealed two bands that migrated at the same positions as
purified human VN (Fig 3
, B). The majority of VN protein was
immunoprecipitated from the cell lysate, while only a small amount was
found in SMC supernatant. Low-molecular-weight polypeptides were
detected, suggesting that VN was proteolytically cleaved from the
larger form. On immunofluorescence with mAb
anti-VN, a fibrillary pattern of VN deposits was observed on surface
membranes of SMCs (Fig 3
, C).
|
Integrin Expression in Human Carotid Plaques
Because VN interacts with different membrane integrin
receptors, we looked for
vß3 and
vß5 on human carotid
plaques. Both
vß3 and
vß5 integrins were expressed in intimal
thickening and media (Fig 4
, A and B,
respectively). On serial sections,
vß3 colocalized with
-actin
staining in the intima (Fig 4
, D). Expression of
vß5 was less
pronounced than that of
vß3 in media but stronger in intima of
human atherosclerotic plaques (Fig 4
, B). Interestingly,
vß5
staining colocalized with both
-actin and HAM-56 staining (Fig 4
, D
and E, respectively). In normal arteries, SMCs expressed both
vß3
and
vß5 (data not shown). On serial sections, VN expression (Fig 4
, C) was observed in both the fibrotic acellular part of
atherosclerotic plaques and in cellular areas. At higher magnification,
VN was clearly colocalized with
vß3 on the internal side of the
cellular rim of the necrotic core (Fig 4
, A), contrasting with the more
external expression of
vß5 on the rim (Fig 4
, B). VN thus appeared
to interact with both
vß3 and
vß5 in human atherosclerotic
plaques.
|
To pinpoint the interactions between VN and its receptors in
situ, carotid plaques were double immunostained for VN and
integrins and examined by confocal microscopy. Colocalization of
red-labeled VN with green-labeled receptors was indicated by a yellow
coloration. It can be seen in Fig 5
that
VN was colocalized with both
vß3 (Fig 5
, A) and
vß5 (Fig 5
, B) integrins on 0.4-µm-sections of carotid tissue specimens. In
contrast, the colocalization between VN and the ß1 subunit in the
same area was sparse and scattered in comparison with the massive
vß3/VN and
vß5/VN colocalization (Fig 5
, C).
|
Integrin Expression In Vitro
Integrin expression on human aortic SMCs in culture was
analyzed by flow cytometry (Fig 6
). It can be seen in Fig 6
, B, that SMCs
strongly expressed the
v subunit. Analysis of the ß
integrin subunit associated with
v showed a higher expression of the
vß5 than the
vß3 integrin. We did not obtain any direct
evidence for
vß1 complex expression, although a moderate
expression of the ß1 subunit was observed, comparable to that of
vß3, indicating a relationship between
vß1 and
v
expression.
|
To determine the distribution of SMC receptors on the membrane surface,
cells were placed on VN-coated plates in the presence of cycloheximide
to inhibit the synthesis of extracellular matrix proteins. After 2
hours, the cells were immunostained with a focal contact
marker, anti-vinculin mAb (Fig 7
, E
through G), along with mAb against the
v subunit (Fig 7
, A),
vß3 (Fig 7
, B), or
vß5 (Fig 7
, C) complexes. In the presence
of cycloheximide, SMCs were seen to organize focal contacts, as shown
by vinculin staining (Fig 7
, E through G). As described by Burridge et
al,26 we observed an exclusion of the ligand-specific
antibody, anti-VN mAb, from focal contacts on cells attached to the
VN coat (Fig 7
, D). This pointed to an involvement of VN in focal
contact organization.
|
Furthermore, the two VN receptors were distributed differently on SMC
surface membranes in contact with VN.
