Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:1803-1809

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grenett, H. E.
Right arrow Articles by Booyse, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grenett, H. E.
Right arrow Articles by Booyse, F. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Triglycerides
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:1803-1809.)
© 1998 American Heart Association, Inc.

Original Contributions

Genotype-Specific Transcriptional Regulation of PAI-1 Gene by Insulin, Hypertriglyceridemic VLDL, and Lp(a) in Transfected, Cultured Human Endothelial Cells

Hernan E. Grenett; Raymond L. Benza; Gunther M. Fless; Xin-Nong Li; Glenda C. Davis; ; Francois M. Booyse

From the Division of Cardiovascular Disease, Department of Medicine, University of Alabama at Birmingham (H.E.G., R.L.B., X.-N.L., G.C.D., F.M.B.), and the Department of Medicine, University of Chicago, Chicago, Ill (G.M.F.).

Correspondence to Hernan E. Grenett, PhD, University of Alabama at Birmingham, 845 19th St S, BBRB 809, Birmingham, AL 35294-2170.


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Abstract—Plasminogen activator inhibitor-1 (PAI-1) has been shown to be an independent risk factor for coronary artery disease. Variations in plasma PAI-1 levels have been attributed to variations in the PAI-1 gene, and associations between PAI-1 levels and PAI-1 genotypes suggest that PAI-1 expression may be regulated in a genotype-specific manner by insulin, hypertriglyceridemic (HTG) very low density lipoprotein (VLDL), or lipoprotein(a) [Lp(a)]. Polymerase chain reaction–amplified 1106-bp fragments of the promoter of the 1/1 and 2/2 PAI-1 genotypes were sequenced and showed 5 regions of small nucleotide differences in the 1/1 versus 2/2 PAI-1 promoters that consistently occurred with high frequency. These fragments were ligated into the luciferase reporter gene, and 1/1 and 2/2 PAI-1 genotype human umbilical vein endothelial cell (HUVEC) cultures were transiently transfected with their respective p1PAI110/luc and p2PAI110/luc constructs and vice versa. Insulin induced an {approx}12- to 16-fold increase in luciferase activity in both the 1/1 and 2/2 PAI-1 genotype HUVEC cultures transfected with the p1PAI110/luc construct. HTG-VLDL and Lp(a) induced luciferase activity by {approx}14- to 16- and {approx}8- to 11-fold, respectively, in both the 1/1 and 2/2 PAI-1 genotype HUVEC cultures transfected with the p2PAI110/luc construct. The positive control interleukin-1 showed an {approx}7- to 12-fold response in the 1/1 and 2/2 PAI-1 genotype HUVEC cultures transfected with either of the constructs. These cross-over results demonstrate that regulation of either the 1/1 or 2/2 PAI-1 genotype by its respective inducer is due to the promoter itself and not to some factor(s) expressed differently in the 1/1 or 2/2 PAI-1 genotype HUVEC cultures.


Key Words: plasminogen activator inhibitor-1 • transfection • insulin • hypertriglyceridemic VLDL • lipoprotein(a)


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Impaired fibrinolysis and hypercoagulability have been suggested as predisposing factors for coronary artery thrombosis, which may have an important role in the pathogenesis of coronary artery disease (CAD) and myocardial infarction (MI).1 2 Young survivors of MI have reduced fibrinolytic activity, increased plasminogen activator inhibitor-1 (PAI-1) levels, and an "impaired release" of tissue plasminogen activator, suggesting that reduced fibrinolytic activity, presumably endothelial cell (EC) related, may have pathogenic importance in MI.2 Certain risk factors for CAD, including hyperinsulinemia and hypertriglyceridemic (HTG) VLDL, have been associated with an increase in plasma PAI-1 antigen and activity levels. Because PAI-1 is generally considered to be a major regulator of fibrinolysis through its interaction with plasminogen activators,3 4 it is conceivable that the elevated blood levels of PAI-1 in hyperinsulinemic and hyperlipoproteinemic subjects may in part explain their increased thrombotic risk and CAD prevalence that are unexplained by conventional risk factors.5 6 7 8 Recent studies have shown that variations in the PAI-1 gene sequence may be closely associated with the regulation of PAI-1 expression and therefore, the increased risk for thrombosis.9 In addition, several studies have indicated that regulation of PAI-1 at the transcriptional level plays an important role in determining the amount of active PAI-1 in plasma.10 11

Investigation into the regulation of PAI-1 gene expression has confirmed the existence of 3 different polymorphic variations in the human PAI-1 gene: a 4G/5G polymorphism in the promoter region; an allelic variation at a (C-A)n dinucleotide repeat polymorphism in the fourth intron; and an HindIII restriction fragment length polymorphism (RFLP) due to a base change at the 3' end of the PAI-1 gene.9 12 With the use of the HindIII RFLP as a marker for genetic variation in the PAI-1 gene, a higher plasma PAI-1 antigen level was observed in the 1/1 PAI-1 genotype than in the 1/2 and 2/2 genotypes of young post-MI patients and population-based controls.12 Functional studies utilizing several DNA-mediated gene transfer approaches have localized a number of inducible elements in the PAI-1 gene promoter. Deletion fragments of the PAI-1 gene promoter and the 5' flanking region have been used to demonstrate transcriptional regulation of the PAI-1 gene promoter by various inducers in different cell culture systems.11 13 14 15 These observations have demonstrated that the PAI-1 promoter is precisely regulated by a variety of effector molecules and further suggest that the promoter is highly reactive to various trans-acting pathways. In these studies, we now additionally demonstrate and confirm the genotype-specific transcriptional regulation of the 1/1 and 2/2 PAI-1 genotypes by insulin and HTG-VLDL/lipoprotein(a) [Lp(a)], respectively, in cultured human umbilical vein ECs (HUVECs) transiently transfected with the p1PAI110/luc and p2PAI110/luc constructs, with lipofectamine as the liposome-mediated delivery system.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Materials
Collagenase (type I, CLS) was obtained from Boehringer Mannheim Biochemicals; FBS from Intergen Corp; heparin (porcine intestinal mucosa), BSA, and insulin from Sigma Chemical Co; [{alpha}-32P]dCTP (3000 Ci/mmol) from Amersham; KpnI, BglII, HindIII, calf intestinal phosphatase, T4 DNA ligase, GeneLight vector pGL2-basic expression, pSV–ß-galactosidase, luciferase enzyme assay kit, ß-galactosidase enzyme assay system, and agarose from Promega Inc; pfu DNA polymerase from Stratagene; and the Sequenase II kit from UBI. Lipofectamine, Opti-MEM 1 reduced serum medium, and medium 199 (M199) were from BRL. Purified HTG-VLDL (Sf 100 to 400) was obtained from Drs William A. Bradley and Sandra H. Gianturco, University of Alabama at Birmingham, and was isolated and characterized as described previously.16 Purified Lp(a) was obtained from Dr Gunther M. Fless, University of Chicago, Ill, and was also isolated and characterized as described previously.17 18

Cell Culture
HUVECs derived from fresh (discarded) umbilical cords by mild collagenase treatment19 20 were seeded individually into human fibronectin–coated plastic T-25 or Petri dishes (960 mm2) and grown to confluency in complete culture medium consisting of M199 (GIBCO; powder medium containing L-glutamine and Earl's salts); 0.025 mol/L HEPES buffer, pH 7.4; 0.002 mol/L fresh L-glutamine; 100 U/mL penicillin; 100 µg/mL streptomycin; 10% heat-deactivated FCS; 90 µg/mL heparin; and 50 µg/mL partially purified EC growth factor.21 Cultures were refed every 48 hours with complete culture medium and maintained in a 95% air–5% CO2 humidified atmosphere. All experiments were carried out with individual vessel–derived subcultured HUVECs (third or fourth passage).

DNA Isolation
Genomic DNA was isolated from human umbilical cords according to Maniatis et al.22 In brief, pieces of tissue (300 to 500 mg) were incubated in digestion buffer containing proteinase K (100 µg/mL) in the presence of 0.02 mol/L EDTA and 0.5% SDS for 16 hours at 55°C. Digested samples were then extracted with phenol saturated with 0.5 mol/L Tris-HCl, pH 8.0, and the DNA was recovered by ethanol precipitation. DNA resuspended in 0.01 mol/L Tris-HCl, pH 8.0, and 0.001 mol/L EDTA was then incubated with 1 µg/mL DNase-free RNase for 30 minutes at 37°C, followed by extraction with phenol/chloroform/isoamyl alcohol and ethanol precipitation. The DNA was washed once with 75% ethanol and resuspended in 0.01 mol/L Tris-HCl, pH 8.0, and 0.001 mol/L EDTA. Absorbance ratios (A260 to A280) of DNA samples were >1.70.

Southern Blot Hybridization and Identification of HindIII Polymorphism
Genomic DNA (3 µg) was digested with HindIII (3 U/µg DNA) for 16 hours at 37°C and then electrophoresed overnight in 0.7% agarose in a buffer of 0.089 mol/L Tris-HCl, 0.89 mol/L boric acid, and 0.002 mol/L EDTA, pH 8.3.22 DNA digests were blotted onto nylon membranes by capillary transfer in 10x SSC (1x SSC is 0.15 mol/L NaCl and 0.015 mol/L sodium citrate buffer, pH 7.0) for 16 hours at room temperature and then UV cross-linked to the nylon membrane. The immobilized DNA was hybridized with a 2.2-kb human PAI-1 cDNA fragment23 radiolabeled with [{alpha}-32P]dCTP to a specific activity of {approx}109 cpm/µg by using a random-primer DNA labeling kit. Prehybridization and hybridization were carried out with Quick Hyb solution in a hybridization oven for 20 minutes and 1 hour, respectively, at 68°C. The filters were washed twice in 2x SSC and 0.5% SDS for 30 minutes at room temperature, once in 1x SSC and 0.5% SDS for 30 minutes at 68°C, and once in 0.1x SSC and 0.1% SDS for 10 minutes at 68°C. The filters were exposed to Fuji film at -70°C for 24 hours by using Fisher Biotech L-Plus intensifying screens. From the Southern blot autoradiograms, the presence of the 18- and/or 22-kb restriction fragment bands was used to identify the 3 different PAI-1 genotypes, designated in these studies as 1/1 (22-kb fragment only), 1/2 (18- plus 22-kb fragments), and 2/2 (18-kb fragment only). The identification of each PAI-1 genotype was confirmed from Southern blot hybridization autoradiograms by 3 different individuals.

Amplification and Sequencing of the Promoter and 5' Flanking Regions of the 1/1 and 2/2 PAI-1 Genotypes
A 1106-bp fragment of the promoter and the 5' flanking region from different 1/1 and 2/2 PAI-1 individual subjects containing the start site of transcription at +1 as well as the TATA box at -23 to -28 was amplified by polymerase chain reaction (PCR) with pfu DNA polymerase. The PCR was carried out using an upstream primer (5' CGATCGGTACCTAAAAGCACACCCTGCAAC 3'), identical to positions 2193 to 2214, and a downstream primer (5' CGATCAGATCTCAGAGGTGCCTTGCGATTG 3'), complementary to positions 3297 to 3278 of the human PAI-1 gene.24 25 Both primers have a CGATC clamp and a KpnI site in the upstream primer (underlined) and a BglII site in the downstream primer (underlined) to aid in the subsequent cloning into the luciferase reporter gene (luc, pGL2-basic expression vector; Promega). PCR was carried out with 100 ng of genomic DNA and 150 pmol of each primer by using pfu polymerase (2.5 U) in a DNA thermal cycler PTC-100-96 (MJ Research Inc). Conditions for the PCR reactions were as follows: template denaturation, 94°C, 45 seconds; primer annealing, 58°C, 45 seconds; primer extension, 72°C, 45 seconds, all for 30 cycles; and an additional 5-minute extension at 72°C. PCR-amplified fragments (1106 bp) were purified by electrophoresis on 1.0% agarose. The pGL2 vector was linearized upstream of the luc gene by double digestion with KpnI and BglII and treated with calf intestinal phosphatase. PCR promoter fragments were digested with KpnI and BglII and ligated into the KpnI/BglII sites of the promoterless and enhancerless luciferase reporter gene,26 27 pGL2-basic, to generate the p1PAI110/luc (from 1/1 PAI-1 promoter) and p2PAI110/luc (from 2/2 PAI-1 promoter) constructs. Ligation mixtures were transformed in JM109-competent cells for sequencing analysis. Detailed sequencing analyses were carried out with duplicate PCR clones from single PCR amplifications of 7 individual 1/1 (14 sequences) and 8 individual 2/2 (16 sequences) PAI-1 genotype promoter fragments to rule out errors due to PCR cloning or sequencing errors. Sequencing was carried out on both strands by the university's Automated DNA Sequencing Core Facility.

Transient Transfection Experiments and Measurement of Luciferase and ß-Galactosidase Activities
Constructs (p1PAI110/luc, p2PAI110/luc, and pSV–ß-galactosidase) were purified by ultracentrifugation through a CsCl/ethidium bromide gradient before transient transfection into genotyped HUVECs. Transfection experiments were carried out on semiconfluent (40% to 50%), cultured (third or fourth passage) HUVECs in 6-well tissue culture plates (960 mm2/well, {approx}4.5x105 cells/well). DNA (pSV–ß-galactosidase)-lipofectamine complexes were preformed by incubation of varying combinations of DNA (1, 2, and 3 µg/well) and lipofectamine (2.5 to 20 µg/well) in Opti-MEM 1 medium (containing only 0.25% BSA) for 45 minutes. To determine the conditions for optimal transfection efficiency into cultured HUVECs, cultures were washed twice with Opti-MEM 1 medium and then transiently transfected with the various preformed ß-galactosidase DNA–lipofectamine complexes in Opti-MEM 1 medium for 4 to 24 hours before measurement of ß-galactosidase activity (see below). Once optimal transfection conditions were determined, 1/1 and 2/2 PAI-1 genotyped HUVEC cultures were transiently transfected with their respective 1/1 and 2/2 PAI-1 promoter/luc constructs (p1PAI110/luc and p2PAI110/luc) and vice versa by using lipofectamine. An internal control plasmid, pSV–ß-galactosidase (2 µg/well), was cotransfected with the luc plasmids, and ß-galactosidase activity was used to correct for differences in DNA uptake. After transient transfection with the p1PAI110/luc and p2PAI110/luc promoter constructs, the media were removed and cultures incubated with fresh, serum-containing M199 containing 0.25% BSA for an additional 12 to 24 hours in the absence or presence of insulin (10-9 mol/L), HTG-VLDL (20 µg/mL), Lp(a) (50 µg/mL), or interleukin-1 (IL-1) (50 ng/mL, positive control). Luciferase activity28 was measured luminometrically in a Turner model TD-20 luminometer, and ß-galactosidase activity was measured colorimetrically (A420 nm) in an automated Dynatech model MR 5000 microplate reader. Individual luciferase activities were normalized for transfection efficiencies by dividing relative light units by ß-galactosidase activities from cotransfection with pSV–ß-galactosidase.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowReferences
 
Determination of PAI-1 Genotypes (HindIII RFLPs) in Individual Human Umbilical Cords
Southern blot hybridization of individual HindIII-digested DNAs, using a 32P-labeled, full-length 2.2-kb PAI-1 cDNA probe, identified the presence of the HindIII RFLPs, designated 1/1 (22-kb fragment), 1/2 (18- plus 22-kb fragments), and 2/2 (18-kb fragment, contains mutation site), as shown in Figure 1Down.



View larger version (43K):
[in this window]
[in a new window]
  		Figure 1. Southern blot hybridization of PAI-1 (HindIII RFLP) genotypes. Genomic DNA was isolated from individual cords and digested with HindIII. Digested DNA was blotted to a nylon membrane, which was then hybridized with a 32P-labeled, full-length, 2.2-kb PAI-1 cDNA probe, followed by autoradiography, as described in Methods. Restriction fragment bands were used to identify the 3 different PAI-1 genotypes, designated in these studies as 1/1 (22-kb fragment only), 1/2 (18- plus 22-kb fragments), and 2/2 (18-kb fragment only; contains the mutation site).

Sequence Analysis of the Promoter and 5' Flanking Regions of the 1/1 and 2/2 PAI-1 Genotypes
Alignment and comparison of the 1/1 versus 2/2 PAI-1 promoter regions with the published PAI-1 sequences of Ny et al25 and Bosma et al24 showed homology both with 5 gaps for the 1/1 PAI-1 promoter and 7 and 9 gaps for the 2/2 PAI-1 promoter, respectively. Detailed sequence analyses of the 1/1 (upper sequence) versus 2/2 (lower sequence) PAI-1 promoters have reproducibly identified 5 regions of small nucleotide differences that consistently occur with high frequency (Figure 2Down). These sequence variations have been designated as follows: Box A (a 2-bp difference at positions -840 and 841; AA for GG); box B (a 1-bp deletion at position -557; T); box C (a 1-bp difference at position -241; T for C); box D (a 1-bp deletion at position -216; T); and box E (a 1-bp deletion at position -138; T), as shown in Figure 2Down.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 2. Sequence alignment of the PCR-amplified (1106-bp fragment) promoter and 5' flanking regions of the 1/1 and 2/2 PAI-1 genotypes. Comparison of the 5 regions of small nucleotide differences in the 1/1 (top sequence) versus 2/2 PAI-1 (bottom sequence) promoter fragments shows that these minor alterations occur consistently and with high frequency.

Transient Transfection of Cultured HUVECs With Their Respective p1PAI110/luc and p2PAI110/luc Constructs and Vice Versa
Transient transfections with the varying combinations of preformed pSV–ß-galactosidase plasmid DNA–lipofectamine complexes for various incubation times were initially used to determine the conditions for optimal transfection efficiency into cultured HUVECs. These experiments indicated that optimal transfection efficiency was consistently achieved by incubation of semiconfluent cultured HUVECs (in 960-mm2-wells; {approx}4.5x105 cells/well) for 8 hours at 37°C with preformed DNA-lipofectamine complexes consisting of 2 µg of DNA/well mixed with 10 µg lipofectamine/well. Higher concentrations of lipofectamine (>10 µg) did not significantly increase the uptake of DNA by cultured HUVECs but did affect cell viability and caused significant cell death at >15 µg/well (data not shown).

Under the optimized conditions described above, PAI-1 genotyped, cultured HUVECs (1/1 and 2/2) were transiently transfected with their respective p1PAI110/luc and p2PAI110/luc constructs and then incubated with the various inducers insulin, HTG-VLDL, and Lp(a). Insulin induced an {approx}12- to 16-fold increase in luciferase activity in both the 1/1 and 2/2 PAI-1 HUVEC cultures transfected with the p1PAI110/luc construct but essentially no increase ({approx}1- to 2-fold) in the 1/1 and 2/2 PAI-1 HUVEC cultures transfected with the p2PAI110/luc construct (Figure 3Down). Conversely, HTG-VLDL and Lp(a) induced an {approx}14- to 16-fold and an {approx}8- to 11-fold increase, respectively, in luciferase activity in both the 1/1 and 2/2 PAI-1 HUVEC cultures transfected with the p2PAI110/luc construct but essentially no increase ({approx}1- to 2-fold) in the 1/1 and 2/2 PAI-1 HUVEC cultures transfected with the p1PAI110/luc construct (Figure 4Down). The positive control IL-1 showed an {approx}7- to 12-fold increase in luciferase activity in 1/1 and 2/2 PAI-1 HUVEC cultures transfected with either the p1PAI110/luc or p2PAI110/luc constructs, as shown in Figures 3Down and 4Down.



View larger version (25K):
[in this window]
[in a new window]
  		Figure 3. Genotype-specific induction of luciferase activity by insulin in 1/1 and 2/2 PAI-1 genotyped HUVEC cultures transiently transfected with their respective p1PAI110/luc and p2PAI110/luc constructs and vice versa. PAI-1 genotyped, cultured HUVECs (1/1 and 2/2) were transiently transfected with the 1/1 and 2/2 PAI-1 promoter/luc constructs, and luciferase activity was determined in the absence or presence of insulin (10-9 mol/L) or IL-1 (50 ng/mL, positive control) as described in Methods. Values were expressed as the ratios of noninduced controls and represent the mean±SD of 8 separate experiments.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 4. Genotype-specific induction of luciferase activity by HTG-VLDL and Lp(a) in 1/1 and 2/2 PAI-1 genotyped HUVEC cultures transiently transfected with their respective p1PAI110/luc and p2PAI110/luc constructs and vice versa. PAI-1 genotyped, cultured HUVECs (1/1 and 2/2) were transiently transfected with the 1/1 and 2/2 PAI-1 promoter/luc constructs, and luciferase activity was determined in the absence or presence of HTG-VLDL (20 µg/mL), Lp(a) (50 µg/mL), or IL-1 (50 ng/mL, positive control) as described in Methods. Values were expressed as the ratios of noninduced controls and represent the mean±SD of 12 separate experiments.

Results from these studies demonstrate that the 1106-bp fragment of the promoter and 5' flanking region of the 1/1 and 2/2 PAI-1 genotypes contains the regulatory sequence(s) important in the transcriptional regulation of the 1/1 and 2/2 PAI-1 genotypes by insulin, HTG-VLDL, and Lp(a). These cross-over results also demonstrate that transcriptional regulation of either the 1/1 or 2/2 PAI-1 genotype by their respective inducers is due to the promoter itself and not to some factor(s) expressed differently in the 1/1 versus the 2/2 PAI-1 genotype HUVEC cultures.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowReferences
 
Impaired fibrinolysis has been suggested to predispose to coronary artery thrombosis, which may have an important role in the pathogenesis of CAD and MI.1 2 Well-established risk factors for MI, such as smoking, obesity, hyperlipoproteinemia, and hyperinsulinemia, are commonly associated with impaired fibrinolysis.5 29 30 31 Impaired fibrinolysis has been associated with elevated PAI-1 levels, and this relation strongly suggests that PAI-1 may have an important pathological role in the development and progression of CAD and eventual MI.1 32 It is conceivable that the elevated blood levels of PAI-1 seen in patients with non–insulin-dependent diabetes mellitus, HTG, and syndrome X5 33 34 35 may in part explain their increased thrombotic risk and CAD prevalence, which are unexplained by conventional risk factors in these subjects.5 6 Also, elevated levels of PAI-1 are often associated with HTG-VLDL. Several in vitro studies have demonstrated that these specific components, including high levels of insulin or proinsulin-like molecules, hyperglycemia, HTG, and Lp(a), will increase PAI-1 production.7 8 12 36 37 Various cell types have been shown to produce PAI-1 in vivo, including hepatocytes and ECs.38 In HepG2 cells, insulin induced a dose-dependent increase in secreted PAI-1 antigen (4.8-fold) and a 2- to 3-fold increase in steady-state PAI-1 mRNA levels.39 40 Similarly, HTG-VLDL induced PAI-1 mRNA expression 2- to 3-fold and PAI-1 antigen secretion by 2-fold.41 42 Lp(a) has also been shown to increase PAI-1 antigen and mRNA levels.43

Epidemiological studies have described an interrelationship between plasma PAI-1 levels, specific PAI-1 genotypes, and risk factors.12 44 45 An HindIII RFLP and a dinucleotide repeat (C-A)n polymorphism have been used as markers for genetic variation in the PAI-1 gene in young post-MI patients and population-based controls.12 Of major interest was the fact that the associations of insulin and VLDL with PAI-1 levels appeared to be genotype specific. Subjects with the HindIII genotype 2/2 showed increased PAI-1 in association with plasma VLDL only, whereas the 1/1 genotype showed increased PAI-1 levels in association with insulin only.12 These authors hypothesized that the HindIII polymorphism is in linkage disequilibrium with a base change at a site of functional importance in the regulation of PAI-1 and that a relationship exists between PAI-1 levels, PAI-1 genotypes, and regulation by VLDL and insulin. Previous studies using cultured ECs (human umbilical vein or human or porcine aorta) did not demonstrate an insulin-mediated effect on PAI-1 expression.37 38 These conclusions are in apparent contradiction with the studies reported here, in which PAI-1 expression may be regulated by insulin in a genotype-specific manner in cultured HUVECs. Because the 1/1 PAI-1 genotype occurs in only {approx}20% of the population and most studies use pooled cultures, it is conceivable that the predominant population of ECs in these pooled cultures in fact represents only the low or nonresponsive 1/2 or 2/2 PAI-1 genotypes and, hence shows little or no response to insulin as we report herein.12 These studies emphasize the newly emerging concept and importance of conducting future experiments with individually genotyped cultured HUVECs to identify and define the responsiveness of human ECs to regulators or inducers of specific protein expression.

Several recent studies have demonstrated that regulation of the PAI-1 gene at the transcription level occurs through specific cis-regulatory regions. Functional studies in which the promoter region of the human PAI-1 gene was attached to a reporter gene have provided reliable information on the ability of different sections of the gene to promote transcriptional responses to different stimuli in cell culture, including glucocorticoids, transforming growth factor-ß, and phorbol myristate acetate.10 11 13 46 Recently, tumor necrosis factor-{alpha} was shown to increase cytosolic calcium in cultured U937 cells, and it was concluded that calcium triggers a pathway that upregulates PAI-1 synthesis and positively interacts with the tumor necrosis factor-{alpha}–induced pathway that stimulates PAI-1 synthesis.47 Previous studies have demonstrated the ability of insulin to transcriptionally regulate the expression of various genes, including c-fos, glucagon, and amylase genes.48 49 50 Insulin also stimulates a serine/threonine kinase in 3T3-L1 adipocytes (mitogen-activated protein kinases).51 However, the mechanism(s) of signal transduction in the induction of PAI-1 mRNA by insulin is presently unknown. Insulin and insulin growth factor-1 have similar biological activities and have been shown to induce PAI-1 gene expression in HepG2 cells. We have carried out similar experiments with PAI-1 (HindIII RFLP) genotyped, cultured HUVECs and insulin growth factor -1 (10-7 mol/L), without any effects on PAI-1 mRNA levels (H.E.G. et al, unpublished data, 1998). A new class of antidiabetic agents, thiazolidinediones, has been shown to affect insulin-induced stimulation of glycogen synthase52 as well as leptin and lipoprotein lipase gene expression at the transcriptional levels.53 54 However, the effect of thiazolidinediones on the regulation of PAI-1 gene expression by insulin has not been reported.

The mechanism by which insulin, HTG-VLDL, or Lp(a) regulates PAI-1 expression in a genotype-specific manner has not yet been clearly identified or defined. Recently, we have demonstrated the genotype-specific transcriptional upregulation of the 2/2 PAI-1 genotype by HTG-VLDL Sf 100 to 400 and Lp(a) in cultured HUVECs by using nuclear transcription run-on assays.55 Similarly, we have demonstrated the genotype-specific transcriptional upregulation of the 1/1 PAI-1 genotype by insulin in cultured HUVECs.56 These results are in apparent contradiction with studies in HepG2 cells, in which HTG-VLDL and insulin increased PAI-1 levels by stabilizing the steady-state levels of PAI-1 mRNA rather than by increasing gene transcription.41 57 The apparent differences in the regulation of PAI-1 gene expression by HTG-VLDL and insulin in cultured HUVECs versus HepG2 cells is presently unknown and remains to be further elucidated. However, the studies described here demonstrate that the regulation of PAI-1 gene expression by HTG-VLDL, Lp(a), and insulin is mediated through specific inducible element(s) contained in the 1106-bp promoter and 5' flanking region of the 1/1 and 2/2 PAI-1 genotypes. Identification of regulatory elements in the promoter and 5' flanking region of the 1/1 and 2/2 PAI-1 genotypes, responsive to HTG-VLDL, Lp(a), or insulin, would provide significant new insights into a unique form of regulation of the fibrinolytic system. This genotyped regulation may be important in explaining the increased risk for thrombosis and atherosclerosis in patients with non–insulin-dependent diabetes mellitus and HTG. It may be particularly important in those patients with syndrome X, who have these combined metabolic abnormalities.


*    Acknowledgments
 
These studies were supported in part by National Institutes of Health grants DK 53536 (to H.E.G.) and HL 52791 (to F.M.B.). Dr Benza was supported in part by National Institutes of Health Institutional National Research Service Award T32 HL 07703 during the course of these studies. We would like to thank the labor and delivery staffs at Brookwood Medical Center and University Hospital, Birmingham, Ala, for providing the umbilical cords used for the isolation of cultured HUVECs in these studies.

Received April 21, 1998; accepted May 21, 1998.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Hamsten A, Wiman B, de Faire V, Blomback M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med. 1985;313:1557–1563.[Abstract]
  2. Wiman B, Hamsten A. The fibrinolytic enzyme system and its role in the etiology of thromboembolic disease. Semin Thromb Haemost. 1990;16:207–216.[Medline] [Order article via Infotrieve]
  3. Bachmann FW. Fibrinolysis. In: Verstraete M, Vermylen J, Lijnen HR, Arnout J, eds. Thrombosis Haemostasis. Leuven, Belgium: Leuven University Press; 1987:227–265.
  4. Sprengers ED, Kluft C. Plasminogen activator inhibitors. Blood. 1987;69:381–387.[Free Full Text]
  5. Auwerx JH, Bouillon R, Collen D, Geboers J. Tissue-type plasminogen activator antigen and plasminogen activator inhibitor in diabetes mellitus. Arteriosclerosis. 1988;8:68–72.[Abstract/Free Full Text]
  6. Gray RP, Yudkin JS, Patterson DL. Plasminogen activator inhibitor: a risk factor for myocardial infarction in diabetic patients. Br Heart J. 1993;69:228–232.[Abstract/Free Full Text]
  7. Nordt TK, Sawa H, Sujii S, Sobel BE. Induction of plasminogen activator inhibitor type-1 (PAI-1) by proinsulin and insulin in vivo. Circulation. 1995;91:764–770.[Abstract/Free Full Text]
  8. Nordt TK, Schneider DJ, Sobel BE. Augmentation of the synthesis of plasminogen activator inhibitor type-1 by precursors of insulin: a potential risk factor for vascular disease. Circulation. 1994;89:321–330.[Abstract/Free Full Text]
  9. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:10739–10745.[Abstract/Free Full Text]
  10. van Zonneveld AJ, Curriden SA, Loskutoff DJ. Type 1 plasminogen activator inhibitor gene: functional analysis and glucocorticoid regulation of its promoter. Proc Natl Acad Sci U S A. 1988;85:5525–5529.[Abstract/Free Full Text]
  11. Keeton MR, Curriden SA, van Zonneveld AJ, Loskutoff DJ. Identification of regulatory sequences in the type I plasminogen activator inhibitor gene responsive to transforming growth factor ß. J Biol Chem. 1991;266:23048–23052.[Abstract/Free Full Text]
  12. Dawson SJ, Hamsten A, Wiman B, Henney A, Humphries S. Genetic variation at the plasminogen activator inhibitor-1 locus is associated with altered levels of plasma plasminogen activator inhibitor-1 activity. Arterioscler Thromb. 1991;11:183–190.[Abstract/Free Full Text]
  13. Descheemaeker KA, Wyns S, Nelles L, Auwerx JH, Ny T, Collen D. Interaction of AP-1-, AP-2-, and Sp1-like proteins with two distinct sites in the upstream regulatory region of the plasminogen activator inhibitor-1 gene mediates the phorbol 12-myristate 13-acetate response. J Biol Chem. 1992;267:15086–15091.[Abstract/Free Full Text]
  14. Shaul Y, Ben-Levy R, De-Medina T. High affinity binding site for nuclear factor I next to the hepatitis B virus S gene promoter. EMBO J. 1986;86:1967–1971.
  15. Lee W, Mitchell P, Tjian R. Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell. 1987;49:741–752.[Medline] [Order article via Infotrieve]
  16. Gianturco SH, Bradley WA. The role of apolipoprotein processing in receptor recognition of VLDL. In: Albers JJ, Segrest JP, eds. Methods in Enzymology. New York, NY: Academic Press; 1986:319–344.
  17. Fless GM, Snyder ML. Polymorphic forms of Lp(a) with different structural and functional properties: cold induced self-association, and binding to fibrin and lysine-Sepharose. Chem Phys Lipids. 1994;67/68:69–79.
  18. Fless GM, Snyder ML, Furbee JW Jr, Garcia-Hedo MT, Mora R. Subunit composition of lipoprotein(a) protein. Biochemistry. 1994;33:13492–13501.[Medline] [Order article via Infotrieve]
  19. Li XN, Varma VK, Parks JM, Benza RL, Koons JC, Grammer JR, Grenett HE, Tabengwa EM, Booyse FM. Thrombin decreases the urokinase receptor and surface-localized fibrinolysis in cultured endothelial cells. Arterioscler Thromb Vasc Biol. 1995;15:410–419.[Abstract/Free Full Text]
  20. Haddock RC, Baker CD, Grammer JR, Parks JM, Speidel MT, Spell ML, Booyse FM. Urokinase binding and receptor identification in cultured endothelial cells. J Biol Chem. 1991;266:21466–21473.[Abstract/Free Full Text]
  21. Booyse FM, Quarfoot AJ, Chediak J, Stemerman MB, Maciag T. Characterization and properties of cultured human von Willebrand umbilical vein endothelial cells. Blood. 1981;58:788–796.[Free Full Text]
  22. Maniatis T, Fritsch EF, Sambrook J. Plasmid Vectors. In: Irwin N, Ford N, Nolan C, Ferguson M, Ockler M, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1982.
  23. Ny T, Sawdey M, Lawrence D, Millan JL, Loskutoff DJ. Cloning and sequence of a cDNA coding for the human B-migrating endothelial-cell-type plasminogen activator inhibitor. Proc Natl Acad Sci U S A. 1986;83:6776–6780.[Abstract/Free Full Text]
  24. Bosma PJ, van den Berg EA, Kooistra T, Siemieniak DR, Slightom JL. Human plasminogen activator inhibitor-1 gene: promoter and structural gene nucleotide sequences. J Biol Chem. 1988;263:9129–9141.[Abstract/Free Full Text]
  25. Ny T, Elgh F, Lund B. The structure of the human tissue-type plasminogen activator gene: correlation of intron and exon structures to functional and structural domains. Proc Natl Acad Sci U S A. 1984;81:5355–5359.[Abstract/Free Full Text]
  26. de Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S. Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol. 1987;7:725–737.[Abstract/Free Full Text]
  27. de Wet JR, Wood KV, Helinski DR, DeLuca M. Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc Natl Acad Sci U S A. 1985;82:7870–7873.[Abstract/Free Full Text]
  28. Wood KV. Luc genes: introduction of colour into bioluminescence assays. J Biolumin Chemilumin. 1990;5:107–114.[Medline] [Order article via Infotrieve]
  29. Eliasson B, Attvall S, Taskinen M, Smith U. The insulin resistance syndrome in smokers is related to smoking habits. Arterioscler Thromb. 1994;14:1946–1950.[Abstract/Free Full Text]
  30. Mehta J, Mehta P, Lawson D, Saldeen T. Plasma tissue plasminogen activator inhibitor levels in coronary artery disease: correlation with age and serum triglyceride concentrations. J Am Coll Cardiol. 1987;9:263–268.[Abstract]
  31. Fontbonne A, Charles MA, Thibult N, Richard JL, Claude JR, Warnet JM, Rosselin GE, Eschwege E. Hyperinsulinaemia as a predictor of coronary heart disease mortality in a healthy population: the Paris Prospective Study, 15-year follow-up. Diabetologia. 1991;34:356–361.[Medline] [Order article via Infotrieve]
  32. Hamsten A, de Faire U, Walldius G, Dahlen G, Szamosi A, Landou C, Blomback M, Wiman B. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet. 1987;2:3–9.[Medline] [Order article via Infotrieve]
  33. Juhan-Vague I, Alessi MC, Vague P. Increased plasma plasminogen activator inhibitor 1 levels: a possible link between insulin resistance and atherothrombosis. Diabetologia. 1991;34:457–462.[Medline] [Order article via Infotrieve]
  34. Juhan-Vague I, Vague P. Hypofibrinolysis and insulin-resistance. Diabete Metab. 1991;17:96–100.[Medline] [Order article via Infotrieve]
  35. Juhan-Vague I, Roul C, Alessi MC, Ardissone JP, Heim M, Vague P. Increased plasminogen activator inhibitor in non insulin dependent diabetic patients: relationship with plasma insulin. Thromb Haemost. 1989;61:370–373.[Medline] [Order article via Infotrieve]
  36. Alessi MC, Juhan-Vague I, Kooistra T, Declerck PJ, Collen D. Insulin stimulates the synthesis of plasminogen activator inhibitor 1 by the human hepatocellular cell line HepG2. Thromb Haemost. 1988;60:491–494.[Medline] [Order article via Infotrieve]
  37. Nordt TK, Klassen KJ, Schneider DJ, Sobel BE. Augmentation of synthesis of plasminogen activator inhibitor type-1 in arterial endothelial cells by glucose and its implications for local fibrinolysis. Arterioscler Thromb. 1993;13:1822–1828.[Abstract/Free Full Text]
  38. Klassen KJ, Nordt TK, Schneider DJ, Sobel BE. Constitutive biosynthesis of plasminogen activator inhibitor type-1 (PAI-1) by cultured human aortic endothelial cells independent of insulin. Coron Artery Dis. 1993;4:713–719.[Medline] [Order article via Infotrieve]
  39. Anfosso F, Chomiki N, Alessi MC, Vague P, Juhan-Vague I. Plasminogen activator inhibitor-1 synthesis in the human hepatoma cell line Hep G2. J Clin Invest. 1993;91:2185–2193.
  40. Anfosso F, Alessi MC, Nalbone G, Chomiki N, Henry M, Juhan-Vague I. Up-regulated expression of plasminogen activator inhibitor-1 in Hep G2 cells: interrelationship between insulin and insulin-like growth factor 1. Thromb Haemost. 1995;73:268–274.[Medline] [Order article via Infotrieve]
  41. Sironi L, Mussoni L, Prati L, Baldassarre D, Camera M, Banfi C, Tremoli E. Plasminogen activator inhibitor type-1 synthesis and mRNA expression in HepG2 cells are regulated by VLDL. Arterioscler Thromb Vasc Biol. 1996;16:89–96.[Abstract/Free Full Text]
  42. Stiko-Rahm A, Wiman B, Hamsten A, Nilsson J. Secretion of plasminogen activator inhibitor-1 from cultured human umbilical vein endothelial cells is induced by very low density lipoproteins. Arteriosclerosis. 1990;10:1067–1073.[Abstract/Free Full Text]
  43. Etingin OR, Hajjar DP, Hajjar KA, Harpel PC, Nachman RL. Lipoprotein (a) regulates plasminogen activator inhibitor-1 expression in endothelial cells: a potential mechanism in thrombogenesis. J Biol Chem. 1991;268:2459–2465.
  44. Mansfield MW, Stickland MH, Grant PJ. Plasminogen activator inhibitor-1 (PAI-1) promoter polymorphism and coronary artery disease in non-insulin-dependent diabetes. Thromb Haemost. 1995;74:1032–1034.[Medline] [Order article via Infotrieve]
  45. Eriksson P, Kallin B, van `T Hooft FM, Bavenholm P, Hamsten A. Allele-specific increase in basal transcription of the plasminogen-activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci U S A. 1995;92:1851–1855.[Abstract/Free Full Text]
  46. Westerhausen DR, Hopkins WE, Billadello JJ. Multiple transforming growth factor-ß-inducible elements regulate expression of the plasminogen activator inhibitor type-1 gene in Hep G2 cells. J Biol Chem. 1991;266:1092–1100.[Abstract/Free Full Text]
  47. Peiretti F, Fossat C, Anfosso F, Alessi MC, Henry M, Juhan-Vague I, Nalbone G. Increase in cytosolic calcium upregulates the synthesis of type 1 plasminogen activator inhibitor in the human histiocytic cell line U937. Blood. 1996;87:162–173.[Abstract/Free Full Text]
  48. Stumpo DJ, Stewart TN, Gilman MZ, Blackshear PJ. Identification of c-fos sequences involved in induction by insulin and phorbol esters. J Biol Chem. 1988;263:1611–1614.[Abstract/Free Full Text]
  49. Philippe J. Insulin regulation of the glucagon gene is mediated by an insulin-responsive DNA element. Proc Natl Acad Sci U S A. 1991;88:7224–7227.[Abstract/Free Full Text]
  50. Keller SA, Rosenberg MP, Johnson TM, Howard G, Meisler MH. Regulation of amylase gene expression in diabetic mice is mediated by a cis-acting upstream element close to the pancreas-specific enhancer. Gene Dev. 1990;4:1316–1321.[Abstract/Free Full Text]
  51. Ray LB, Sturgill TW. Rapid stimulation by insulin of a serine/threonine kinase in 3T3–L1 adipocytes that phosphorylates microtubule-associated protein 2 in vitro. Proc Natl Acad Sci U S A. 1987;84:1502–1506.[Abstract/Free Full Text]
  52. Berger J, Biswas C, Hayes N, Ventre J, Wu M, Doebber TW. An antidiabetic thiazolidinedione potentiates insulin stimulation of glycogen synthase in rat adipose tissues. Endocrinology. 1996;137:1984–1990.[Abstract]
  53. Hollenberg AN, Susulic VS, Madura JP, Zhang B, Moller DE, Tontonoz P, Sarraf P, Spiegelman BM, Lowell BB. Functional antagonism between CCAAT/enhancer binding protein-{alpha} and peroxisome proliferation-activated receptor-{gamma} on the leptin promoter. J Biol Chem. 1997;272:5283–5290.[Abstract/Free Full Text]
  54. Schoonjans K, Peinado-Onsurbe J, Lefebvre AM, Heyman RA, Briggs M, Deeb S, Staels B, Auwerx J. PPAR{alpha}, and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J. 1996;15:5336–5348.[Medline] [Order article via Infotrieve]
  55. Li XN, Grenett HE, Benza RL, Demissie S, Brown SL, Tabengwa EM, Bradley WA, Gianturco SH, Fless GM, Booyse FM. Genotype-specific transcriptional regulation of PAI-1 expression by hypertriglyceridemic (HTG)-VLDL and Lp(a) in cultured human endothelial cells. Arterioscler Thromb Vasc Biol. 1997;17:3215–3223.[Abstract/Free Full Text]
  56. Grenett HE, Benza RL, Li XN, Hines RB, Reeder VC, Brown SL, Booyse FM. Expression of plasminogen activator inhibitor type I in genotyped human endothelial cell cultures: genotype-specific regulation by insulin. Abstracts Submitted to the Council on Arteriosclerosis for the 69th Scientific Sessions of the American Heart Association. 1996:51. Abstract.
  57. Fattal PG, Sachneider DJ, Sobel BE, Billadello JJ. Post-transcriptional regulation of expression of plasminogen activator inhibitor type 1 mRNA by insulin and insulin-like growth factor 1. J Biol Chem. 1992;267:12412–12415.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
C Roncal, J Orbe, J.A Rodriguez, M Belzunce, O Beloqui, J Diez, and J.A Paramo
Influence of the 4G/5G PAI-1 genotype on angiotensin II-stimulated human endothelial cells and in patients with hypertension
Cardiovasc Res, July 1, 2004; 63(1): 176 - 185.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. I. Vulin and F. M. Stanley
A Forkhead/Winged Helix-related Transcription Factor Mediates Insulin-increased Plasminogen Activator Inhibitor-1 Gene Transcription
J. Biol. Chem., May 31, 2002; 277(23): 20169 - 20176.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
O. Klezovitch, C. Edelstein, and A. M. Scanu
Stimulation of Interleukin-8 Production in Human THP-1 Macrophages by Apolipoprotein(a). EVIDENCE FOR A CRITICAL INVOLVEMENT OF ELEMENTS IN ITS C-TERMINAL DOMAIN
J. Biol. Chem., December 7, 2001; 276(50): 46864 - 46869.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
E. M. Tabengwa, R. L. Benza, H. E. Grenett, and F. M. Booyse
Hypertriglyceridemic VLDL Downregulates Tissue Plasminogen Activator Gene Transcription Through cis-Repressive Region(s) in the Tissue Plasminogen Activator Promoter in Cultured Human Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., June 1, 2000; 20(6): 1675 - 1681.
[Abstract] [Full Text] [PDF]

Home page
 J Am Coll CardiolHome page
J. L. Anderson, J. B. Muhlestein, J. Habashi, J. F. Carlquist, T. L. Bair, S. P. Elmer, and B. P. Davis
Lack of association of a common polymorphism of the plasminogen activator inhibitor-1 gene with coronary artery disease and myocardial infarction
J. Am. Coll. Cardiol., November 15, 1999; 34(6): 1778 - 1783.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grenett, H. E.
Right arrow Articles by Booyse, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grenett, H. E.
Right arrow Articles by Booyse, F. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Triglycerides

ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search
Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited.