Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:20-26

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eriksson, P.
Right arrow Articles by Hamsten, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eriksson, P.
Right arrow Articles by Hamsten, A.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1998;18:20-26.)
© 1998 American Heart Association, Inc.


Original Contributions

Very-Low-Density Lipoprotein Response Element in the Promoter Region of the Human Plasminogen Activator Inhibitor-1 Gene Implicated in the Impaired Fibrinolysis of Hypertriglyceridemia

Per Eriksson; Lennart Nilsson; Fredrik Karpe; ; Anders Hamsten

From the Atherosclerosis Research Unit, King Gustaf V Research Institute, Department of Medicine, Karolinska Institute, Karolinska Hospital, S-171 76 Stockholm, Sweden.

Correspondence to Per Eriksson, King Gustaf V Research Institute, Karolinska Hospital, S-171 76 Stockholm, Sweden. E-mail perikson{at}instmed.ks.se


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Hypertriglyceridemia and impaired fibrinolytic function are linked to coronary heart disease and other atherothrombotic disorders. Triglyceride-rich lipoproteins may attenuate fibrinolysis by increasing the plasma levels of plasminogen activator inhibitor-1 (PAI-1). Furthermore, a common 4/5 guanosine (4G/5G) polymorphism in the promoter region of the PAI-1 gene has been indicated to influence plasma PAI-1 activity and to be involved in an allele-specific response to triglycerides. Herein we show by transfection assays that VLDLs induce transcription of the human PAI-1 promoter in endothelial cells. A VLDL response element (VLDLRE) is located to residues -672 to -657 in the promoter region by electromobility shift assay, methylation interference, and DNase I footprinting, and its activity is shown to be influenced by the common 4G/5G polymorphism located adjacent to and upstream of the binding site of a VLDL-inducible transcription factor. These findings may provide a molecular explanation to the link between VLDL and PAI-1 activity elevation in plasma and to the interaction between the 4G/5G polymorphism and plasma triglycerides.


Key Words: PAI-1 • VLDL • promoter • genotype • triglycerides


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Increased plasma PAI-1 activity is a common finding in patients with CHD, particularly in young postinfarction patients with hypertriglyceridemia,1 and is associated with recurrence of cardiovascular events.2 3 4 5 The prognostic role of PAI-1 in CHD is related principally to insulin resistance.5 Since PAI-1 is a rapid inhibitor of tissue-type plasminogen activator, the major proteolytic activator of plasminogen, high plasma PAI-1 activity is thought to be linked to increased risk of coronary thrombosis. Elevated PAI-1 expression has also been demonstrated in atherosclerotic plaques,6 7 suggesting that PAI-1 may play a role in atherogenesis as well. Several common polymorphisms have been discovered in the PAI-1 locus,8 9 10 11 some of which have been reported to be associated with plasma PAI-1 activity. In particular, the 4G allele of the 4G/5G polymorphism in the promoter region has been linked to higher PAI-1 levels in healthy individuals,12 13 in patients with previous myocardial infarction10 13 or suspected CHD,14 and in patients with NIDDM.15 16 The prevalence of the 4G allele was also found to be significantly higher in patients with myocardial infarction before the age of 45 than in population-based control subjects (allele frequencies of .63 versus .53),12 and the 4G allele has recently been linked to an increased risk of coronary artery disease also in middle-aged subjects.14 However, the association between the 4G/5G polymorphism and plasma PAI-1 activity has not been observed uniformly.11 13 Furthermore, no association between 4G/5G genotype and myocardial infarction was found in the ECTIM study, examining postinfarction patients recruited from different geographical and cultural areas.13

Both environmental and genetic factors contribute to determining plasma PAI-1 activity. A striking feature of PAI-1 is its positive association with the VLDL triglyceride concentration.17 There is also some indication that the potential triglyceride regulation of PAI-1 is mainly confined to individuals with a certain PAI-1 genotype. Subjects who are homozygous for the HindIII noncutting allele (genotype 1/1) of the 3' flanking region of the PAI-1 gene have higher plasma PAI-1 activity in the presence of a raised VLDL triglyceride concentration than individuals who are homozygous for the cutting allele (genotype 2/2), with the heterozygotes lying in between.8 This finding suggests that the HindIII polymorphism could be in linkage disequilibrium with a base change at a site of functional importance in the regulation of PAI-1 by VLDL. Furthermore, the 4G/5G polymorphic region in the PAI-1 promoter has been implicated in an allele-specific response to triglycerides in studies of patients with NIDDM, in whom the triglyceride level and its interaction with the 4G/5G genotype appeared to be strong determinants of plasma PAI-1 activity.15 16 A genotype-specific association between triglyceride level and PAI-1 antigen concentration was found also in patients undergoing coronary angiography because of chest pain.14 However, such gene/environment interaction was not encountered in healthy individuals or postinfarction patients in the ECTIM study13 or in healthy participants of the PRIME study.11

Endothelial cell synthesis and secretion of PAI-1 is indicated to contribute to the regulation of plasma PAI-1 activity.18 Furthermore, VLDL induces secretion of PAI-1 from cultured HUVECs.19 20 In the present study, we have characterized an element in the PAI-1 promoter that mediates VLDL induction of PAI-1 in endothelial cells.

The promoter element is located downstream of and adjacent to the 4G/5G polymorphic site. A VLDL-inducible transcription factor shows competitive binding, with the transcription factors binding to the 4G/5G polymorphic site. Competition between the 5G allele–specific transcriptional repressor protein and the VLDL-inducible factor could explain the 4G/5G allele–specific relation between VLDL triglyceride and PAI-1 activity levels in plasma.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
DNA Constructs
For EMSA and footprinting analysis, double-stranded oligonucleotides were designed. The oligonucleotides used in EMSA are shown in Figs 2ADown and 5Down. In the methylation interference assay and the DNase I footprinting, a double-stranded oligonucleotide of the -676/-641 segment of the human PAI-1 promoter with flanking cytosine residues (CGGGGAGTCAGCCGTGTATCATCGGAGGCGGCCGGGC) was constructed. The probes were end labeled with [{gamma}-32P]ATP at either end using T4 polynucleotide kinase.21 The 2x5G-HCAT and the 2x4G-HCAT vectors, containing the 4G/5G polymorphic site coupled to a minimal and heterologous promoter, were constructed as described earlier.12



View larger version (84K):
[in this window]
[in a new window]
 
Figure 2. Binding of VLDL-induced factor to the human PAI-1 promoter. A, Human PAI-1 sequence from -717 to -607. Boxes delineate the four different probes: -717/-684, -689/-665, -672/-637, and -642/-607. B, EMSA of HUVEC nuclear extract induced by VLDL for 16 hours and bound to the -672/-637 probe. The arrow denotes VLDL-induced factor. Lane 1, no lipoprotein; lane 2, 5 µg VLDL; lane 3, 10 µg VLDL; lane 4, 20 µg VLDL; lane 5, 40 µg VLDL; lane 6, 80 µg VLDL; and lane 7, 160 µg VLDL per milliliter. The figure shows a representative EMSA from five different experiments. C, EMSA on nuclear extract derived from HUVECs bound to the -672/-637 probe. Lane 1, no extract; lane 2, HUVEC extract stimulated by 80 µg VLDL per milliliter with no competitor; lane 3, 200-fold excess of -717/-684; lane 4, -672/-637; lane 5, -642/-607; and lane 6, -689/-665 as competitors. F indicates free DNA.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. DNA constructs used in the EMSAs presented in Figs 6Up and 7Up. Boxes indicate the binding sites of the common transcriptional activator (factor A), the 5G allele–specific transcriptional repressor (factor B), and the VLDL-induced factor binding to the VLDLRE. Mutated bases are underlined and indicated with bold letters.

The 5G-PAI–pCAT and the 4G-PAI–pCAT comprise the human PAI-1 sequences -805/-804 to +17. Polymerase chain reaction primers with flanking Pst I and Xba I sites were used (upstream primer: AACTGCAGGCTTTTACCATGGTAACCCC; downstream primer: GCTCTAGAGCCAAACACAGCTGTGCTC). The polymerase chain reaction products from amplifying the PAI-1 promoter from genomic DNA of individuals who were homozygous for either the 4G or 5G allele were inserted into the Pst I and Xba I sites of the pCAT-Basic vector (Promega). The correct sequence of the inserts was tested by DNA sequencing. The truncated promoter constructs -708-PAI–pCAT and -609-PAI–pCAT were constructed from the 4G-PAI–pCAT as described above with the upstream polymerase chain reaction primers AACTGCAGCAGACGGACTCCCAGAGC (-708) and AACTGCAGCCTGAATGCTCTTACACACG (-609), respectively. The 4G-DEL-PAI–pCAT plasmid was constructed using the Altered Sites II in vitro mutagenesis system (Promega). A 9-bp deletion was introduced just downstream of the 4G/5G polymorphic site of the 4G-PAI–pCAT construct (see Fig 4ADown) by using a mutagenic oligonucleotide (ACAGAGAGAGTCTGGACACGTGGGGAGTATCATCGGAGGCGGCCGGGCACATGG).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Elimination of VLDL responsiveness by 9-bp deletion of the VLDLRE. A, DNA construct of the 4G-deletion (DEL)–PAI–pCAT. The 4G polymorphic site is shown in bold. B, Results from transfections in endothelial cells based on four experiments. After transfection, cells were incubated for 24 hours with 0.075 mg VLDL per milliliter culture medium. *P<.05 in a paired t test.

VLDL Preparation and Cell Culture
VLDL for incubation with HUVECs was prepared by density-gradient ultracentrifugation.22 The endotoxin content in the VLDL preparations was tested by using a Limulus amebocyte lysate assay (COATEST Endotoxin, Endosafe Inc). Endotoxin levels were shown to be <0.1 ng/mg protein. HUVECs were cultured as described earlier.19

Transfection Assay
HUVECs were transfected using a calcium phosphate–precipitation method as described by Descheemaeker et al.23 pRSV-ß-Galactosidase (Promega) or luciferase control vector (Promega) was cotransfected as an internal control.

EMSA
Nuclear extracts were prepared according to Alksnis et al.24 All buffers were freshly supplemented with 0.7 µg/mL leupeptin, 16.7 µg/mL aprotinin, 0.5 mmol/L PMSF, and 5 mmol/L 2-mercaptoethanol. The protein concentration in the extracts was estimated by the method of Kalb and Bernlohr.25 Incubation for EMSA was conducted as described.10 12

Methylation Interference and DNase I Footprinting
Methylation interference was conducted essentially as described previously.21 The methylated DNA fragments were analyzed on an 11% (wt/vol) denaturing polyacrylamide/bisacrylamide (19:1) gel. DNase I footprinting was conducted using the same DNA fragment, labeled at either end. Partial DNase I digestion was performed as described earlier,26 except that the reaction was terminated with 0.02 mol/L Na2EDTA and directly put on ice. The different protein:DNA complexes were directly separated by EMSA as described above. Retarded DNA fragments were electroblotted onto a Schleicher & Schuell diethylaminoethyl membrane and analyzed on an 11% (wt/vol) denaturing polyacrylamide/bisacrylamide (19:1) gel.

Statistical Methods
Differences in continuous variables between two groups were tested by paired or unpaired t tests.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
VLDL-Induced PAI-1 Expression and the 4G/5G Polymorphic Site
Because VLDL induction of PAI-1 in endothelial cells may at least in part be mediated by transcriptional activation, transfection studies were performed in HUVECs to further examine potential 4G/5G allele–specific mechanisms by which VLDL could enhance PAI-1 expression. Fragments (804 bp) of the PAI-1 promoter that contained either the 4G or 5G allele were coupled to a CAT gene and transiently transfected into HUVECs (Fig 1ADown). As shown in Fig 1BDown and 1CDown, VLDL induced transcription of the PAI-1 promoter in HUVECs. Maximum induction was obtained at 0.075 mg VLDL per milliliter culture medium (data not shown). There was a tendency to an allele-specific response to VLDL. The promoter fragment containing the 4G allele showed a slightly higher promoter activity in response to VLDL than did the promoter fragment containing the 5G allele (3.8±1.0-fold induction, mean±SD, n=4, versus 2.3±0.9-fold induction, mean±SD, n=6; P=.06 in an unpaired t test).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. VLDL-induced transcription from the PAI-1 promoter in endothelial cells. A, DNA constructs of the 4G-PAI–pCAT and the 5G-PAI–pCAT. B, VLDL induction of the PAI-1 promoter in endothelial cells, with a tendency to an allele-specific response to VLDL. Bars represent mean (SD). Results are based on four experiments with the 4G-PAI–pCAT and six experiments with the 5G-PAI–pCAT constructs. After transfection, cells were incubated for 24 hours with 0.075 mg VLDL per milliliter culture medium. C, Example of autoradiograph of thin-layer chromatography analysis of CAT assay using 1-deoxychloramphenicol (Amersham) as a substrate. D, Results from transfections using truncation of the human PAI-1 promoter in HUVECs when induced by VLDL. P<.05 denotes the result of a paired t test comparing the induction of -804-PAI–pCAT and -609-PAI–pCAT. n.s. indicates not significant.

We have recently demonstrated in HUVECs that both the 4G and 5G alleles bind a transcriptional activator (factor A), whereas the 5G allele also binds a repressor protein (factor B) to an overlapping binding site.12 The 4G/5G allele–specific differences in the relations between the VLDL triglyceride and PAI-1 activity levels in plasma thus suggest that the transcription factors binding to this polymorphic region could be involved in an activation of the PAI-1 promoter mediated by VLDL. We therefore performed an EMSA on the 4G/5G polymorphic region, using VLDL-induced nuclear extracts from HUVECs. However, we could detect neither any increased binding of the common factor to this region nor of the 5G allele–specific factor (data not shown). Furthermore, a transfection assay using two tandem copies of a 30-bp DNA segment containing either the 4G or 5G allele sequence inserted upstream of a minimal and heterologous promoter driving the CAT gene12 did not respond to VLDL when transiently transfected into HUVECs (data not shown). These results taken together allow the conclusion that the two proteins (factors A and B) showing sequence-specific binding to the 4G and 5G sequences are not directly involved in an activation of the PAI-1 promoter mediated by VLDL.

The fact that the VLDL induction of PAI-1 in HUVECs is mediated by transcriptional activation and seems to be influenced by the 4G/5G site may suggest that a region of the PAI-1 promoter adjacent to the 4G/5G site is involved.

Localization of the VLDLRE in the PAI-1 Promoter
To localize the VLDLRE within the PAI-1 promoter, we next constructed several truncations of the promoter region coupled to a CAT gene and transfected the new constructs into HUVECs. Successive 100-bp segments were deleted from the initial promoter construct, which contained the 804 bp located upstream of the start of transcription. The results obtained from induction of transiently transfected cells with 0.075 mg/mL VLDL are shown in Fig 1DUp. The VLDL response was lost in the construct containing 609 bp of the promoter region. This finding indicates that the VLDL response region is located within the 609 to 708 bp upstream of the transcription start site in the PAI-1 promoter. We therefore evaluated potential binding regions for any VLDL-induced transcription factor(s) that could mediate transcriptional activation. For this purpose, three overlapping EMSA probes, in addition to the 4G/5G probe, were constructed that covered the -717 to -607 region (Fig 2AUp). HUVECs were induced with 0.075 mg/mL VLDL for 1 to 24 hours, and nuclear extracts were prepared. Neither the -717/-684, -689/-665 (4G/5G), nor -642/-607 probe bound any VLDL-inducible factor (data not shown). However, the probe covering the -672 to -637 region of the promoter showed increased binding of one factor (Fig 2BUp). The specificity of the binding was analyzed by including nonlabeled EMSA probes in excess as competitors. Fig 2CUp shows that the VLDL-induced factor exhibits sequence-specific binding, as the band induced by VLDL was not decreased when either the -717/-684 probe (lane 3) or the -642/-607 probe (lane 5) was added as competitor, whereas the VLDL-induced band diminished when using the same probe (-672/-637) as competitor (lane 4). Interestingly, the VLDL-induced factor was competed by both the 4G and 5G (-689/-665) probes (lane 6). This observation indicates that the VLDL-induced factor is bound within the region covering the -672 to -637 residues of the PAI-1 promoter adjacent to the binding site of the 5G allele–specific factor (-679/-673).12

Identification of the Binding Site of the VLDL-Inducible Transcription Factor
Footprinting studies using nuclear extract derived from VLDL-induced HUVECs were performed to map the specific binding site of the VLDL-inducible factor. Methylation interference (Fig 3ADown) and DNase I footprinting (Fig 3BDown) showed that the VLDL-induced factor is bound to the residues -672 to -657 of the PAI-1 promoter (Fig 3CDown). To further study the involvement of this promoter element in the VLDL induction of the PAI-1 promoter, a 9-bp deletion (residues -662 to -670) of the VLDLRE was introduced into the 804-bp 4G–PAI-1 promoter construct (Fig 4AUp). This deletion eliminated the VLDL induction of promoter activity (Fig 4BUp). The wild-type 804-bp 4G–PAI-1 promoter construct was significantly induced by VLDL (2.0±0.6-fold induction, mean±SD, n=4, P<.05 in a paired t test). In contrast, the mutated promoter showed no significant response to VLDL (1.3±0.5-fold induction, mean±SD, n=4, P=.31 in a paired t test).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 3. Binding of VLDL-induced factor near the 4G/5G polymorphic site. Representative autoradiograms of two different experiments are shown. A, Methylation interference of the VLDL-induced factor. Numbers denote the position of interfering guanosine residues in relation to the start of transcription. B, DNase I footprinting of the VLDL-induced factor. Numbers denote the position of the protected region in relation to the start of transcription. F represents free methylated DNA and B, bound VLDL-induced factor. Maxam-Gilbert sequencing served as a size marker. C, Summary of the footprinting data. Solid lines refer to the DNase I footprinting pattern. *Interfering guanine residues.

VLDL-Inducible Factor Shows Competitive Binding With the Transcription Factors Binding to the 4G/5G Polymorphic Site
Since the VLDL-inducible factor was found to bind to the region adjacent to and partly overlapping the 4G/5G polymorphic site, competition between the 5G allele–specific transcriptional repressor protein12 and the VLDL-induced factor could explain the 4G/5G allele–specific relations between VLDL triglyceride and PAI-1 activity levels in plasma. To resolve this issue, several binding sites were constructed for use in an EMSA (Fig 5Up). Base pair substitutions were designed on the basis of the results of footprinting and methylation interference assays (Reference 1212 and Fig 3Up). Fig 6ADown shows an EMSA demonstrating the differential binding of the 4G/5G polymorphic site as previously described,12 using the 4G or 5G alleles as probe. The EMSA shows that both alleles bound a common factor (factor A), while the 5G allele bound an additional factor (factor B). Additional complexes have earlier been shown to have nonspecific interactions.12 Previous work has demonstrated that the common factor, factor A, acts as a transcriptional activator, whereas the 5G allele–specific factor, factor B, acts as a transcriptional repressor.12 As demonstrated in Fig 6ADown, binding of factor B to the 5G allele results in a decreased binding of factor A compared with the 4G probe. To further study the interaction between factors B and A, two mutated EMSA probes were designed, containing mutations that impair the binding of factor A and factor B, respectively (Fig 5Up). As shown in Fig 6BDown, competition of factor B resulted in an increased binding of factor A. Similarly, competition of factor A (Fig 6CDown) resulted in increased binding of factor B. Thus, the binding of the 5G allele–specific factor impaired the binding of the common transcriptional activator (factor A).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 6. Interference by the 5G allele–specific repressor with binding of the common transcriptional activator binding to both alleles. Representative autoradiograms of five different experiments are shown. A, EMSA of HUVEC nuclear extract bound to the 4G and 5G alleles. B, EMSA of HUVEC nuclear extract bound to the 5G-allele with the B site or nonspecific DNA as competitors. C. EMSA of HUVEC nuclear extract bound to the 5G-allele with the A site or nonspecific DNA as competitors.

To study whether the 5G allele–specific repressor also influenced the binding of the VLDL-induced factor, EMSA probes were constructed that included the binding sites for both of these factors (Fig 5Up). As demonstrated in Fig 7ADown, factor A and the VLDL-induced factor bound to the 4G+VLDLRE construct, whereas the 5G+VLDLRE construct also bound factor B. Densitometric scanning showed a 30% decrease in binding of the VLDL-induced factor to the 5G+VLDLRE probe compared with the 4G+VLDLRE. Furthermore, an interaction between factor B and the VLDL-induced factor was demonstrated by using a probe containing the B site and the VLDLRE but with a mutated binding site for factor A. As shown in Fig 7BDown, addition of VLDLRE as competitor decreased the binding of the VLDL-induced factor and increased the binding of factor B. Taken together, these studies show that the 5G allele–specific repressor can compete for binding to the PAI-1 promoter with both the common transcriptional activator (factor A) and the VLDL-induced factor.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 7. Interference by the 5G allele–specific repressor with the binding of VLDL-induced factor. Representative autoradiograms of five different experiments are shown. A, EMSA of HUVEC nuclear extract bound to the 4G+VLDLRE and 5G+VLDLRE probes. The left lane shows the 4G+VLDLRE probe in the absence of nuclear extract. B, EMSA of HUVEC nuclear extract bound to the B+VLDLRE probe with increasing amounts of the VLDLRE as competitor.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Increased PAI-1 expression in endothelial cells induced by VLDL may predispose to both arterial thrombosis and atherosclerosis by promoting persistence of fibrin on injured intimal surfaces and incorporation of fibrin into the artery wall. It is notable in this context that impaired fibrinolytic function secondary to elevated plasma PAI-1 activity has been shown to be of particular importance for myocardial infarction in men with hypertriglyceridemia.17 However, the fairly strong positive relation between triglyceride and PAI-1 levels has been a consistent observation not only in young male postinfarction patients but also among healthy normolipidemic subjects, obese individuals, and patients with angina pectoris or NIDDM.27 The evidence that PAI-1 plays a role in CHD now also extends beyond the rare cases of myocardial infarction before the age of 45.3 5 28

The delineation in the present work of a molecular event in endothelial cells that could link hypertriglyceridemia to impaired fibrinolytic function not only reinforces the risk factor status of triglycerides but also may provide a molecular explanation of why lowering of plasma triglycerides reduce the plasma PAI-1 level and thus improve the fibrinolytic capacity, in line with the results obtained in a recent diet intervention study.29 However, it needs to be emphasized that endothelial cells may not be the major source of plasma PAI-1 in hypertriglyceridemic individuals. It also remains to be established that VLDL actually increases endogenous PAI-1 gene transcription in the intact cell in the arterial endothelium.

The 4G/5G polymorphism in the PAI-1 promoter region was recently shown to be implicated in an allele-specific response to plasma triglycerides in patients with suspected CHD14 or NIDDM.15 16 The present work disentangles the underlying molecular mechanisms. The VLDL-induced factor was found to bind to the region adjacent to and partly overlapping the binding site of the 5G allele. Competition between the 5G allele–specific transcriptional repressor protein12 (factor B) and the VLDL-induced factor could explain the 4G/5G allele–specific relations between VLDL triglyceride and PAI-1 activity levels in plasma. In addition, competitive binding between the 5G allele–specific repressor and the common transcriptional activator could explain the differences in basal transcriptional activity.

Analysis of the VLDLRE showed that there is some homology with a peroxisome proliferator activator response element. The footprint included the sequence TCAGCC G TGTATC, which is similar to the peroxisome proliferator activator response element consensus sequence A/T C/G A C/A C T A/T T G/T N C C C/T.30 The members of the PPAR family are ligand-dependent transcription factors that bind their cognate ligand with high affinity and specificity and then activate gene transcription through binding to a specific hormone response element in the promoter region of the target gene. The ligand activating PPAR is unknown. Interestingly, a variety of fatty acids can activate PPAR,30 31 32 33 34 and it has been proposed that fatty acids, or their acyl-CoA derivatives, are the natural ligands of PPAR and that the physiological role of PPAR is to regulate fatty acid homeostasis.31 At this stage, one could speculate that fatty acids derived from VLDL triglycerides may cooperate to regulate the PAI-1 gene. In contrast to VLDL, native LDL has no effect on PAI-1 expression in endothelial cells.35 This observation argues for a nutritional regulation of PAI-1 secretion from endothelial cells by fatty acids, as the major difference between VLDL and LDL is the high triglyceride content of the former. In fact, unsaturated fatty acids have been found to selectively increase PAI-1 mRNA levels in cultured HUVECs,36 a finding that is in accordance with dietary studies showing that polyunsaturated fatty acids increase circulating PAI-1 levels.37 38 39 Differences between populations in plasma PAI-1 levels and in the relationship of the 4G/5G polymorphism to plasma PAI-1 activity might thus be accounted for by differences in dietary habits.

In conclusion, the present work has contributed a molecular explanation to the link between VLDL and PAI-1 activity elevation in plasma and a direct mechanism by which hypertriglyceridemia may increase the risk of CHD and other atherothrombotic disorders.


*    Selected Abbreviations and Acronyms
 
CAT = chloramphenicol acetyltransferase
CHD = coronary heart disease
EMSA = electromobility shift assay
4G/5G = 4/5 guanosine
HUVEC = human umbilical vein endothelial cell
PAI-1 = plasminogen activator inhibitor-1
PPAR = peroxisomal proliferator activator receptor
VLDLRE = VLDL response element


*    Acknowledgments
 
This project was supported by grants from the Swedish Medical Research Council (8691), the Swedish Heart-Lung Foundation, the European Commission (HIFMECH study, contract BMH4-CT96 to 0272), the Marianne and Marcus Wallenberg Foundation, the King Gustaf V 80th Birthday Foundation, and the Professor Nanna Svartz Foundation. We are grateful to Barbro Burt and Kerstin Carlson for excellent technical assistance.

Received May 2, 1997; accepted August 29, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Wiman B, Hamsten A. Impaired fibrinolysis and risk of thromboembolism. Prog Cardiovasc Dis. 1991;34:179–192.[Medline] [Order article via Infotrieve]

2. Hamsten A, de Faire U, Walldius G, Dahlen G, Szamosi A, Landou C, Blombäck M, Wiman B. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet. 1987;2:3–9.[Medline] [Order article via Infotrieve]

3. Cortellaro M, Cofrancesco E, Boschetti C, Mussoni L, Donati MB, Cardillo M, Catalano M, Gabrielli L, Lombardi B, Specchia G, Tavazzi L, Tremoli E, Pozzoli E, Turri M, for the PLAT Group. Increased fibrin turnover and high PAI-1 activity as predictors of ischemic events in atherosclerotic patients. Arterioscler Thromb. 1993;13:1412–1417.[Abstract/Free Full Text]

4. Malmberg K, Båvenholm P, Hamsten A. Clinical and biochemical factors associated with prognosis after myocardial infarction at a young age. J Am Coll Cardiol. 1994;24:592–599.[Abstract]

5. Juhan-Vague I, Pyke SDM, Alessi MC, Jespersen J, Haverkate F, Thompson SG, on behalf of the ECAT Study Group. Fibrinolytic factors and the risk of myocardial infarction on sudden death in patients with angina pectoris. Circulation. 1996;94:2057–2063.[Abstract/Free Full Text]

6. Schneiderman J, Sawdey MS, Keeton MR, Bordin GM, Bernstein EF, Dilley RB, Loskutoff DJ. Increased type 1 plasminogen activator inhibitor gene expression in atherosclerotic human arteries. Proc Natl Acad Sci U S A. 1992;89:6998–7002.[Abstract/Free Full Text]

7. Lupu F, Bergonzelli GE, Heim DA, Cousin E, Genton CY, Bachmann F, Kruithof EK. Localization and production of plasminogen activator inhibitor-1 in human healthy and atherosclerotic arteries. Arterioscler Thromb. 1993;13:1090–1100.[Abstract/Free Full Text]

8. Dawson S, Hamsten A, Wiman B, Henney A, Humphries SE. Genetic variation at the plasminogen activator inhibitor-1 locus is associated with altered levels of plasma plasminogen activator inhibitor-1 activity. Arterioscler Thromb. 1991;11:183–190.[Abstract/Free Full Text]

9. Klinger KW, Winqvist R, Riccio A, Andreasen PA, Sartorio R, Nielsen LS, Stuart N, Stanislovitis P, Watkins P, Douglas R, Grzeschik KH, Alitalo K. Plasminogen activator inhibitor type 1 gene is located at region q21.3-q22 of chromosome 7 and genetically linked with cystic fibrosis. Proc Natl Acad Sci U S A. 1991;84:8548–8552.

10. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:10739–10745.[Abstract/Free Full Text]

11. Henry M, Chomiki N, Scarabin PY, Alesi MC, Peiseffi F, Arveiler D, Ferrières J, Evans A, Amoyel P, Poirier O, Cambien F, Juhan-Vague I. Five frequent polymorphisms of the PAI-1 gene: lack of association between genotypes, PAI-1 activity, and triglyceride levels in a healthy population. Arterioscler Thromb Vasc Biol. 1997;17:851–858.[Abstract/Free Full Text]

12. Eriksson P, Kallin B, van't Hooft FM, Båvenholm P, Hamsten A. Allele-specific increase in basal transcription of the plasminogen activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci U S A. 1995;92:1851–1855.[Abstract/Free Full Text]

13. Ye S, Green FR, Scarabin PY, Nicaud V, Bara L, Dawson SJ, Humphries SE, Evans A, Luc G, Cambou JP, Arveiler D, Henney AM, Cambien F. The 4G/5G genetic polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene is associated with differences in plasma PAI-1 activity but not with risk of myocardial infarction in the ECTIM study. Thromb Haemost. 1995;74:837–841.[Medline] [Order article via Infotrieve]

14. Ossei-Gerning N, Mansfield MW, Stickland MH, Wilson IJ, Grant PJ. Plasminogen activator inhibitor-1 promoter 4G/5G genotype and plasma levels in relation to a history of myocardial infarction in patients characterized by coronary angiography. Arterioscler Thromb Vasc Biol. 1997;17:33–37.[Abstract/Free Full Text]

15. Panahloo A, Mohamed-Ali V, Lane A, Green F, Humphries SE, Yudkin JS. Determinants of plasminogen activator inhibitor-1 activity in treated NIDDM and its relation to a polymorphism in the plasminogen activator inhibitor-1 gene. Diabetes. 1995;44:37–42.[Abstract]

16. Mansfield MW, Stickland MH, Grant PJ. Environmental and genetic factors in relation to elevated circulating levels of plasminogen activator inhibitor-1 in Caucasian patients with non–insulin-dependent diabetes mellitus. Thromb Haemost. 1995;74:842–847.[Medline] [Order article via Infotrieve]

17. Hamsten A, Wiman B, de Faire U, Blombäck M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med. 1985;313:1557–1563.[Abstract]

18. Chomiki N, Henry M, Alessi MC, Anfosso F, Juhan-Vague I. Plasminogen activator inhibitor-1 expression in human liver and healthy or atherosclerotic vessel walls. Thromb Haemost. 1994;72:44–53.[Medline] [Order article via Infotrieve]

19. Stiko-Rahm A, Wiman B, Hamsten A, Nilsson J. Secretion of plasminogen activator inhibitor-1 from cultured human umbilical vein endothelial cells is induced by very low density lipoprotein. Arteriosclerosis. 1990;10:1067–1073.[Abstract/Free Full Text]

20. Mussoni L, Mannucci L, Sirtori M, Camera M, Maderna P, Sironi L, Tremoli E. Hypertriglyceridemia and regulation of fibrinolytic activity. Arterioscler Thromb. 1991;12:19–27.[Abstract/Free Full Text]

21. Eriksson P, Wrange Ö. Protein-protein contacts in the glucocorticoid receptor homodimer influence its DNA binding properties. J Biol Chem. 1990;265:3535–3542.[Abstract/Free Full Text]

22. Karpe F, Steiner G, Olivecrona T, Carlson LA, Hamsten A. Metabolism of triglyceride-rich lipoproteins during alimentary lipemia. J Clin Invest. 1993;91:748–759.

23. Descheemaeker KA, Nelles L, Moreau H, Strandberg L, Ny T, Collen D. Transfection of human endothelial cells with plasminogen activator inhibitor type-1 promoter/reporter gene fragments reveals phorbol ester induction of gene expression. Fibrinolysis. 1992;6:256–262.

24. Alksnis M, Barkhem T, Strömstedt PE, Ahola H, Kutoh E, Gustafsson J-Å, Poellinger L, Nilsson S. High level expression of functional full length and truncated glucocorticoid receptor in Chinese hamster ovary cells: demonstration of ligand-induced down-regulation of expressed receptor mRNA and protein. J Biol Chem. 1991;266:10078–10085.[Abstract/Free Full Text]

25. Kalb VF, Bernlohr RW. A new spectrophotometric assay for protein in cell extracts. Anal Biochem. 1977;82:362–371.[Medline] [Order article via Infotrieve]

26. Wrange Ö, Carlstedt-Duke J, Gustafsson J-Å. Stoichiometric analysis of the specific interaction of the glucocorticoid receptor with DNA. J Biol Chem. 1986;261:11770–11778.[Abstract/Free Full Text]

27. Juhan-Vague I, Alessi MC, Vague P. Increased plasma plasminogen activator inhibitor 1 levels: a possible link between insulin resistance and atherothrombosis. Diabetologia. 1991;34:457–462.[Medline] [Order article via Infotrieve]

28. Meade TW, Ruddock V, Stirling Y, Chakrabarti R, Miller GJ. Fibrinolytic activity, clotting factors, and long-term incidence of ischaemic heart disease in the Northwick Park Heart Study. Lancet. 1993;342:1076–1079.[Medline] [Order article via Infotrieve]

29. Mehrabian M, Peter JB, Barnard RJ, Lusis AJ. Dietary regulation of fibrinolytic factors. Atherosclerosis. 1990;84:25–32.[Medline] [Order article via Infotrieve]

30. Rodriguez JC, Gil-Gomez G, Hegardt FG, Haro D. Peroxisome proliferator-activated receptor mediates induction of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene by fatty acids. J Biol Chem. 1994;269:18767–18772.[Abstract/Free Full Text]

31. Green S, Wahli W. Peroxisome proliferator-activated receptors: finding the orphan a home. Mol Cell Endocrinol. 1994;100:149–153.[Medline] [Order article via Infotrieve]

32. Issemann I, Prince RA, Tugwood JD, Green S. The peroxisome proliferator-activated receptor:retinoid X receptor heterodimer is activated by fatty acids and fibrate hypolipidaemic drugs. J Mol Endocrinol. 1993;11:37–47.[Abstract/Free Full Text]

33. Vu-Dac N, Schoonjans K, Kosykh V, Dallongeville J, Fruchart J-C, Staels B, Auwerx J. Fibrates increase human apolipoprotein A-II expression through activation of the peroxisome proliferator-activated receptor. J Clin Invest. 1995;96:741–750.

34. Göttlicher M, Widmark E, Li Q, Gustafsson J-A. Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor. Proc Natl Acad Sci U S A. 1992;89:4653–4657.[Abstract/Free Full Text]

35. Latron Y, Chautan M, Anfosso F, Alessi MC, Nalbone G, Lafont H, Juhan-Vague I. Stimulating effect of oxidized low density lipoproteins on plasminogen activator inhibitor-1 synthesis by endothelial cells. Arterioscler Thromb. 1991;11:1821–1829.[Abstract/Free Full Text]

36. Karikó K, Rosenbaum H, Kua A, Zurier RB, Barnathan ES. Stimulatory effect of unsaturated fatty acids on the level of plasminogen activator inhibitor-1 mRNA in cultured human endothelial cells. FEBS Lett. 1995;361:118–122.[Medline] [Order article via Infotrieve]

37. Schmidt EB, Varming K, Ernst E, Madsen P, Dyerberg J. Dose-response studies on the effect of n-3 polyunsaturated fatty acids on lipids and haemostasis. Thromb Haemost. 1990;63:1–5.[Medline] [Order article via Infotrieve]

38. Moller JM, Svaneborg N, Lervang HH, Varming K, Madsen P, Dyerberg J, Schmidt EB. The acute effect of a single very high dose of n-3 fatty acids on coagulation and fibrinolysis. Thromb Res. 1992;67:569–577.[Medline] [Order article via Infotrieve]

39. Boberg M, Pollare T, Siegbahn A, Vessby B. Supplementation with n-3 fatty acids reduces triglycerides but increases PAI-1 in non–insulin- dependent diabetes mellitus. Eur J Clin Invest. 1992;22:645–650.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. M.K. Williams, A. M. Carter, B. Kato, M. Falchi, L. Bathum, G. Surdulescu, K. O. Kyvik, A. Palotie, T. D. Spector, P. J. Grant, et al.
Identification of Quantitative Trait Loci for Fibrin Clot Phenotypes: The EuroCLOT Study
Arterioscler. Thromb. Vasc. Biol., April 1, 2009; 29(4): 600 - 605.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Mutoh, N. Niho, M. Komiya, M. Takahashi, R. Ohtsubo, K. Nakatogawa, K. Ueda, T. Sugimura, and K. Wakabayashi
Plasminogen activator inhibitor-1 (Pai-1) blockers suppress intestinal polyp formation in Min mice
Carcinogenesis, April 1, 2008; 29(4): 824 - 829.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. P. Corsetti, D. Ryan, A. J. Moss, D. L. Rainwater, W. Zareba, and C. E. Sparks
Plasminogen Activator Inhibitor-1 Polymorphism (4G/5G) Predicts Recurrence in Nonhyperlipidemic Postinfarction Patients
Arterioscler. Thromb. Vasc. Biol., March 1, 2008; 28(3): 548 - 554.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
P.-G. Wiklund, L. Nilsson, S. N. Ardnor, P. Eriksson, L. Johansson, B. Stegmayr, A. Hamsten, D. Holmberg, and K. Asplund
Plasminogen Activator Inhibitor-1 4G/5G Polymorphism and Risk of Stroke: Replicated Findings in Two Nested Case-Control Studies Based on Independent Cohorts
Stroke, August 1, 2005; 36(8): 1661 - 1665.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Kudo, E. Nakayama, S. Suzuki, M. Akiyama, and S. Shibata
Cholesterol diet enhances daily rhythm of Pai-1 mRNA in the mouse liver
Am J Physiol Endocrinol Metab, October 1, 2004; 287(4): E644 - E651.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Hou, M. Eren, C. A. Painter, J. W. Covington, J. D. Dixon, J. A. Schoenhard, and D. E. Vaughan
Tumor Necrosis Factor {alpha} Activates the Human Plasminogen Activator Inhibitor-1 Gene through a Distal Nuclear Factor {kappa}B Site
J. Biol. Chem., April 30, 2004; 279(18): 18127 - 18136.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. Voetsch and J. Loscalzo
Genetic Determinants of Arterial Thrombosis
Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 216 - 229.
[Abstract] [Full Text]


Home page
Am. J. Clin. Nutr.Home page
I. Ellingsen, I. Hjermann, M. Abdelnoor, E. M Hjerkinn, and S. Tonstad
Dietary and antismoking advice and ischemic heart disease mortality in men with normal or high fasting triacylglycerol concentrations: a 23-y follow-up study
Am. J. Clinical Nutrition, November 1, 2003; 78(5): 935 - 940.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. E. Sobel, D. J. Taatjes, and D. J. Schneider
Intramural Plasminogen Activator Inhibitor Type-1 and Coronary Atherosclerosis
Arterioscler. Thromb. Vasc. Biol., November 1, 2003; 23(11): 1979 - 1989.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. E. Vaughan
Plasminogen Activator Inhibitor-1 and the Calculus of Mortality After Myocardial Infarction
Circulation, July 29, 2003; 108(4): 376 - 377.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. S. Freeman, M. W. Mansfield, J. H. Barrett, and P. J. Grant
Genetic Contribution to Circulating Levels of Hemostatic Factors in Healthy Families With Effects of Known Genetic Polymorphisms on Heritability
Arterioscler. Thromb. Vasc. Biol., March 1, 2002; 22(3): 506 - 510.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Ren, H. Lee, L. Hu, L. Lu, and G. X. Shen
Impact of Diabetes-Associated Lipoproteins on Generation of Fibrinolytic Regulators from Vascular Endothelial Cells
J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 286 - 291.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Jormsjo, C. Whatling, D. H. Walter, A. M. Zeiher, A. Hamsten, and P. Eriksson
Allele-Specific Regulation of Matrix Metalloproteinase-7 Promoter Activity Is Associated With Coronary Artery Luminal Dimensions Among Hypercholesterolemic Patients
Arterioscler. Thromb. Vasc. Biol., November 1, 2001; 21(11): 1834 - 1839.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Banfi, P. Eriksson, G. Giandomenico, L. Mussoni, L. Sironi, A. Hamsten, and E. Tremoli
Transcriptional Regulation of Plasminogen Activator Inhibitor Type 1 Gene by Insulin: Insights Into the Signaling Pathway
Diabetes, July 1, 2001; 50(7): 1522 - 1530.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. J. Brown, L. J. Murphey, N. Srikuma, N. Koschachuhanan, G. H. Williams, and D. E. Vaughan
Interactive Effect of PAI-1 4G/5G Genotype and Salt Intake on PAI-1 Antigen
Arterioscler. Thromb. Vasc. Biol., June 1, 2001; 21(6): 1071 - 1077.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Chen, J. J. Billadello, and D. J. Schneider
Identification and Localization of a Fatty Acid Response Region in the Human Plasminogen Activator Inhibitor-1 Gene
Arterioscler. Thromb. Vasc. Biol., December 1, 2000; 20(12): 2696 - 2701.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. von Depka, U. Nowak-Gottl, R. Eisert, C. Dieterich, M. Barthels, I. Scharrer, A. Ganser, and S. Ehrenforth
Increased lipoprotein (a) levels as an independent risk factor for venous thromboembolism
Blood, November 15, 2000; 96(10): 3364 - 3368.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. P. Kohler and P. J. Grant
Plasminogen-Activator Inhibitor Type 1 and Coronary Artery Disease
N. Engl. J. Med., June 15, 2000; 342(24): 1792 - 1801.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E. M. Tabengwa, R. L. Benza, H. E. Grenett, and F. M. Booyse
Hypertriglyceridemic VLDL Downregulates Tissue Plasminogen Activator Gene Transcription Through cis-Repressive Region(s) in the Tissue Plasminogen Activator Promoter in Cultured Human Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., June 1, 2000; 20(6): 1675 - 1681.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Jormsjo, S. Ye, J. Moritz, D. H. Walter, S. Dimmeler, A. M. Zeiher, A. Henney, A. Hamsten, and P. Eriksson
Allele-Specific Regulation of Matrix Metalloproteinase-12 Gene Activity Is Associated With Coronary Artery Luminal Dimensions in Diabetic Patients With Manifest Coronary Artery Disease
Circ. Res., May 12, 2000; 86(9): 998 - 1003.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. A. Lane and P. J. Grant
Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease
Blood, March 1, 2000; 95(5): 1517 - 1532.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
W. Dichtl, A. Stiko, P. Eriksson, I. Goncalves, F. Calara, C. Banfi, M. P. S. Ares, A. Hamsten, and J. Nilsson
Oxidized LDL and Lysophosphatidylcholine Stimulate Plasminogen Activator Inhibitor-1 Expression in Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., December 1, 1999; 19(12): 3025 - 3032.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
B. T. Heijmans, R. G. J. Westendorp, D. L. Knook, C. Kluft, and P. E. Slagboom
Angiotensin I-converting enzyme and plasminogen activator inhibitor-1 gene variants: risk of mortality and fatal cardiovascular disease in an elderly population-based cohort
J. Am. Coll. Cardiol., October 1, 1999; 34(4): 1176 - 1183.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. M Dart and J. P.F Chin-Dusting
Lipids and the endothelium
Cardiovasc Res, August 1, 1999; 43(2): 308 - 322.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. Banfi, L. Mussoni, P. Rise, M. G. Cattaneo, L. Vicentini, F. Battaini, C. Galli, and E. Tremoli
Very Low Density Lipoprotein–Mediated Signal Transduction and Plasminogen Activator Inhibitor Type 1 in Cultured HepG2 Cells
Circ. Res., July 23, 1999; 85(2): 208 - 217.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Nilsson, T. Takemura, P. Eriksson, and A. Hamsten
Effects of Fibrate Compounds on Expression of Plasminogen Activator Inhibitor-1 by Cultured Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., June 1, 1999; 19(6): 1577 - 1581.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. Dichtl, L. Nilsson, I. Goncalves, M. P. S. Ares, C. Banfi, F. Calara, A. Hamsten, P. Eriksson, and J. Nilsson
Very Low-Density Lipoprotein Activates Nuclear Factor-{kappa}B in Endothelial Cells
Circ. Res., May 14, 1999; 84(9): 1085 - 1094.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. Nilsson, M. Gåfvels, L. Musakka, K. Ensler, D. K. Strickland, B. Angelin, A. Hamsten, and P. Eriksson
VLDL activation of plasminogen activator inhibitor-1 (PAI-1) expression: involvement of the VLDL receptor
J. Lipid Res., May 1, 1999; 40(5): 913 - 919.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. A. Allison, L. Nilsson, F. Karpe, A. Hamsten, and P. Eriksson
Effects of Native, Triglyceride-Enriched, and Oxidatively Modified LDL on Plasminogen Activator Inhibitor-1 Expression in Human Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., May 1, 1999; 19(5): 1354 - 1360.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Marx, T. Bourcier, G. K. Sukhova, P. Libby, and J. Plutzky
PPAR{gamma} Activation in Human Endothelial Cells Increases Plasminogen Activator Inhibitor Type-1 Expression : PPAR{gamma} as a Potential Mediator in Vascular Disease
Arterioscler. Thromb. Vasc. Biol., March 1, 1999; 19(3): 546 - 551.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Nilsson, C. Banfi, U. Diczfalusy, E. Tremoli, A. Hamsten, and P. Eriksson
Unsaturated Fatty Acids Increase Plasminogen Activator Inhibitor-1 Expression in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., November 1, 1998; 18(11): 1679 - 1685.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eriksson, P.
Right arrow Articles by Hamsten, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eriksson, P.
Right arrow Articles by Hamsten, A.