vß3 expression was low and
punctiform (Fig 7
, B) and not associated with focal contact, evidenced
by mAb to vinculin (Fig 7
, F). In contrast,
vß5 staining was both
punctiform and in focal contact (Fig 7
, C) and codistributed with
vinculin staining (Fig 7
, G). The
v subunit pattern revealed a
strong focal contact staining (Fig 7
, A) as well as a punctate nonfocal
staining on some cells. In control experiments with SMCs placed on
fibronectin,
vß3 expression was in focal contact in association
with vinculin staining, whereas
vß5 staining was diffuse (data not
shown). No labeling was detected in the absence of primary
antibody.
| Discussion |
|---|
|
|
|---|
-actin, suggesting that much
of the VN was associated with SMCs in both atherosclerotic plaques and
normal media. In addition, some VN protein was colocalized with
macrophage HAM-56 staining. Although VN protein was present
in normal media, its expression was markedly elevated in the intima of
human atherosclerotic plaques. These results are in line with the
accumulation of VN observed by numerous authors in human
atherosclerotic plaques associated with cell debris, collagen, and
elastin and with an activation of complement.6 27 In
experimental models, an accumulation of VN expression in
arterial wall with no increase in plasma VN has been
described in both hypercholesterolemic and mechanically
injured aortas28 as well as in Watanabe heritable
hyperlipidemic rabbits.29 An accumulation of VN protein within the plaque was demonstrated immunohistochemically, although the source of the arterial VN was not clear. It may have diffused from plasma, been secreted by activated platelets or been synthesized by cells in the plaque. To determine whether cells in atherosclerotic lesions synthesize VN and whether intimal SMCs remodel their extracellular matrix via VN, we carried out an immunolabeling and in situ hybridization study of human atheromatous carotid arteries. We found that a large population of SMCs and a few macrophages expressed VN mRNA. It is of interest that the VN mRNA expression was not restricted to pathological intimal SMCs, because some expression was also observed in medial SMCs. Therefore, normal medial SMCs as well as SMCs in the intima appear to synthesize VN, which would account for its presence in the arterial wall. Some of the VN in atherosclerotic plaques may be derived from increased VN synthesis by SMCs induced by cytokines or growth factors secreted by cells in the plaques. In this respect, in vitro studies have shown that TGF-ß, like IL-6, upregulates VN mRNA and protein in Hep G2 cells.30 In our study, we did not find any induction of VN mRNA in cultured human SMCs after treatment with TGF-ß (data not shown). However, we cannot rule out a diffusion of VN from plasma into the arterial wall. Indeed, plasmatic VN may be trapped and internalized by endothelial cells.31 This suggested that VN binds to the endothelial surface and may be involved in receptor-ligand endocytosis.
The expression of VN by SMCs was supported by the in vitro findings on cultured human SMCs. VN mRNA was detected in these cells, and we showed by immunoprecipitation after metabolic labeling that they synthesized and deposited their own VN protein. Primary cultured SMC expressed the two VN forms at 65 and 75 kd, corresponding to the two well-characterized forms of human VN.32 Smaller polypeptides were also detected and were thought to be proteolytic fragments. In this respect, it has been reported that VN can be cleaved and degraded by various enzymes. For example, plasmin cleaves VN into 61- to 63-, 56-, 42-, and 35-kd polypeptides.33 The small amounts of VN protein detected in SMC supernatant suggested that most of the synthesized VN was associated with cells. The immunofluorescence labeling studies showed that it was anchored on the membrane surface in a fibrillary distribution. We therefore concluded that SMCs produce and deposit their own VN.
