© 1998 American Heart Association, Inc.
Original Contributions |
HMG-CoA Reductase Inhibitors Reduce MMP-9 Secretion by Macrophages
From the Institute of Pharmacological Sciences, University of Milan (S.B., M.C., R.F., R.P.) and the Institute of Pharmacology and Pharmacognosy, University of Parma (F.B.), Italy; Baylor College of Medicine (D.V.), Houston, Tex; and Novartis Pharma AG (P.P.), Basel, Switzerland.
Correspondence to Prof Franco Bernini, Institute of Pharmacology and Pharmacognosy, University of Parma, Via delle Scienze, 43100 Parma, Italy. E-mail fbernini{at}ipruniv.cce.unipr.it
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Macrophages secrete matrix metalloproteinases (MMPs) that may weaken the fibrous cap of atherosclerotic plaque, predisposing its fissuration. The 92-kDa gelatinase B (MMP-9) has been identified in abdominal aortic aneurysms and in atherosclerotic tissues. Fluvastatin, through the inhibition of the isoprenoid pathway, inhibits major processes of atherogenesis in experimental models (smooth muscle cell migration and proliferation and cholesterol accumulation in macrophages). We studied the effect of fluvastatin on the activity of MMP-9 in mouse and human macrophages in culture. Conditioned media of cells treated for 24 hours with fluvastatin were analyzed by gelatin zymography. In mouse macrophages, fluvastatin (5 to 100 µmol/L) significantly inhibited in a dose-dependent manner MMP-9 activity from 20% to 40% versus control. The drug, at a concentration as low as 5 µmol/L, inhibited MMP-9 activity (
30%) in human monocyte–derived
macrophages as well. Phorbol esters (TPA, 50 ng/mL) stimulated
MMP-9 activity by 50%, and fluvastatin inhibited this
enhanced activity up to 50% in both mouse and human
macrophages. The above results on the secretion of MMP-9 were
confirmed by Western blotting and ELISA. The inhibitory
effect of fluvastatin was overcome by the
simultaneous addition of exogenous mevalonate (100
µmol/L), a precursor of isoprenoids. Fluvastatin's
effect was fully reversible, and the drug did not cause any cellular
toxicity. The statin did not block directly the in vitro activation of
the secreted protease. Similar data were obtained with simvastatin.
Altogether, our data indicate an inhibition of MMP-9 secretion by the
drug. This effect is mediated by the inhibition of synthesis of
mevalonate, a precursor of numerous derivatives essential for several
cellular functions.
Key Words: statins • macrophages • plaque stability • metalloproteinases
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Advanced human atherosclerotic plaques are characterized by a lipid core covered by a fibrous cap composed of smooth muscle cells (SMCs) and extracellular matrix.1 These lesions also have chronic inflammatory infiltrates of macrophages and T lymphocytes. Composition and stability of the plaque, rather than its volume (ie, severity of stenosis), are the most important determinants of atherosclerosis complications. Plaque disruption with superimposed thrombosis is the main cause for the acute coronary syndrome of unstable angina, myocardial infarction, and sudden death.2 Plaque instability, manifesting as ulceration of the fibrous cap, plaque rupture, or intraplaque hemorrhage, is characteristic of plaques with a high lipid content and excess macrophages in the cap.3 4
Disrupted aortic caps contain fewer SMCs (collagen-synthesizing cells)
and less collagen than intact caps.3 5 Collagen
is the main component of fibrous caps responsible for their tensile
strength.5 In addition to the plaque rupture, the
matrix composition participates in several key events in the
development of the atherosclerotic lesion: cell migration and
proliferation, lipoprotein retention, cell adhesion, calcification,
thrombosis, coagulation, and apoptosis.6
A wide range of proteases may be produced at focal sites in plaques.
Macrophages are capable of degrading extracellular matrix by
phagocytosis or by secreting proteolytic enzymes, in particular a
family of metalloproteinases (MMPs) that may weaken the fibrous cap,
predisposing its rupture.7 The 92-kDa gelatinase
B, or MMP-9, is the most prevalent form, expressed by virtually all
activated macrophages, and has been shown to be more
common in atherectomy materials from unstable
angina8 and abdominal aortic
aneurysm.9 In addition to
macrophages, SMCs may release MMPs, an event relevant not only
to atherogenesis but especially to the process of restenosis
after angioplasty.7 MMPs play a major role in
restenosis by liberating the SMC from its pericellular matrix
cage as a prerequisite to proliferation and
migration.10 11 12 13 14 MMPs are a family of
Zn2+- and Ca2+-dependent
enzymes, which are important in the resorption of extracellular
matrixes in both physiological and pathological
processes. The MMPs are secreted as the proenzyme and, once
activated, can completely degrade all extracellular matrix
components. The regulation of these enzymes is very important and
occurs at 3 levels: transcription, activation of latent
proenzymes, and inhibition of proteolytic
activity.15 16 Interleukin-1,
platelet-derived growth factor, and tumor necrosis factor-
stimulate the synthesis of MMPs; transforming growth factor-ß
(TGF-ß), heparin, and corticosteroids have an
inhibitory effect.7 15 Plasmin is a
potent proenzyme activator of most MMPs, but
plasmin-independent pathways also exist.17 18 In
vitro experiments have shown that phorbol esters
(12-0-tetradecanoylphorbol 13-acetate [TPA]) and
lipopolysaccharide can stimulate MMP
secretion.19 MMPs are inhibited by a family of
naturally occurring specific inhibitors (tissue
inhibitors of metalloproteinases [TIMPs]), which are
secreted multifunctional proteins essential in the regulation of
connective tissue metabolism.
In addition to lipid-lowering therapy, which most probably affects the size of the atheromatous core, plaque stabilization could be achieved by a direct inhibition of MMPs in the arterial wall. Along with TGF-ß, corticosteroids, and heparin, several synthetic inhibitors have been investigated: namely, tetracyclines, antracyclines, and synthetic peptides. The efficacy of these molecules in therapy, however, is questionable.7 The inhibition of MMP activity also has been investigated in tumor therapy.
In our laboratory, we demonstrated that fluvastatin, a hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitor (statin), may directly interfere with the major processes of atherogenesis occurring in the arterial wall.20 SMC migration and proliferation are inhibited by the drug,21 22 and cholesterol accumulation is prevented in macrophages23 by reducing modified-LDL endocytosis.24 Interestingly, the inhibitory activity observed in macrophages was more pronounced in cholesterol-loaded cells than in normal cells, suggesting a potential selectivity of the drug for the foam cells and hence for the atherosclerotic lesion.24 All cellular effects mentioned above are mediated by inhibition of the isoprenoid pathway. Because the isoprenoid pathway is involved in several cellular processes25 and macrophage-derived foam cells constitutively produce MMPs,26 we studied the effect of fluvastatin on secreted MMP-9 activity in macrophages in vitro.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture
Mouse peritoneal macrophages (MPMs) were collected by peritoneal lavage with PBS from mice given a 3-mL intraperitoneal injection of 4% thioglycollate in water. The MPMs were pelleted, washed twice with serum-free Dulbecco's modified Eagle's medium (DMEM; GIBCO BRL), plated at a density of 3x106 cells/35-mm dish, and allowed to adhere to dishes for 2 hours in DMEM containing 10% FBS. Then, plates were washed 3 times with DMEM to remove nonadherent cells and incubated in DMEM containing 10% FBS until the day of the experiment.
Circulating human monocyte–derived macrophages (HMs) were isolated from the blood of healthy donors. In brief, blood was centrifuged, and the buffy coats were underlayered with Ficoll-Paque (Pharmacia) and centrifuged at 320g for 35 minutes at 25°C. The monocytes in a broad band below the interface were collected using a siliconized Pasteur pipette and washed 3 times with cold PBS. The final pellet was resuspended in serum-free DMEM, and the cells were plated at a density of 3x106 cells in a 35-mm dish. After 2 hours, cell monolayers were washed twice, and the adherent cells were incubated for 10 to 14 days with DMEM containing 10% human AB serum and insulin (8 µg/mL).
To generate the conditioned media, cells were incubated for 24 hours at 37°C with DMEM supplemented with 0.2% BSA (Sigma) and increasing concentrations of fluvastatin in the absence or presence of phorbol esters (TPA, 50 ng/mL; Sigma). At the end of the incubation, the conditioned media were collected, and the activity of secreted MMP-9 was analyzed by zymography. Cellular protein content was measured according to Lowry et al.26 Cellular toxicity caused by the drug was assessed using the dimethylthiazaol-diphenyltetrazolium bromide assay (MTT), which relied on the ability of viable cells to actively metabolize a tetrazolium dye.27
SDS–Polyacrylamide Gel Electrophoresis Zymography
Electrophoresis was performed on samples (40 µL for MPMs and 5
µL for HMs of conditioned medium per lane) at 4°C on 7.5%
polyacrylamide gels containing 10% SDS and gelatin (1 mg/mL)
under nonreducing conditions and without boiling. After
electrophoresis, SDS was removed from gels in 2 washes with 2.5%
Triton X-100 (Sigma) at room temperature. After washes, the gels were
incubated overnight at 37°C with gentle shaking in Tris (50
mmol/L; pH 7.5) containing NaCl (150 mmol/L),
CaCl2 (10 mmol/L), and
ZnCl2 (1 µmol/L) to activate the
MMP's ability to digest the substrate. For inhibition studies and to
confirm the identity of MMPs, identical gels were incubated in the
above buffer containing either EDTA (20 mmol/L), an
inhibitor of MMPs, or PMSF (1 mmol/L), an
inhibitor of serine proteinases. The addition of PMSF did
not alter MMP-9 activity, whereas the treatment with EDTA completely
abolished it (data not shown). At the end of the incubation, the gels
were stained with a solution of 0.1% Coomassie brilliant blue R-250
(Sigma) in 25% methanol and 7% acetic acid. Clear zones against the
blue background indicated the presence of proteinolytic activity. It is
important to note that in this SDS-containing gel, the latent form of
MMP-9, pro–MMP-9, and the activated gelatinase develop
gelatinolytic activity.28
Therefore, we used the word "activity" to indicate the total
gelatinolytic capacity measured in the conditioned
media, which, in our experimental conditions, is due entirely to the
92-kDa pro–MMP-9, as assessed by zymography and Western blot
analysis (see experimental data), and after activation by
incubation for 2 hours at 37°C with 2 mmol/L APMA
(4-aminophenylmercuric acetate), the propeptide is cleaved to the
active form (<90-kDa; data not shown).
Western Blot Analysis
Aliquots of the conditioned media (40 µL per lane) were run on
10% polyacrylamide gel containing SDS, under nonreducing
conditions. The proteins were blotted to nitrocellulose membranes
(Bio-Rad) and incubated with a 3% solution of defatted dried milk in
PBS containing 0.1% Tween 20 (PBS-T) to block nonspecific binding.
Then a mouse monoclonal antibody anti–human MMP-9 (clone 6-6B;
Calbiochem) diluted in PBS-T was added, and the incubation continued
for 1 hour. This antibody recognizes both the latent (92 kDa) and
active (83 kDa) forms of human MMPs-9 under nonreducing conditions but
only the latent form under reducing conditions.29
The bound primary antibody was detected using an anti-mouse secondary
antibody conjugated to horseradish peroxidase (Sigma) and the enhanced
chemiluminescence kit (Amersham) according to the manufacturer's
instructions.
Northern Blot Analysis
RNA was extracted (RNAzol B; Tel-Test Inc) from
3x107 to 4x107 primary
HMs cultured for 12 days and treated with and without 50 µmol/L
fluvastatin for 24 hours before harvest. Equal amounts of
total RNA (10 µg) were denatured in 2.2 mol/L formaldehyde, 50%
deionized formamide, and 50 mmol/L MOPS (pH 7.0) at 55°C and
electrophoresed on 1% agarose gels containing 3.4% formaldehyde. RNA
was blot-transferred to GeneScreen Plus membranes using 10x SSC and
fixed with UV irradiation. Blots were prehybridized at 68°C for 1
hour. An MMP-9 probe was generated from THP-1 cells treated with TPA by
reverse transcription–polymerase chain reaction (PCR) of total RNA
using the following primers: sense, 5' TGGGCAGATTCCAAACCTTTGAGGGC 3'
and antisense, 5' CCATTCACGTCGTCCTTATGCAAGGG 3'. The 1003-bp
product was subcloned into the pCRII vector, and its sequence was
verified as MMP-9. Purified MMP-9 probe (QIAquick, Quiagen, 25 ng)
generated by PCR from the vector or a G3PDH probe (Clontech) were
labeled with [32P]dCTP by random priming and
incubated with the blots in ExpressHyb (Clontech) for 1 hour at 68°C.
Blots were washed (2x SSC; 0.05% SDS) exhaustively at room
temperature and given a final wash at 50°C (0.1x SSC; 0.1% SDS) for
10 minutes. Blots were exposed for autoradiography
(X-OMAT AR, Kodak) and then placed on a Bio-Rad BI screen for
quantitative analysis in the Bio-Rad GS 363 Molecular Imager.
After autoradiography to detect MMP-9 mRNA, the blot
was stripped by incubation in 0.01% SDS, 0.01x SSC for 15 minutes at
100°C. The blot then was reprobed for the G3PDH housekeeping
gene.
ELISA
The amount of secreted MMP-9 protein was quantified using the
highly specific Biotrak Matrix MMP-9 ELISA systems (Amersham). The
MMP-9 assay uses 2 antibodies directed against different epitopes of
MMP-9 and does not show detectable cross-reactivity with MMP-1, -2, and
-3 and TIMP-1 and -2 (Amersham). Aliquots of conditioned media were
analyzed as suggested by the manufacturer.
Statistical Analysis
For quantitation of Western blots and zymograms, densitometric
scanning was performed using a system incorporating a video camera and
a computer analysis package (NIH Image 1.52 image
analysis software). Each experiment was performed at least 3
times with different preparations of cells. Background was set for each
gel, and each lane was analyzed sequentially. Results were
normalized by cellular protein content and expressed as optical density
units. To validate the method, a linear response of optical density
units versus dilution was obtained for different serial dilutions on 2
separate samples (data not shown). To standardize conditions between
gels, an aliquot of a standard sample was loaded on each gel, and
values for each band then were normalized to the value of the band of
the reference sample run on the same gel. Data are presented as
mean±SD and analyzed using the Student t test. P
values <0.05 were considered statistically significant
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
To study the effect of fluvastatin on MMP-9 activity, we incubated MPMs for 24 hours with increasing concentrations of the drug. The conditioned media then were collected and analyzed by gelatin zymography. This technique allows the visualization of both the active and proenzyme forms of gelatinases. In our experimental conditions, we observed only the pro–MMP-9 form (Figure 1
). The analysis of the data
obtained in 3 different experiments showed that the addition of
fluvastatin (5 to 100 µmol/L) significantly
inhibited in a dose-dependent manner MMP-9 activity from 20% to 40%
versus control (nontreated cells) (Figure 2A). As expected,
dexamethasone, a corticosteroid known to
inhibit MMP gene transcription,7 suppressed
almost completely the enzyme activity (Figure 2A). In the next series
of experiments, we stimulated MMP activity by incubating the cells with
phorbol ester (TPA, 50 ng/mL), a known enhancer of MMP
expression.7 Treatment with TPA increased MMP-9
activity >50%, and fluvastatin was still effective in
inhibiting the enhanced protease activity by almost 50% (Figure 2B).
|
|
Our previous data have shown that fluvastatin may directly
interfere with the major processes of atherogenesis occurring in the
arterial wall20 through the
inhibition of the isoprenoid pathway. Because mevalonate is the
precursor of isoprenic compounds, we postulated that the
inhibitory effect of fluvastatin might be due
to a deprivation of mevalonate caused by the drug. To test
this hypothesis, we incubated the cells with fluvastatin in
the presence of exogenous mevalonate (100 µmol/L). As shown in
Figure 3, the addition of mevalonate
fully overcame the inhibitory effect of the statin, in both
the absence and presence of TPA.
|
To determine whether the inhibitory effect of fluvastatin was due to an interference with the activation process after MMP-9 had been secreted, we incubated MPMs with medium alone. After 24 hours, the conditioned media were collected, divided in aliquots, and added with increasing concentrations of the tested drugs. Media then were incubated for 24 more hours at 37°C, in the absence of cells, and analyzed by gelatin gel zymography. None of the tested compounds showed any appreciable effect on MMP-9 activity (data not shown), thus suggesting that fluvastatin did not interfere with the activation of the protease.
To exclude a possible drug toxicity as the reason of its
inhibitory effect, MPMs were incubated with
fluvastatin (5 to 100 µmol/L) in the absence or
presence of TPA (50 ng/mL); then, cell viability was assessed using the
dimethylthiazaol-diphenyltetrazolium bromide assay.
Fluvastatin did not cause any appreciable cellular
toxicity, even at the highest concentration used (100 µmol/L).
In another set of experiments, cells were incubated for 24 hours with
medium containing fluvastatin and then for 24 hours with
medium alone. As shown in Table 1,
withdrawal of the drug restored the capacity of cells to secrete normal
amounts of MMP-9. These data further confirm that
fluvastatin is not toxic and that its
inhibitory effect is reversible.
|
To assess whether fluvastatin was effective also in HMs, we
performed a new series of experiments. As shown in Figure 4A, the incubation of HMs with increasing
concentrations of fluvastatin caused a significant and
dose-dependent reduction of MMP-9 activity in the culture medium. At
the lowest concentration used (0.1 µmol/L),
fluvastatin inhibited MMP-9 activity by 20%, and at the
highest (50 µmol/L), by 45% compared with control (Figure 4A).
Fluvastatin inhibitory effect was also
maintained in the presence of phorbol ester. The addition of TPA alone
(50 ng/mL of medium) determined a 2.5-fold increase of MMP-9 activity
(Figure 4B). This enhancement was dose-dependently blocked (25%
to 
60% compared with cells treated with TPA alone) by increasing
amounts of fluvastatin (0.1 to 50 µmol/L; Figure 4B).
|
We also performed a Western blot analysis of the media
collected from HMs incubated with fluvastatin. As shown in
Figure 5, the addition of
fluvastatin, 5 and 50 µmol/L, reduced the amount of
MMP-9 protein released into the incubation media by 25% and 50%,
respectively. The coincubation with exogenous mevalonate blocked the
inhibitory effect of fluvastatin (Figure 5).
|
To confirm the above observation obtained with murine
macrophages that the inhibitory effect of
fluvastatin was not due to an interaction of the drug with
the protease already secreted into the media, we performed a different
experiment. HMs were incubated with fluvastatin (5
µmol/L alone or with 100 µmol/L mevalonate) for 24 hours.
Media were discarded, and cells were incubated for an additional 4
hours with medium alone. At the end of the second incubation, media
were collected and analyzed by zymography.
Fluvastatin still maintained its inhibitory
effect on MMP-9 activity, and mevalonate prevented this effect (Figure 6A). This reduction in
gelatinolytic activity is due to a reduction of the
amount of MMP-9 protein released in the incubation media, as shown by
Western blot analysis (Figure 6B).
|
We also measured the amount of MMP-9 protein secreted by HMs with
ELISA. As shown in Table 2, the addition
of fluvastatin (5 and 50 µmol/L) inhibited the
secretion of MMP-9 protein, whereas the coincubation with mevalonate
prevented the inhibitory effect.
|
To determine whether the inhibitory effect we observed was
specific to fluvastatin, we used a different HMG-CoA
reductase inhibitor simvastatin. Data in Table 3 show that the incubation of mouse
macrophages with increasing concentrations of the latter statin
caused an inhibition in MMP-9 activity similar to that observed with
fluvastatin.
|
Finally, we evaluated by Northern blot analysis whether the
reduced levels of secreted MMP-9 in fluvastatin-treated HMs
could reflect a reduction in MMP-9 gene expression. As shown in Figure 7, Northern blots of HMs treated for 24
hours with 50 µmol/L fluvastatin demonstrated no
reduction in the level of MMP-9 gene expression. Instead, an almost
2-fold increase in mRNA levels for MMP-9 was consistently
observed. In contrast, essentially no change was observed in the levels
of the housekeeping gene G3PDH.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In this study, we have demonstrated that the in vitro incubation of mouse macrophages and HMs with fluvastatin or simvastatin, 2 hypolipidemic and antiatherosclerotic agents, reduced the amount of MMP-9 secreted, suggesting that the effect on MMP-9 activity belongs to the statins as a class of drugs. Cells were treated for 24 hours with increasing concentrations of fluvastatin, and the data clearly show that the inhibition of the HMG-CoA reductase enzyme reduces the amount of protease released into the incubation media. This effect is reversible and appears to be mediated through a starvation of mevalonate and its derivatives, because the coincubation of the cells with fluvastatin and mevalonate completely overcame the inhibitory effect of the drug. The experiments show that fluvastatin reduced MMP-9 activity in gelatin zymography and that the effect of the drug was also maintained when MMP-9 production was induced by the coincubation with TPA, a known inducer of MMP gene transcription. TPA induced a 1.5- to 2.5-fold increase in MMP-9 activity in mouse macrophages and HMs, respectively. In these conditions, fluvastatin inhibited MMP-9 activity up to 60% compared with the value obtained in cells incubated with TPA alone.
The inhibitory effect of fluvastatin on MMP-9 activity detected by zymography could be the consequence of direct interference of the drug with the activation process of the MMPs after this has been secreted. Our data exclude this hypothesis, because the drug did not have any effect on the activity of MMP-9 already secreted into the growth media. In addition, as evaluated by Western blot analysis and ELISA, fluvastatin reduced the amount of MMP-9 protein released by the cells, suggesting a direct effect on the secretion process.
The reduced levels of MMP-9 detected in the media by ELISA, Western blot analysis, and zymography could also be the result of a fluvastatin-mediated decrease in MMP-9 gene expression. Our data clearly indicate that this is not the case, because mRNA levels actually rose in treated cells. This would suggest a complex mechanism of action of the drug affecting posttranscriptional processes for MMP-9. A more detailed examination of these processes, beyond the scope of this article, will be required to fully understand the mechanism(s) involved.
In addition to TGF-ß, corticosteroids, and heparin, several synthetic inhibitors of MMPs have been investigated: viz, tetracyclines, antracyclines, and synthetic peptides. The therapeutic efficacy of all of these molecules, however, is doubtful.7 Inhibition of MMP activity has demonstrated a direct effect in reducing tumor cells invasion and angiogenesis.30 31 32 The MMP inhibitor GM 6001 was shown to block SMC migration.33 The synthetic MMP inhibitor BB94 (Batimastat) inhibits gelatinases A and B with IC50 values of 4 and 10 nmol/L, respectively,34 and is able to reduce intimal thickening after arterial injury by decreasing both SMC migration and proliferation.35 These data support the conclusion that MMPs play a significant role in regulating intimal thickening in injured arteries and therefore in atherogenesis.
Fluvastatin and simvastatin are inhibitors of the HMG-CoA reductase enzyme, a key step in the cholesterol biosynthetic pathway, which synthesizes mevalonate, the precursor of isoprenoids, a class of compounds involved in several cellular processes. The treatment with the inhibitors causes mevalonate starvation inside the cells. This seems to cause the inhibition of MMP-9 secretion, because the coincubation with mevalonate completely overcame the reduction of MMP-9 secretion. Prenylation is a type of stable lipid modification involving covalent addition of either farnesyl or geranylgeranyl isoprenoids to conserved cysteine residues at or near the C-terminus of proteins.36 Known prenylated proteins include fungal mating factors, nuclear lamins, Ras and Ras-related GTP-binding proteins, protein kinases, and at least 1 viral protein.36 Prenylation promotes membrane interactions of most of these proteins and plays a major role in several protein-protein interactions and in signal transduction.36 Prenylated proteins of the Rab subgroup, small Ras-like GTPases in mammalian cells, have an important role in regulating membrane traffic and exocytic and endocytic transport processes.37 An inhibition of Rab prenylation causes a block in protein secretion,38 and the Rab3A is deeply involved in regulated secretion in neuronal cells.36 Therefore, it is conceivable that the inhibition of isoprenoids formation by statins could lead to a reduced MMP-9 secretion by macrophages, by inhibiting factor(s) essential for the secretion process.
Extrapolation of our in vitro results to the in vivo condition is difficult, of course. The final net level of proteinase activity depends on several factors, such as the relative concentrations of active enzymes and specific inhibitors (ie, TIMPs), and further studies are required to assess the in vivo relevance of our observation. Nevertheless, several clinical studies demonstrated the ability of statins to reduce the incidence of coronary heart disease,39 40 most probably by increasing the stability of the atherosclerotic plaque rather than by reducing the stenotic occlusion.2 This effect may involve, in addition to cholesterol reduction, a direct effect of these drugs on the arterial wall. We previously suggested that statins may reduce modified LDL endocytosis and cholesterol accumulation in macrophages.24 The inhibitory effect of statins on MMP-9 secretion observed in the present study suggests an additional potential mechanism for the stabilizing effect of these drugs on atherosclerotic plaque.41
|
Acknowledgments |
|---|
This study was supported in part by the National Council for Research (C.N.R.) and by MURST (to R.F.; Italian Government). We thank Laura Mozzarelli for expert preparation of the manuscript.
Received August 8, 1997; accepted April 17, 1998.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (Lond). 1993;362:801–809.[Medline] [Order article via Infotrieve]
2.
Falk E, Shah PK, Fuster V. Coronary plaque
disruption. Circulation. 1995;92:657–671.
3.
Davies MJ, Richardson PD, Woolf N, Katz DR, Mann J.
Risk of thrombosis in human atherosclerotic plaques: role of
extracellular lipid, macrophage, and smooth muscle cell
content. Br Heart J. 1993;69:377–381.
4. Fernandez-Ortiz A, Badimon J, Falk E, Fuster V, Meyer B, Mailhac A, Weng D, Shah PK, Badimon L. Characterization of the relative thrombogenicity of atherosclerotic plaque components: implications for consequences of plaque rupture. Am J Coll Cardiol. 1994;23:1562–1569.[Abstract]
5. Burleigh MC, Briggs AD, Lendon CL, Davies MJ, Born GV, Richardson PD. Collagen types I and II, collagen content, GAGs and mechanical strength of human atherosclerotic plaque caps: snap-wise variations. Atherosclerosis. 1992;96:71–81.[Medline] [Order article via Infotrieve]
6. Wight TN. The extracellular matrix and atherosclerosis. Curr Opin Lipidol. 1995;6:326–334.[Medline] [Order article via Infotrieve]
7.
Dollery CM, McEwan JR, Henney AM. Matrix
metalloproteinases and cardiovascular disease.
Circ Res. 1995;77:863–868.
8.
Brown DL, Hibbs MS, Kearney M, Loushin C, Isner JM.
Identification of 92-kDa gelatinase in human coronary
atherosclerotic lesions: association of active enzyme synthesis with
unstable angina. Circulation. 1995;91:2125–2131.
9.
Newman KM, Ogata Y, Malon AM, Irizzary E, Gandhi RH,
Nagase H, Tilson MD. Identification of matrix metalloproteinases 3
(stromelysin-1) and 9 (gelatinase B) in abdominal aneurysm.
Arterioscler Thromb. 1994;14:1315–1320.
10. James TW, Wagner R, White LA, Zwolak RM, Brinkerhoff CE. Induction of collagenase and stromelysin gene expression by mechanical injury in vascular smooth muscle-derived cell line. J Cell Physiol. 1993;157:426–437.[Medline] [Order article via Infotrieve]
11.
Bendeck MP, Zempo N, Clowes AW, Galardy RE, Reidy MA.
Smooth muscle cell migration and matrix metalloproteinase expression
after arterial injury in the rat. Circ Res. 1994;75:539–545.
12.
Clowes AW, Clowes MM, Au YPT, Reidy MA, Belin D. Smooth
muscle cells express urokinase during mitogenesis and tissue-type
plasminogen activator during migration in
injured rat carotid artery. Circ Res. 1990;67:61–67.
13. More R, Underwood M, Brack MJ, de Bono D, Gershlick AK. Changes in vessel wall plasminogen activator activity and smooth muscle cell proliferation and activation after arterial injury. Cardiovasc Res. 1995;29:22–26.[Medline] [Order article via Infotrieve]
14. Southgate KM, Banning AP, Groves PH, Cheadle H, Newby AC. Upregulation of basement membrane-degrading metalloproteinases by balloon angioplasty in pigs. Br Heart J. 1994;71(suppl 5):65. Abstract.
15.
Birkedal-Hansen H, Moore W, Bodden MK, Windsor LJ,
Birkedal-Hansen B, DeCarlo A, Engler JA. Matrix metalloproteinases: a
review. Crit Rev Oral Biol Med. 1993;4:197–250.
16. Matrisian LM. Metalloproteinases and their inhibitors in matrix remodeling. Trends Genet. 1990;6:121–125.[Medline] [Order article via Infotrieve]
17.
Sperti G, van Leeuwen RTJ, Quax PHA, Maseri A, Kluft C.
Cultured rat aortic vascular smooth muscle cells digest naturally
produced extracellular matrix: involvement of
plasminogen-dependent and
plasminogen-independent pathways. Circ Res. 1992;71:385–392.
18. Nagase H, Enghild JJ, Suzuki K, Salvesen G. Stepwise activation mechanisms of the precursor of matrix metalloproteinase 3 (stromelysin) by proteinases and (4-aminophenyl) mercuric acetate. Biochemistry. 1990;29:5783–5789.[Medline] [Order article via Infotrieve]
19.
Galis ZS, Sukhova GK, Kranzhofer R, Clark S, Libby P.
Macrophage foam cells from experimental atheroma
constitutive produce matrix-degrading proteinases. Proc Natl Acad
Sci U S A. 1995;92:402–406.
20. Corsini A, Raiteri M, Soma MR, Bernini F, Fumagalli R, Paoletti R. Pathogenesis of atherosclerosis and the role of 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors. Am J Cardiol. 1995;76:21A–28A.[Medline] [Order article via Infotrieve]
21. Corsini A, Mazzotti M, Raiteri M, Soma MR, Gabbiani G, Fumagalli R, Paoletti R. Relationship between mevalonate pathway and arterial myocyte proliferation: in vitro studies with inhibitors of HMG-CoA reductase. Atherosclerosis. 1993;101:117–125.[Medline] [Order article via Infotrieve]
22.
Soma MR, Donetti E, Parolini C, Mazzini G, Ferrari C,
Fumagalli R, Paoletti R. HMG-CoA reductase inhibitors: in
vivo effects on carotid intimal thickening in
normocholesterolemic rabbits. Arterioscler
Thromb. 1993;13:571–578.
23. Bernini F, Didoni G, Bonfadini G, Bellosta S, Fumagalli R. Requirement for mevalonate in acetylated LDL induction of cholesterol esterification in macrophages. Atherosclerosis. 1993;104:19–26.[Medline] [Order article via Infotrieve]
24.
Bernini F, Scurati N, Bonfadini G, Fumagalli R. HMG-CoA
reductase inhibitors reduce acetyl LDL endocytosis in mouse
peritoneal macrophages. Arterioscler Thromb Vasc
Biol. 1995;15:1352–1358.
25. Sinensky M, Lutz RJ. The prenylation of proteins. Bioessays. 1992;14:25–31.[Medline] [Order article via Infotrieve]
26.
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein
measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275.
27. Marks J, Mason MA, Nagelschmidt G. A study of dust toxicity using a quantitative tissue culture technique. Br J Ind Med. 1956;13:187–191.[Medline] [Order article via Infotrieve]
28. Kleiner DE, Stetler-Stevenson WG. Quantitative zymography: detection of picogram quantities of gelatinases. Anal Biochem. 1994;218:325–329.[Medline] [Order article via Infotrieve]
29. Ramos-DeSimone N, Moll UM, Quigley JP, French DL. Inhibition of matrix metalloproteinase 9 activation by a specific monoclonal antibody. Hybridoma. 1993;12:349–363.[Medline] [Order article via Infotrieve]
30. Brown PD, Bloxidge RE, Anderson E, Howell A. Expression of activated gelatinase in human invasive breast carcinoma. Clin Exp Metastasis. 1993;11:183–189.[Medline] [Order article via Infotrieve]
31.
Albini A, Melchiori A, Santi L, Liotta LA, Brown PD,
Stetler-Stevenson WG. Tumor cell invasion inhibited by TIMP-2.
J Natl Cancer Inst. 1991;83:775–779.
32. Schnaper HW, Grant DS, Stetler-Stevenson WG, Fridman R, D'Orazi G, Murphy AN, Bird RE, Hoythya M, Fuerst TR, French DL, Quigley JP, Kleinman HK. Plasminogen activators augment endothelial cell organization in vitro by two distinct pathways. J Cell Physiol. 1993;156:235–246.[Medline] [Order article via Infotrieve]
33.
Bendeck MP, Irvin C, Reidy MA. Inhibition of matrix
metalloproteinase activity inhibits smooth muscle cell migration but
not neointimal thickening after arterial
injury. Circ Res. 1996;78:38–43.
34.
Botos I, Scapozza L, Zhang D, Liotta LA, Meyer EF.
Batimastat, a potent matrix metalloproteinase inhibitor,
exhibits an unexpected mode of binding. Proc Natl Acad Sci
U S A. 1996;93:2749–2754.
35.
Zempo N, Koyama N, Kenagy RD, Lea HJ, Clowes AW.
Regulation of vascular smooth muscle cell migration and proliferation
in vitro and injured rat arteries by a synthetic matrix
metalloproteinase inhibitor. Arterioscler Thromb Vasc
Biol. 1996;16:28–33.
36. Zhang FL, Casey PJ. Protein prenylation: molecular mechanisms and functional consequences. Ann Rev Biochem. 1996;65:241–269.[Medline] [Order article via Infotrieve]
37. Zerial M, Stenmark H. Rab GTPases in vesicular transport. Curr Opin Cell Biol. 1993;6:613–620.
38.
Seabra MC, Brown MS, Goldstein JL. Retinal degeneration
in choroideremia: deficiency of rab geranylgeranyl transferase.
Science. 1993;259:377–381.
39. 4S Investigators. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet. 1994;344:1383–1389.[Medline] [Order article via Infotrieve]
40.
Shepherd J, Cobbe SM, Ford I, Isles CG, Lorimer AR,
MacFarlane PW, McKillop JH, Packard CJ. Prevention of coronary
heart disease with pravastatin in men with
hypercholesterolemia. N Engl J
Med. 1995;333:1301–1307.
41. Vaugham CJ, Murphy MB, Buckley BM. Statins do more than just lower cholesterol. Lancet. 1996;348:1079–1082.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  Y. Zhang, J. C. Naggar, C. M. Welzig, D. Beasley, K. S. Moulton, H.-J. Park, and J. B. Galper Simvastatin Inhibits Angiotensin II-Induced Abdominal Aortic Aneurysm Formation in Apolipoprotein E-Knockout Mice: Possible Role of ERK Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1764 - 1771. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Shyamsundar, S. T. W. McKeown, C. M. O'Kane, T. R. Craig, V. Brown, D. R. Thickett, M. A. Matthay, C. C. Taggart, J. T. Backman, J. S. Elborn, et al. Simvastatin Decreases Lipopolysaccharide-induced Pulmonary Inflammation in Healthy Volunteers Am. J. Respir. Crit. Care Med., June 15, 2009; 179(12): 1107 - 1114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Dol-Gleizes, R. Paumelle, V. Visentin, A.-M. Mares, P. Desitter, N. Hennuyer, A. Gilde, B. Staels, P. Schaeffer, and F. Bono Rimonabant, a Selective Cannabinoid CB1 Receptor Antagonist, Inhibits Atherosclerosis in LDL Receptor-Deficient Mice Arterioscler Thromb Vasc Biol, January 1, 2009; 29(1): 12 - 18. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Fujimoto, D. Hartung, S. Ohshima, D. S. Edwards, J. Zhou, P. Yalamanchili, M. Azure, A. Fujimoto, S. Isobe, Y. Matsumoto, et al. Molecular Imaging of Matrix Metalloproteinase in Atherosclerotic Lesions: Resolution With Dietary Modification and Statin Therapy J. Am. Coll. Cardiol., December 2, 2008; 52(23): 1847 - 1857. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Newby Metalloproteinase Expression in Monocytes and Macrophages and its Relationship to Atherosclerotic Plaque Instability Arterioscler Thromb Vasc Biol, December 1, 2008; 28(12): 2108 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. J. Zoghbi, T. A. Dorfman, and A. E. Iskandrian The Effects of Medications on Myocardial Perfusion J. Am. Coll. Cardiol., August 5, 2008; 52(6): 401 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rodriguez-Yanez, J. Agulla, R. Rodriguez-Gonzalez, T. Sobrino, and J. Castillo Review: Statins and stroke Therapeutic Advances in Cardiovascular Disease, June 1, 2008; 2(3): 157 - 166. [Abstract] [PDF]
|
|
|
|
 |
|
 K. I. Paraskevas, C. D. Liapis, G. Hamilton, and D. P. Mikhailidis Are Statins an Option in the Management of Abdominal Aortic Aneurysms? Vascular and Endovascular Surgery, May 1, 2008; 42(2): 128 - 134. [Abstract] [PDF]
|
|
|
|
 |
|
 S. Takahashi, H. Nakamura, M. Seki, Y. Shiraishi, M. Yamamoto, M. Furuuchi, T. Nakajima, S. Tsujimura, T. Shirahata, M. Nakamura, et al. Reversal of elastase-induced pulmonary emphysema and promotion of alveolar epithelial cell proliferation by simvastatin in mice Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L882 - L890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nusca, R. Melfi, and G. Di Sciascio Review: Percutaneous coronary interventions and statins therapy Therapeutic Advances in Cardiovascular Disease, April 1, 2008; 2(2): 101 - 107. [Abstract] [PDF]
|
|
|
|
 |
|
 T. Aoki, H. Kataoka, R. Ishibashi, K. Nozaki, and N. Hashimoto Simvastatin Suppresses the Progression of Experimentally Induced Cerebral Aneurysms in Rats Stroke, April 1, 2008; 39(4): 1276 - 1285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. White, S. J. Duffy, A. S. Walton, J. F. Ng, G. E. Rice, S. Mukherjee, J. A. Shaw, G. L. Jennings, A. M. Dart, and B. A. Kingwell Matrix metalloproteinase-3 and coronary remodelling: Implications for unstable coronary disease Cardiovasc Res, September 1, 2007; 75(4): 813 - 820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ferri, G. Colombo, C. Ferrandi, E. W. Raines, B. Levkau, and A. Corsini Simvastatin Reduces MMP1 Expression in Human Smooth Muscle Cells Cultured on Polymerized Collagen by Inhibiting Rac1 Activation Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 1043 - 1049. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Gianella, E. Nobili, M. Abbate, C. Zoja, P. Gelosa, L. Mussoni, S. Bellosta, M. Canavesi, D. Rottoli, U. Guerrini, et al. Rosuvastatin Treatment Prevents Progressive Kidney Inflammation and Fibrosis in Stroke-Prone Rats Am. J. Pathol., April 1, 2007; 170(4): 1165 - 1177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Armani, E. Catalani, A. Balbarini, P. Bagnoli, and D. Cervia Expression, pharmacology, and functional role of somatostatin receptor subtypes 1 and 2 in human macrophages J. Leukoc. Biol., March 1, 2007; 81(3): 845 - 855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hanefeld, N. Marx, A. Pfutzner, W. Baurecht, G. Lubben, E. Karagiannis, U. Stier, and T. Forst Anti-Inflammatory Effects of Pioglitazone and/or Simvastatin in High Cardiovascular Risk Patients With Elevated High Sensitivity C-Reactive Protein: The PIOSTAT Study J. Am. Coll. Cardiol., January 23, 2007; 49(3): 290 - 297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Daub, H. Langer, P. Seizer, K. Stellos, A. E. May, P. Goyal, B. Bigalke, T. Schonberger, T. Geisler, D. Siegel-Axel, et al. Platelets induce differentiation of human CD34+ progenitor cells into foam cells and endothelial cells FASEB J, December 1, 2006; 20(14): 2559 - 2561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Choudhary, C. L. Higgins, I. Y. Chen, M. Reardon, G. Lawrie, G. W. Vick III, C. Karmonik, D. P. Via, and J. D. Morrisett Quantitation and Localization of Matrix Metalloproteinases and Their Inhibitors in Human Carotid Endarterectomy Tissues Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2351 - 2358. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. W. Rice and A. B. Lumsden Optimal Medical Management of Peripheral Arterial Disease Vascular and Endovascular Surgery, August 1, 2006; 40(4): 312 - 327. [Abstract] [PDF]
|
|
|
|
 |
|
 E Hothersall, C McSharry, and N C Thomson Potential therapeutic role for statins in respiratory disease. Thorax, August 1, 2006; 61(8): 729 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Nilsson, L. Jonasson, J. Nijm, A. Hamsten, and P. Eriksson Increased Plasma Concentration of Matrix Metalloproteinase-7 in Patients with Coronary Artery Disease Clin. Chem., August 1, 2006; 52(8): 1522 - 1527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. van der Harst, A. A. Voors, W. H. van Gilst, M. Bohm, and D. J. van Veldhuisen Statins in the treatment of chronic heart failure: Biological and clinical considerations Cardiovasc Res, August 1, 2006; 71(3): 443 - 454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. T. Jones, I. P. Kay, J.W. S. Chu, G.T. Wilkins, L.V. Phillips, M. McCormick, A.M. van Rij, and M.J.A. Williams Elevated Plasma Active Matrix Metalloproteinase-9 Level Is Associated With Coronary Artery In-Stent Restenosis Arterioscler Thromb Vasc Biol, July 1, 2006; 26(7): e121 - e125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Morimoto, W. J. Janssen, M. B. Fessler, K. A. McPhillips, V. M. Borges, R. P. Bowler, Y.-Q. Xiao, J. A. Kench, P. M. Henson, and R. W. Vandivier Lovastatin enhances clearance of apoptotic cells (efferocytosis) with implications for chronic obstructive pulmonary disease. J. Immunol., June 15, 2006; 176(12): 7657 - 7665. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Paumelle, C. Blanquart, O. Briand, O. Barbier, C. Duhem, G. Woerly, F. Percevault, J.-C. Fruchart, D. Dombrowicz, C. Glineur, et al. Acute Antiinflammatory Properties of Statins Involve Peroxisome Proliferator-Activated Receptor-{alpha} via Inhibition of the Protein Kinase C Signaling Pathway Circ. Res., February 17, 2006; 98(3): 361 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ichihara, A. Noda, K. Nagata, K. Obata, J. Xu, G. Ichihara, S. Oikawa, S. Kawanishi, Y. Yamada, and M. Yokota Pravastatin increases survival and suppresses an increase in myocardial matrix metalloproteinase activity in a rat model of heart failure Cardiovasc Res, February 15, 2006; 69(3): 726 - 735. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Pavlovic, B. Du, K. Sakamoto, K. M. F. Khan, C. Natarajan, R. M. Breyer, A. J. Dannenberg, and D. J. Falcone Targeting Prostaglandin E2 Receptors as an Alternative Strategy to Block Cyclooxygenase-2-dependent Extracellular Matrix-induced Matrix Metalloproteinase-9 Expression by Macrophages J. Biol. Chem., February 10, 2006; 281(6): 3321 - 3328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Gegg, R. Harry, D. Hankey, H. Zambarakji, G. Pryce, D. Baker, P. Adamson, V. Calder, and J. Greenwood Suppression of Autoimmune Retinal Disease by Lovastatin Does Not Require Th2 Cytokine Induction J. Immunol., February 15, 2005; 174(4): 2327 - 2335. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cordle and G. Landreth 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase Inhibitors Attenuate {beta}-Amyloid-Induced Microglial Inflammatory Responses J. Neurosci., January 12, 2005; 25(2): 299 - 307. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Newby Dual Role of Matrix Metalloproteinases (Matrixins) in Intimal Thickening and Atherosclerotic Plaque Rupture Physiol Rev, January 1, 2005; 85(1): 1 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Teissier, A. Nohara, G. Chinetti, R. Paumelle, B. Cariou, J.-C. Fruchart, R. P. Brandes, A. Shah, and B. Staels Peroxisome Proliferator-Activated Receptor {alpha} Induces NADPH Oxidase Activity in Macrophages, Leading to the Generation of LDL with PPAR-{alpha} Activation Properties Circ. Res., December 10, 2004; 95(12): 1174 - 1182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Van Doornum, G McColl, and I P Wicks Atorvastatin reduces arterial stiffness in patients with rheumatoid arthritis Ann Rheum Dis, December 1, 2004; 63(12): 1571 - 1575. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Li, S.-P. Zhao, D.-q. Peng, Z.-m. Xu, and H.-n. Zhou Early Effect of Pravastatin on Serum Soluble CD40L, Matrix Metalloproteinase-9, and C-Reactive Protein in Patients with Acute Myocardial Infarction Clin. Chem., September 1, 2004; 50(9): 1696 - 1699. [Full Text] [PDF]
|
|
|
|
|
|
P E Lazzerini, P L Capecchi, F Nerucci, A Fioravanti, F Chellini, M Piccini, S Bisogno, R Marcolongo, and F Laghi Pasini Simvastatin reduces MMP-3 level in interleukin 1{beta} stimulated human chondrocyte culture Ann Rheum Dis, July 1, 2004; 63(7): 867 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Davignon Beneficial Cardiovascular Pleiotropic Effects of Statins Circulation, June 15, 2004; 109(23_suppl_1): III-39 - III-43. [Abstract] [Full Text]
|
|
|
|
 |
|
 B. C. Kieseier, J. J. Archelos, and H.-P. Hartung Different Effects of Simvastatin and Interferon Beta on the Proteolytic Activity of Matrix Metalloproteinases Arch Neurol, June 1, 2004; 61(6): 929 - 932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Schonbeck and P. Libby Inflammation, Immunity, and HMG-CoA Reductase Inhibitors: Statins as Antiinflammatory Agents? Circulation, June 1, 2004; 109(21_suppl_1): II-18 - II-26. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Xu, S. Zhao, H. Zhou, H. Ye, and J. Li Atorvastatin Lowers Plasma Matrix Metalloproteinase-9 in Patients with Acute Coronary Syndrome Clin. Chem., April 1, 2004; 50(4): 750 - 753. [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Werba, E. Tremoli, P. Massironi, M. Camera, A. Cannata, F. Alamanni, P. Biglioli, and A. Parolari Statins in coronary bypass surgery: rationale and clinical use Ann. Thorac. Surg., December 1, 2003; 76(6): 2132 - 2140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. B Jones, D. C Sane, and D. M Herrington Matrix metalloproteinases: A review of their structure and role in acute coronary syndrome Cardiovasc Res, October 1, 2003; 59(4): 812 - 823. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Luan, A. J. Chase, and A. C. Newby Statins Inhibit Secretion of Metalloproteinases-1, -2, -3, and -9 From Vascular Smooth Muscle Cells and Macrophages Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 769 - 775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Milenkovic, M. Weick, P. Wiedemann, A. Reichenbach, and A. Bringmann P2Y Receptor-Mediated Stimulation of Muller Glial Cell DNA Synthesis: Dependence on EGF and PDGF Receptor Transactivation Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1211 - 1220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.O Bonetti, L.O Lerman, C Napoli, and A Lerman Statin effects beyond lipid lowering--are they clinically relevant? Eur. Heart J., February 1, 2003; 24(3): 225 - 248. [Full Text] [PDF]
|
|
|
|
|
|
M. Gervais, S. Pons, A. Nicoletti, C. Cosson, J.-F. Giudicelli, and C. Richer Fluvastatin Prevents Renal Dysfunction and Vascular NO Deficit in Apolipoprotein E-Deficient Mice Arterioscler Thromb Vasc Biol, February 1, 2003; 23(2): 183 - 189. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Pearlman Medical treatment ofaortic stenosis: Promising, or wishful thinking? J. Am. Coll. Cardiol., November 20, 2002; 40(10): 1731 - 1734. [Full Text] [PDF]
|
|
|
|
|
|
W. Palinski and C. Napoli Unraveling Pleiotropic Effects of Statins on Plaque Rupture Arterioscler Thromb Vasc Biol, November 1, 2002; 22(11): 1745 - 1750. [Full Text] [PDF]
|
|
|
|
 |
|
 C. Kluft, R. Kleemann, and M.P.M. de Maat How best to counteract the enemies? By controlling inflammation in the coronary circulation Eur. Heart J. Suppl., November 1, 2002; 4(suppl_G): G53 - G65. [Abstract] [PDF]
|
|
|
|
 |
|
 O. Neuhaus, S. Strasser-Fuchs, F. Fazekas, B.C. Kieseier, G. Niederwieser, H.P. Hartung, and J.J. Archelos Statins as immunomodulators: Comparison with interferon-{beta}1b in MS Neurology, October 8, 2002; 59(7): 990 - 997. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Sposito and M. J. Chapman Statin Therapy in Acute Coronary Syndromes: Mechanistic Insight Into Clinical Benefit Arterioscler Thromb Vasc Biol, October 1, 2002; 22(10): 1524 - 1534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. Koh, J. W. Son, J. Y. Ahn, D. K. Jin, H. S. Kim, Y. M. Choi, D. S. Kim, E.-M. Jeong, G. S. Park, I. S. Choi, et al. Comparative Effects of Diet and Statin on NO Bioactivity and Matrix Metalloproteinases in Hypercholesterolemic Patients With Coronary Artery Disease Arterioscler Thromb Vasc Biol, September 1, 2002; 22(9): e19 - 23. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. K. Sukhova, J. K. Williams, and P. Libby Statins Reduce Inflammation in Atheroma of Nonhuman Primates Independent of Effects on Serum Cholesterol Arterioscler Thromb Vasc Biol, September 1, 2002; 22(9): 1452 - 1458. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Chan, G. F. Watts, P. H. R. Barrett, L. J. Beilin, and T. A. Mori Effect of Atorvastatin and Fish Oil on Plasma High-Sensitivity C-Reactive Protein Concentrations in Individuals with Visceral Obesity Clin. Chem., June 1, 2002; 48(6): 877 - 883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Loftus and M. Thompson The role of matrix metalloproteinases in vascular disease Vascular Medicine, May 1, 2002; 7(2): 117 - 133. [Abstract] [PDF]
|
|
|
|
|
|
P. Libby, P. M. Ridker, and A. Maseri Inflammation and Atherosclerosis Circulation, March 5, 2002; 105(9): 1135 - 1143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. S. Galis and J. J. Khatri Matrix Metalloproteinases in Vascular Remodeling and Atherogenesis: The Good, the Bad, and the Ugly Circ. Res., February 22, 2002; 90(3): 251 - 262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Albert, E. Danielson, N. Rifai, P. M Ridker, and for the PRINCE Investigators Effect of Statin Therapy on C-Reactive Protein Levels: The Pravastatin Inflammation/CRP Evaluation (PRINCE): A Randomized Trial and Cohort Study JAMA, July 4, 2001; 286(1): 64 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Wong, W. C. Lumma, A. M. Smith, J. T. Sisko, S. D. Wright, and T.-Q. Cai Statins suppress THP-1 cell migration and secretion of matrix metalloproteinase 9 by inhibiting geranylgeranylation J. Leukoc. Biol., June 1, 2001; 69(6): 959 - 962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Aikawa and P. Libby Vascular inflammation and activation: new targets for lipid lowering Eur. Heart J. Suppl., May 1, 2001; 3(suppl_B): B3 - B11. [Abstract] [PDF]
|
|
|
|
 |
|
 S. Bellosta, M. Canavesi, E. Favari, L. Cominacini, G. Gaviraghi, R. Fumagalli, R. Paoletti, and F. Bernini Lalsoacidipine Modulates the Secretion of Matrix Metalloproteinase-9 by Human Macrophages J. Pharmacol. Exp. Ther., March 1, 2001; 296(3): 736 - 743. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Fukumoto, P. Libby, E. Rabkin, C. C. Hill, M. Enomoto, Y. Hirouchi, M. Shiomi, and M. Aikawa Statins Alter Smooth Muscle Cell Accumulation and Collagen Content in Established Atheroma of Watanabe Heritable Hyperlipidemic Rabbits Circulation, February 20, 2001; 103(7): 993 - 999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D M Braganza and M R Bennett New insights into atherosclerotic plaque rupture Postgrad. Med. J., February 1, 2001; 77(904): 94 - 98. [Full Text]
|
|
|
|
|
|
M. Aikawa, E. Rabkin, S. Sugiyama, S. J. Voglic, Y. Fukumoto, Y. Furukawa, M. Shiomi, F. J. Schoen, and P. Libby An HMG-CoA Reductase Inhibitor, Cerivastatin, Suppresses Growth of Macrophages Expressing Matrix Metalloproteinases and Tissue Factor In Vivo and In Vitro Circulation, January 16, 2001; 103(2): 276 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Ikeda, M. Shimpo, R. Ohki, H. Inaba, M. Takahashi, K. Yamamoto, and K. Shimada Fluvastatin Inhibits Matrix Metalloproteinase-1 Expression in Human Vascular Endothelial Cells Hypertension, September 1, 2000; 36(3): 325 - 329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. Koh Effects of statins on vascular wall: vasomotor function, inflammation, and plaque stability Cardiovasc Res, September 1, 2000; 47(4): 648 - 657. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Hess, A. M. Demchuk, L. M. Brass, and F. M. Yatsu HMG-CoA reductase inhibitors (statins): A promising approach to stroke prevention Neurology, February 22, 2000; 54(4): 790 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Corsini Reviews: Fluvastatin: Effects Beyond Cholesterol Lowering Journal of Cardiovascular Pharmacology and Therapeutics, January 1, 2000; 5(3): 161 - 175. [Abstract] [PDF]
|
|
|
|
|
|
W. Marz, R. Siekmeier, H.-M. Muller, H. Wieland, W. Gross, and H.-G. Olbrich Effects of Lovastatin and Pravastatin on the Survival of Hamsters With Inherited Cardiomyopathy Journal of Cardiovascular Pharmacology and Therapeutics, January 1, 2000; 5(4): 275 - 279. [Abstract] [PDF]
|
|
|
|
|
|
A. Faggiotto and R. Paoletti Statins and Blockers of the Renin-Angiotensin System : Vascular Protection Beyond Their Primary Mode of Action Hypertension, October 1, 1999; 34(4): 987 - 996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Ridker, N. Rifai, M. A. Pfeffer, F. Sacks, and E. Braunwald Long-Term Effects of Pravastatin on Plasma Concentration of C-reactive Protein Circulation, July 20, 1999; 100(3): 230 - 235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. W. Chan, D. L. Bhatt, D. P. Chew, M. J. Quinn, D. J. Moliterno, E. J. Topol, and S. G. Ellis Early and Sustained Survival Benefit Associated With Statin Therapy at the Time of Percutaneous Coronary Intervention Circulation, February 12, 2002; 105(6): 691 - 696. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||