With respect to cell-matrix interactions, VN interacts with the cell
surface via integrins containing the
v subunit.34 35
This integrin subunit is associated with multiple ß chains, including
ß1, ß3, ß5, and ß8. Among these heterodimers,
vß3,
vß5, and
vß1 are expressed on SMCs.36 37 We
examined the localization of VN-binding integrins,
vß3 and
vß5, on human carotid arteries, and we present evidence that
both receptors are expressed in human atherosclerotic plaques. The
intimal and medial expression of
vß3 in human arteries has been
reported by Hoshiga et al.20 We present here the first
evidence of
vß5 expression in atherosclerotic lesions. On serial
sections in situ,
vß5 integrin appeared to be expressed by both
SMCs and macrophages, which is consistent with the
demonstration of
vß5 expression by
macrophages38 and SMCs in vitro.4
Interestingly,
vß3 and
vß5 staining was observed in
VN-positive areas. To obtain more evidence of a colocalization of VN
with its receptors, sections of artery were examined by confocal
microscopy. VN was observed together with
vß3 and
vß5
receptors in the fibrous cap of atherosclerotic lesions. These results
were supported by the in vitro findings that human cultured SMCs
express both
vß3 and
vß5 and adhere to VN. However, it can be
seen in Figure that not all
vß3 and
vß5 integrins were
associated with VN ligand. It is known that
vß3 and
vß5
interact with several ligands, including fibronectin and
osteopontin,4 39 40 These extracellular matrix proteins
are all expressed in atherosclerotic plaques.41 42 We
found that the VN receptors
vß3 and
vß5 and the
v integrin
subunit exhibited different patterns of expression in contact with VN
on the surface of SMCs. The
vß3 integrin was observed in a
punctiform and diffuse distribution on VN and was not concentrated in
focal contacts. This is not in agreement with the findings of Clyman et
al,36 but they used a mAb against ß3 subunit and ductal
SMCs rather than the arterial SMCs used in the present
study. In contrast to the distribution of
vß3,
vß5 was
observed in both punctiform and in focal adhesion sites of the SMC-VN
interactions, contrasting with the diffuse distribution on fibronectin.
So, SMC
vß5 can be organized in focal adhesion plaque in contact
with VN. Similarly, the
v and ß1 subunits (data not shown) were
distributed in focal contact, suggesting that
vß1 was abundant in
focal adhesion sites, although we were unable to precisely localize the
complex
vß1 itself. The participation of ß1 subunit integrin in
focal adhesion sites on SMCs has been reported by
others.36
vß3 expression on SMCs has been
demonstrated to be involved in SMC migration.11 37 43 The
functional roles of the
vß5 integrins on SMCs are as yet unknown.
For instance, it has been demonstrated that
keratinocytes migrate on VN via
vß5 only after
activation by growth factors.44 Many extracellular matrix
proteins have been shown to transmit signals via integrins, giving rise
to a variety of intracellular processes, including tyrosine
phosphorylation, an increase in intracellular pH, and
calcium flux.21 45 46 47 The distributions of VN receptors on
the cell surface as well as in atherosclerotic plaques suggest that
various functional changes may be induced by VN in SMCs via different
signal transducers.
The pathophysiological significance of VN in
atherosclerotic plaques is still unclear, although several lines of
evidence point to a role for VN in the cellular processes involved in
atherogenesis. Migration of SMCs into the intima layer is an important
contributor to the intimal thickening in atherosclerotic
lesions,1 and it has been shown that VN mediates
chemotactic and haptotatic activities of SMC in vitro.11
Furthermore, the migration on VN is dependent on the
vitronectin receptor,
vß3,11 which is
strongly expressed in human atherosclerotic plaques. VN could thus play
a role in the recruitment of SMCs from the media to the intima.
Peptides that bind to
vß3 receptor have been found to reduce
neointima formation after balloon injury in rabbit and
hamster arteries.48 49 Although
vß3 binds several
extracellular matrix proteins, VN could be involved in the regulation
of cellular recruitment. Interestingly, PAI-1, which is highly
expressed in human atherosclerotic plaques,50 may block
SMC migration on VN by hindering its access to the VN
receptor.43 Indeed, PAI-1-binding sites for VN overlap the
region containing RGD cell attachment sites for the VN
receptor.16 The VN synthesized and secreted by SMCs may
thus modulate its effect on migration as a function of its affinities
for the two substrates, PAI-1 or the integrin
vß3. Moreover,
because VN stabilizes PAI-1 in extracellular matrix
proteins,15 thereby protecting them from
plasminogen activator-mediated degradation, it
may help stabilize plaques.
In conclusion, we show here that (1) VN protein and mRNA are expressed
in human carotid artery plaques; (2) SMCs synthesize VN in the plaque,
which may account for its accumulation; (3)
vß3 and
vß5
integrins are expressed in these plaques and colocalize with VN in the
intima; and (4) these integrins were differently distributed on the
membrane surface. Comprehension of the true functions of VN and its
interactions with its receptors in atherosclerotic lesions will have to
await the results of further studies.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received June 11, 1997; accepted September 6, 1997.
| References |
|---|
|
|
|---|
2.
Hedin U, Bottger BA, Forsberg E, Johansson S, Thyberg
J. Diverse effects of fibronectin and laminin on phenotypic
properties of cultured arterial smooth muscle
cells. J Cell Biol.. 1988;107:307-319.
3.
Thyberg J, Hedin U, Sjölund M, Palmberg L,
Bottger BA. Regulation of differentiated properties and
proliferation of arterial smooth muscle cells.
Arteriosclerosis.. 1990;10:966-990.
4. Liaw L, Skinner MP, Raines EW, Ross R, Cheresh D, Schwaertz SM. The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins. J Clin Invest.. 1995;95:713-724.
5. Niculescu F, Rus HG, Vlaicu R. Immunohistochemical localization of C5b-9, S-protein, C3d and apolipoprotein B in human arterial tissues with atherosclerosis. Atherosclerosis.. 1987;65:1-11.[Medline] [Order article via Infotrieve]
6. Guettier C, Hinglais N, Bruneval P, Kazatchkine M, Bariety J. Immunohistochemical localisation of S protein/vitronectin in human atherosclerotic versus atherosclerotic arteries. Virchows Arch A Pathol Anat Histopathol.. 1989;414:309-313.[Medline] [Order article via Infotrieve]
7. Preissner K, Wassmuth R, Muller-Berghaus G. Physiochemical characterisation of human S protein and its function in the blood coagulation system. Biochem J.. 1985;231:349-355.[Medline] [Order article via Infotrieve]
8. Preisner KT. Structure and biological role of vitronectin. Annu Rev Cell Biol.. 1991;7:275-310.
9. Seiffert D, Iruelaarispe M, Sage E, Loskutoff D. Distribution of vitronectin mRNA during murine development. Dev Dyn.. 1995;203:71-79.[Medline] [Order article via Infotrieve]
10. Gladson C, Wilcox J, Sanders L, Gillespie G, Cheresh D. Cerebral microenvironment influences expression of the vitronectin gene in astrocytic tumors. J Cell Sci.. 1995;108:947-956.[Abstract]
11.
Brown SL, Lundgren CH, Nordt T, Fujii S.
Stimulation of migration of human aortic smooth muscle cells by
vitronectin: implications for
atherosclerosis. Cardiovasc Res.. 1994;28:1815-1820.
12.
Delannet M, Martin F, Bossy B, Cheresh D, Reichardt L,
Duband J. Specific roles of the alpha V beta 1, alpha V beta 3
and alpha V beta 5 integrins in avian neural crest cell adhesion and
migration on vitronectin. Development.. 1994;120:2687-2702.
13. Martinez-Morales J, Marti E, Frade J, Rodrigueztebar A. Developmentally regulated vitronectin influences cell differentiation, neuron survival and process outgrowth in the developing chicken retina. Neuroscience.. 1995;68:245-253.[Medline] [Order article via Infotrieve]
14. Gullberg D, Fessler LI, Fessler JH. Differentiation, extracellular matrix synthesis, and integrin essembly by Drosophilia embryo cells cultured on vitronectin and laminine substrates. Dev Dyn.. 1994;199:116-128.[Medline] [Order article via Infotrieve]
15. Sigurdardottir O, Wiman B. Identification of a PAI-1 binding site in vitronectin. Biochim Biophys Acta.. 1994;1208:104-110.[Medline] [Order article via Infotrieve]
16.
Seiffert D, Ciambrone G, Wagner N, Binder B, Loskotoff
D. The somatomedin B domain of the
vitronectin. J Biol Chem.. 1994;269:2659-2666.
17.
Wei Y, Waltz D, Rao N, Drummond RJ, Rosenberg S,
Chapman HA. Identification of the urokinase receptor as an
adhesion receptor for vitronectin. J
Biol Chem.. 1994;269:32380-32388.
18. Ruoslahti E. Integrins. J Clin Invest.. 1991;87:1-5.
19. Hynes RO. Integrins: versatility, modulation, and sygnaling in cell adhesion. Cell.. 1992;69:11-25.[Medline] [Order article via Infotrieve]
20.
Hoshiga M, Alpers CE, Smith LL, Giachelli CM, Schwartz
SM.
vß3 integrin expression in normal and atherosclerotic
artery. Circ Res.. 1995;77:1129-1135.
21.
Juliano RL, Haskill S. Signal transduction from
the extracellular matrix. J Cell Biol.. 1993;120:577-585.
22. Adams JC, Watt FM. Regulation of development and differentiation by the extracellular matrix. Development.. 1993;117:1183-1198.[Medline] [Order article via Infotrieve]
23.
Duplàa C, Couffinhal T, Dufourcq P, Llanas B,
Moreau C, Bonnet J. The integrin very late antigen-4 is
expressed in human smooth muscle cell. Circ Res.. 1997;80:159-169.
24. Jenne D, Stanley KK. Nucleotide sequence and organization of the human S-protein gene: repeating peptide motifs in the pexin family and a model for their evolution. Biochemistry.. 1987;26:6737-6742.
25. Suzuki S, Oldberg A, Hayman EG, Pierschbacher MD, Ruoslahti E. Complete amino acid sequence of human vitronectin deduced from cDNA. EMBO J.. 1985;4:2519-2524.[Medline] [Order article via Infotrieve]
26. Burridge K, Fath K, Kelly TN, Nuckolls G, Turner C. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu Rev Cell Biol.. 1988;4:487-525.
27. Niculescu F, Rus HG, Porutiu D, Ghiurca V, Vlaicu R. Immunoelectron-microscopic localisation of S-protein/vitronectin in human atherosclerotic wall. Atherosclerosis.. 1989;78:197-203.[Medline] [Order article via Infotrieve]
28.
Sawa H, Sobel BE, Fujii S. Potentiation by
hypercholesterolemia of the induction of aortic
intramural synthesis of plasminogen activator
inhibitor type-1 by endothelial
injury. Circ Res.. 1993;73:671-680.
29.
Sato R, Komine Y, Imada T, Takano T. Monoclonal
antibody EMR 1a/212D recognizing site of deposition of extracellular
lipid in atherosclerosis: isolation and
characterisation of a cDNA clone for the antigen. J
Biol Chem.. 1990;265:21232-21236.
30. Koli K, Lohi J, Hautanen A, Keski-Oja J. Enhancement of vitronectin expression in human HepG2 hepatoma cells by transforming growth factor-ß1. Eur J Biochem.. 1991;199:337-345.[Medline] [Order article via Infotrieve]
31.
Deboer HC, Preissner KT, Bouma BN, Degroot PG.
Internalization of vitronectin-thrombin-antithrombin
complex by endothelial cells leads to deposition of the
complex into the subendothelial matrix.
J Biol Chem.. 1995;270:30733-30740.
32.
Barnes DW, Silnutzer J, See C, Shaffer M.
Characterization of human serum spreading factor with monoclonal
antibody. Proc Natl Acad Sci U S A.. 1983;80:1362-1366.
33. Kost C, Benner K, Stockmann A, Linder D, Preissner KT. Limited plasmin proteolysis of vitronectin. Eur J Biochem.. 1996;236:682-688.[Medline] [Order article via Infotrieve]
34. Felding-Habermann B, Mueller BM, Romerdahl CA, Cheresh DA. Involvement of integrin av gene expression in human melanoma tumorigenicity. J Clin Invest.. 1992;89:2018-2022.
35.
Leavesley DI, Ferguson GD, Wayner EA, Cheresh DA.
Requirement of the integrin b3 subunit for carcinoma cell
spreading or migration on vitronectin and
fibrinogen. J Cell Biol.. 1992;117:1101-1107.
36. Clyman RI, Mauray F, Kramer RH. ß1 and ß3 integrins have different roles in the adhesion and migration of vascular smooth muscle cells on extracellular matrix. Exp Cell Res.. 1992;200:272-284.[Medline] [Order article via Infotrieve]
37.
Jones JI, Prevette T, Gockerman A, Clemmons DR.
Ligand occupancy of the
vß3 integrin is necessary for
smooth muscle cells to migrate in response to insulin-like growth
factor I. Proc Natl Acad Sci U S A.. 1996;93:2482-2487.
38.
De Nichilo MO, Yamada KM. Integrin
avb5-dependent serine phosphorylation of paxillin in
cultured human macrophages adherent to
vitronectin. J Biol Chem.. 1996;271:11016-11022.
39.
Cheresh D. Human
endothelial cells synthesized and expressed an
Arg-Gly-Asp directed adhesion receptor involved in attachment to
fibrinogen and von Willebrand factor. Proc Natl
Acad Sci U S A.. 1987;84:6471-6475.
40.
Smith J, Vestal D, Irwin S, Burke T, Cheresh D.
Purification and functional characterisation of integrin
vß5. J Biol Chem.. 1990;265:11008-11013.
41.
Clausell N, Delima V, Molossi S, et al.
Expression of tumour necrosis factor alpha and accumulation of
fibronectin in coronary artery restenotic lesions
retrieved by atherectomy. Br Heart J.. 1995;73:534-539.
42. Giachelli C, Bae N, Almeida M, Denhardt D, Alpers C, Schwartz S. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest.. 1993;92:1686-1696.
43.
Stefansson S, Lawrence DA. The serpin PAI-1
inhibits cell migration by blocking integrin
vß3 binding to
vitronectin. Nature.. 1996;383:441-443.[Medline]
[Order article via Infotrieve]
44. Yebra M, Filardo E, Bayna E, Kawahara E, Becker J, Cheresh D. Induction of carcinoma cell migration on vitronectin by NF-kappa B-dependent gene expression. Mol Biol Cell.. 1995;6:841-850.[Abstract]
45. Rosales C, Obrien V, Kornberg L, Juliano R. Signal transduction by cell adhesion receptors. Biochim Biophys Acta.. 1995;1242:77-98.[Medline] [Order article via Infotrieve]
46. Schwartz MA. Integrins as signal transducing receptors. In: Tanaka Y, ed. Integrins. Boca Raton, Fla: CRC Press, 1994:3347.
47. Guan J, Shalloway D. Regulation of focal adhesion-associated protein tyrosine kinase by both cellular adhesion and oncogenic transformation. Nature.. 1992;358:690-692.[Medline] [Order article via Infotrieve]
48.
Choi ETM, Engel LP, Callow ADMP, et al.
Inhibition of neointimal hyperplasia by blocking
vß3 integrin with a small peptide antagonist
GpenGRGDSPCA. J Vasc Surg.. 1994;19:125-134.[Medline]
[Order article via Infotrieve]
49.
Matsumo H, Stassen JM, Vermylen J, Deckmyn H.
Inhibition of integrin function by a cyclic RGD-containing
peptide prevents neointima formation.
Circulation.. 1994;90:2203-2206.
50.
Lupu F, Heim DA, Bachmann F, Hurni M, Kakkar VV,
Kruithof EKO. Plasminogen activator
expression in human atherosclerotic lesions. Arterioscler
Thromb.. 1995;15:1444-1455.
This article has been cited by other articles:
![]() |
W. Derer, E. S. Barnathan, E. Safak, P. Agarwal, H. Heidecke, M. Mockel, M. Gross, C. Oezcelik, R. Dietz, and R. Dechend Vitronectin Concentrations Predict Risk in Patients Undergoing Coronary Stenting Circ Cardiovasc Intervent, February 1, 2009; 2(1): 14 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Robert, M.-J. Jacobin-Valat, D. Daret, S. Miraux, A. T. Nurden, J.-M. Franconi, and G. Clofent-Sanchez Identification of Human scFvs Targeting Atherosclerotic Lesions: SELECTION BY SINGLE ROUND IN VIVO PHAGE DISPLAY J. Biol. Chem., December 29, 2006; 281(52): 40135 - 40143. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ekmekci, O. B. Ekmekci, H. Sonmez, Z. Ozturk, N. Domanic, and E. Kokoglu Evaluation of Fibronectin, Vitronectin, and Leptin Levels in Coronary Artery Disease: Impacts on Thrombosis and Thrombolysis Clinical and Applied Thrombosis/Hemostasis, January 1, 2005; 11(1): 63 - 70. [Abstract] [PDF] |
||||
![]() |
S. M. Kanse, R. L. Matz, K. T. Preissner, and K. Peter Promotion of Leukocyte Adhesion by a Novel Interaction Between Vitronectin and the {beta}2 Integrin Mac-1 ({alpha}M{beta}2, CD11b/CD18) Arterioscler. Thromb. Vasc. Biol., December 1, 2004; 24(12): 2251 - 2256. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Stawowy, H. Kallisch, J. P. Veinot, A. Kilimnik, W. Prichett, S. Goetze, N. G. Seidah, M. Chretien, E. Fleck, and K. Graf Endoproteolytic Activation of {alpha}v Integrin by Proprotein Convertase PC5 Is Required for Vascular Smooth Muscle Cell Adhesion to Vitronectin and Integrin-Dependent Signaling Circulation, February 17, 2004; 109(6): 770 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Kanse, T. Chavakis, N. Al-Fakhri, K. Hersemeyer, D. Monard, and K. T. Preissner Reciprocal regulation of urokinase receptor (CD87)-mediated cell adhesion by plasminogen activator inhibitor-1 and protease nexin-1 J. Cell Sci., January 22, 2004; 117(3): 477 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Konstantinides, K. Schafer, and D. J. Loskutoff Do PAI-1 and Vitronectin Promote or Inhibit Neointima Formation?: The Exact Role of the Fibrinolytic System in Vascular Remodeling Remains Uncertain Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 1943 - 1945. [Full Text] [PDF] |
||||
![]() |
U. Kintscher, C. Lyon, S. Wakino, D. Bruemmer, X. Feng, S. Goetze, K. Graf, A. Moustakas, B. Staels, E. Fleck, et al. PPAR{alpha} Inhibits TGF-{beta}-Induced {beta}5 Integrin Transcription in Vascular Smooth Muscle Cells by Interacting With Smad4 Circ. Res., November 29, 2002; 91 (11): e35 - e44. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Newby Vitronectin is implicated as the matrix takes control of neointima formation Cardiovasc Res, March 1, 2002; 53(4): 779 - 781. [Full Text] [PDF] |
||||
![]() |
P. Dufourcq, T. Couffinhal, P. Alzieu, D. Daret, C. Moreau, C. Duplaa, and J. Bonnet Vitronectin is up-regulated after vascular injury and vitronectin blockade prevents neointima formation Cardiovasc Res, March 1, 2002; 53(4): 952 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Moiseeva Adhesion receptors of vascular smooth muscle cells and their functions Cardiovasc Res, December 1, 2001; 52(3): 372 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Paulhe, C. Racaud-Sultan, A. Ragab, C. Albiges-Rizo, H. Chap, N. Iberg, O. Morand, and B. Perret Differential Regulation of Phosphoinositide Metabolism by alpha Vbeta 3 and alpha Vbeta 5 Integrins upon Smooth Muscle Cell Migration J. Biol. Chem., November 2, 2001; 276(45): 41832 - 41840. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Konstantinides, K. Schafer, T. Thinnes, and D. J. Loskutoff Plasminogen Activator Inhibitor-1 and Its Cofactor Vitronectin Stabilize Arterial Thrombi After Vascular Injury in Mice Circulation, January 30, 2001; 103(4): 576 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H Baron, E. P Moiseeva, D. P de Bono, K. R Abrams, and A. H Gershlick Inhibition of vascular smooth muscle cell adhesion and migration by c7E3 Fab (abciximab): a possible mechanism for influencing restenosis Cardiovasc Res, December 1, 2000; 48(3): 464 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Stoop, F. Lupu, and H. Pannekoek Colocalization of Thrombin, PAI-1, and Vitronectin in the Atherosclerotic Vessel Wall : A Potential Regulatory Mechanism of Thrombin Activity by PAI-1/Vitronectin Complexes Arterioscler. Thromb. Vasc. Biol., April 1, 2000; 20(4): 1143 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Pickering, L. H. Chow, S. Li, K. A. Rogers, E. F. Rocnik, R. Zhong, and B. M. C. Chan {alpha}5{beta}1 Integrin Expression and Luminal Edge Fibronectin Matrix Assembly by Smooth Muscle Cells after Arterial Injury Am. J. Pathol., February 1, 2000; 156(2): 453 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P Moiseeva, Q. Javed, E. L Spring, and D. P de Bono Galectin 1 is involved in vascular smooth muscle cell proliferation Cardiovasc Res, January 14, 2000; 45(2): 493 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Coleman, G. A. Braden, M. C. Willingham, and D. C. Sane Vitaxin, a Humanized Monoclonal Antibody to the Vitronectin Receptor ({alpha}vß3), Reduces Neointimal Hyperplasia and Total Vessel Area After Balloon Injury in Hypercholesterolemic Rabbits Circ. Res., June 11, 1999; 84(11): 1268 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tahvanainen, P. Pajukanta, K. Porkka, S. Nieminen, L. Ikavalko, I. Nuotio, M.-R. Taskinen, L. Peltonen, and C. Ehnholm Haplotypes of the ApoA-I/C-III/A-IV Gene Cluster and Familial Combined Hyperlipidemia Arterioscler. Thromb. Vasc. Biol., November 1, 1998; 18(11): 1810 - 1817. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pajukanta, K. V.K. Porkka, M. Antikainen, M.-R. Taskinen, M. Perola, S. Murtomaki-Repo, S. Ehnholm, I. Nuotio, L. Suurinkeroinen, A.-T. Lahdenkari, et al. No Evidence of Linkage Between Familial Combined Hyperlipidemia and Genes Encoding Lipolytic Enzymes in Finnish Families Arterioscler. Thromb. Vasc. Biol., May 1, 1997; 17(5): 841 - 850. [Abstract] [Full Text] |
||||
![]() |
H. Chaulet, C. Desgranges, M.-A. Renault, F. Dupuch, G. Ezan, F. Peiretti, G. Loirand, P. Pacaud, and A.-P. Gadeau Extracellular Nucleotides Induce Arterial Smooth Muscle Cell Migration Via Osteopontin Circ. Res., October 26, 2001; 89(9): 772 - 778. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |