Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:1725-1729

This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hughes, S. D.
Right arrow Articles by Rubin, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hughes, S. D.
Right arrow Articles by Rubin, E. M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
*Genetics Home Reference
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:1725-1729.)
© 1997 American Heart Association, Inc.


Articles

HDL Deficiency in Genetically Engineered Mice Requires Elevated LDL to Accelerate Atherogenesis

Steven D. Hughes; Judy Verstuyft; ; Edward M. Rubin

From the Human Genome Center, Life Science Division, Lawrence Berkeley Laboratory, Berkeley, Calif.

Correspondence to Edward M. Rubin, Human Genome Center, Lawrence Berkeley Laboratory, 1 Cyclotron Rd, Berkeley, CA 94720. E-mail emrubin{at}lbl.gov


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract In humans, a low HDL concentration is one of the strongest indicators of increased risk for coronary heart disease. Apolipoprotein A-I (apo A-I) synthetic defects result in extremely low HDL levels and are frequently although not invariably associated with premature atherosclerosis. To investigate atherosclerosis susceptibility associated with HDL deficiency alone and in combination with other risk factors, such as high levels of LDL, we have quantified diet-induced atherogenesis in a series of genetically engineered mice, including mice with low HDL levels due to targeted disruption of both apo A-I alleles (AI KO mice), mice with high LDL levels due to expression of a human apolipoprotein B transgene (Btg mice), and mice with combined high LDL and low HDL levels due to the presence of the human apo B transgene and apo A-I knockout alleles, respectively (AI KO/Btg mice). After exposure to an atherogenic diet, AI KO and control mice had negligible lesions. All mice expressing the apo B transgene developed extensive lesions, but AI KO/Btg mice developed significantly larger lesions than Btg mice: 56, 260±4630 µm2 for AI KO/Btg (n=27) versus 38, 120±3350 µm2 for Btg mice (n=19) (P<.02). Results of this study, consistent with several human epidemiological studies, indicate that HDL deficiency in the mouse does not by itself lead to the development of atherosclerosis but does increase atherosclerosis susceptibility when accompanied by other risk factors, in this case elevated LDL.


Key Words: apolipoprotein A-I • apolipoprotein B • atherosclerosis • genetics • lipoproteins • transgenic mice


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The inverse relationship between HDL levels and coronary artery disease is one of the strongest correlations identified in epidemiological studies of atherosclerosis risk factors,1 2 3 a finding that has long supported the view that this class of lipoproteins has the ability to counteract atherogenic mechanisms. Although low HDL levels are highly associated with risk for CHD, the majority of direct studies investigating the link between HDL and CHD have examined the effect of increasing levels of HDL on atherogenesis in animal models. In several studies, overexpression of a human apo A-I transgene in mice has consistently demonstrated the direct role of elevating apo A-I levels and, consequently, HDL levels in reducing atherosclerosis.4 5 6 7 8 One approach to understanding how low levels of HDL may lead to CHD has focused on analysis of rare cases of individuals completely lacking apo A-I because of a variety of genetic defects.9 These defects are invariably associated with extremely low HDL levels, although not all the affected individuals develop CHD. Clinical studies of complete apo A-I deficiency have been somewhat limited by the small number of kindreds identified with this disorder and the high incidence of confounding abnormalities in lipoprotein metabolism. In one of the largest kindreds reported to date, Ng et al10 documented severe HDL deficiency secondary to complete isolated apo A-I deficiency, accompanied by a high prevalence of premature CHD. Despite the striking association between HDL deficiency and premature CHD in this kindred, it is of interest to note that some affected subjects also had a concomitant mild elevation in LDL cholesterol levels, albeit insufficient to account for the severity of atherosclerosis observed. It therefore remains unclear whether apo A-I deficiency alone is a potent atherogenic factor or if it is simply permissive for development of atherosclerosis due to other factors.

The recent development of AI KO mice that completely lack apo A-I and have low levels of HDL has enabled the effects of HDL deficiency to be examined in the mouse.11 Because HDL is the predominant lipoprotein class in mice, it is not surprising that these mice had total plasma cholesterol levels about one third of normal values. HDLs present in the AI KO mice were abnormal and enriched in apo A-II, apo A-IV, and apo E. Despite the reduction in HDL levels and its altered composition, mice lacking apo A-I were not prone to diet-induced atherosclerosis in the single study examining this issue.12 One possible explanation for the differing consequences of apo A-I deficiency in mice and humans is the relative abundance of LDL and VLDL in humans, whereas in mice, these atherogenic lipoproteins are normally present only at low levels relative to HDL.

To test the hypothesis that HDL deficiency resulting from a lack of apo A-I does not directly cause atherosclerosis but can be permissive for atherogenesis when coupled with other risk factors such as high LDL levels, we examined the effect of apo A-I deficiency on diet-induced atherosclerosis in mice overexpressing a human apo B transgene. Expression of human apo B in mice has previously been shown to result in high levels of LDL as well as marked susceptibility to diet-induced atherosclerosis.13 14 Mice expressing this transgene that were either homozygous for a targeted murine apo A-I allele or for normal murine apo A-I alleles were placed on a high-fat diet and quantitatively evaluated for proximal aortic lesion formation. The results derived are consistent with the hypothesis that the role of apo A-I with regard to atherogenesis is largely to mitigate the effects of proatherogenic factors.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Production of Mice
AI KO mice11 and transgenic human apo B mice15 have been described previously. AI KO mice were originally prepared in the 129 genetic background and were subsequently crossed into the C57BL/6 background for eight generations, then maintained in the homozygous state by continued inbreeding. The apo B transgenic mice were prepared in the inbred FVB genetic background, and hemizygous transgenic animals were bred with apo AI -/- mice to produce mice that were apo AI +/–, apo B transgenic, which were then crossed with apo AI +/- littermates. This breeding produced all mice used in the present study: AI -/-, Btg mice; apo AI +/+, Btg mice; and nontransgenic AI -/- and AI +/+ mice. These mice, although not genetically identical, were genetically similar, containing a mixed genetic background of C57BL/6 and FVB. This was necessitated by the complex breeding schemes required to produce the four groups of mice. Mice were screened for human apo B by immuno-dot blot using a biotinylated human apo B–specific monoclonal antibody (provided by E. Krul, Washington University, St Louis, Mo). The biotinylated antibody was detected with an Extravidin-alkaline phosphatase conjugate (Sigma Chemical Co). The polymerase chain reaction was used to screen mice for the presence of murine apo A-I (mAI.f, 5' GGATATCTCGCACCTTTAGCC 3' and mAI.r, 5' TGGGAATTCTGTTCTCTGTGC 3') and the apo A-I targeted allele ( neo2.F, 5' GCAGCCAATATGGGATCG 3' and neo2.R, 5' ATCAGAGCAGCCGATTGTCT 3').

Diets and Lipid Analysis
Mice were fed Purina mouse chow (No. 5001) until 10 weeks of age, after which the animals were fed an atherogenic diet containing 1.25% cholesterol, 0.5% cholic acid, and 15% fat for an additional 18 weeks.16 A blood sample was collected from the tail vein at 6 weeks after initiation of the atherogenic diet. TC, HDL-C, and triglycerides were determined using commercially available assay kits (Boehringer Mannheim) that were modified for use with a microtiter plate reader.17 HDL-C was determined by selective precipitation of non-HDL lipoproteins by polyethylene glycol.18

Lipoprotein and Apolipoprotein Analysis
Human apo B plasma levels were determined by ELISA with a human apo B–specific antibody (International Immunology). Apo A-I and apo E levels were determined by radial-immunodiffusion assays17 using polyclonal antisera against the respective mouse apo (Biodesign International). Lipoproteins were separated from plasma by ultracentrifugation at a density of 1.21 g/mL with NaBr. The floating fraction was analyzed for lipoprotein particle sizes by nondenaturing gradient gel electrophoresis.19 LDL was examined on 2% to 16% gels and HDL on 4% to 30% gels. Electrophoresed lipoproteins were stained with Coomassie R-250 and analyzed by use of scanning densitometry.

Lesion Development
After 18 weeks of the atherogenic diet, animals were killed and their hearts and aortas collected. Aortic sectioning, lipid staining, and lesion scoring were performed as previously described.4 Briefly, the heart and attached aorta were fixed in 10% phosphate-buffered formalin, and 10-µm-thick sections were prepared, each separated by 10 µm. The first and most proximal section of the aorta was taken where the aorta becomes rounded and the aortic valves become distinct. Sections were stained with oil red O and hematoxylin and counterstained with light green. Lesion area as determined by oil red O staining was measured using a calibrated eyepiece at x100 magnification. The lesion area was determined for five sections per animal.

Statistical Analysis
Statistical difference between means was determined using the Mann-Whitney U test for nonparametric analysis.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Effects of Apo A-I and Apo B Genotypes on Plasma Lipoproteins
To determine the combined effects of the human apo B transgene and the absence of apo A-I on mouse plasma lipoproteins, lipoprotein parameters were measured before and after feeding the atherogenic diet. AI KO/Btg mice had significantly lower HDL-C levels than either the Btg group or the AI KO nontransgenic mice on the high-fat diet (TableDown). HDL-C levels were largely unchanged in AI KO/Btg and AI KO mice in response to the high-fat diet, whereas in Btg mice, HDL-C declined significantly. Compared with control mice (nontransgenic, apo AI +/+ littermates), AI KO mice had twofold to threefold lower HDL-C levels. Sizing of HDL particles in mice containing apo A-I (Btg and control) by gradient gel electrophoresis showed the previously described monodispersed distribution of particles within the HDL size range. In mice lacking apo A-I (AI KO and AI KO/Btg), the HDL fraction comprised fewer particles, widely dispersed in size (data not shown). Apo measurements confirmed the complete absence of apo A-I in AI KO and AI KO/Btg mice and showed that apo E levels were significantly higher in AI KO/Btg mice (17.0±2.2 mg/dL; n=12) than in Btg mice (10.2±1.3 mg/dL; n=9 ).


View this table:
[in this window]
[in a new window]
 
Table 1. Plasma Lipid Analyses of Mice on Chow and High-Fat Diets

TC levels were not significantly different between AI KO/Btg and Btg mice on the chow diet. On the high-fat diet, however, TC levels were significantly higher in AI KO/Btg mice, indicating a greater level of non-HDL-C than in Btg mice. In both groups of mice expressing the apo B transgene, TC levels were threefold to fourfold greater than in AI KO and control mice. Average human apo B concentration in the transgenic mice was 112±14 mg/dL, with no significant difference between Btg and AI KO/Btg groups. Lipoproteins in the VLDL to LDL size range were also examined by gradient gel electrophoresis (data not shown). In both AI KO/Btg and Btg mice, the majority of lipoprotein particles migrated in the LDL size range, with no distinct grouping of particle size unique to either of these groups. In both groups, feeding of a high-fat diet increased both the number and size of particles in the LDL size range. This effect of the high-fat diet was consistently greater in AI KO/Btg mice, confirming that increased non-HDL-C in these mice was due to changes in the LDL fraction. In AI KO and control mice, the non-HDL fraction contained roughly equivalent amounts of VLDL-sized particles, with significantly fewer particles in the LDL size range than in Btg and AI KO/Btg mice.

High-fat–diet feeding has been shown to alter composition of the LDL fraction in Btg mice, resulting in triglyceride depletion and cholesterol enrichment in these lipoproteins.20 Consistent with these observations, plasma triglycerides of both Btg and AI KO/Btg mice fell severalfold after 6 weeks on the high-fat diet, coincident with the increase in non-HDL-C levels (TableUp). This cholesterol enrichment of the LDL fraction was consistently of greater magnitude in female mice of both groups, with the largest change in female AI KO/Btg mice. Other minor differences between male and female mice were observed. Female Btg mice had lower HDL-C levels than males regardless of diet, and in all groups of female mice, TC levels were higher than in males fed the chow diet.

Effects of Apo A-I and Apo B Genotypes on Atherogenesis
Significant differences in fatty streak lesion area in the proximal aorta were noted in the different groups of mice after 18 weeks of the high-fat diet. It was expected that the apo B transgenic mice would show increased diet-induced atherogenesis as a result of high LDL cholesterol levels, as in previous studies.13 14 Both groups of apo B transgenic mice developed advanced disseminated fatty streak lesions, whereas AI KO mice had a minimal number of very small lesions (mean lesion area, 852±590 µm2; n=24), not significantly different from nontransgenic control mice (922±465 µm2; n=5), consistent with earlier studies by Li et al.12 Compared with Btg mice, AI KO/Btg mice developed significantly larger lesions (39, 350±2830 µm2 in AI KO/Btg mice [n=49] versus 27, 970±2270 µm2 in Btg mice [n=32]; P<.03) (Fig 1Down). In both groups of animals, the mean lesion area was larger in female mice than in male mice, whereas in both sex subgroups, the AI KO/Btg mice had significantly larger lesions than Btg mice: females, 56, 260±4630 µm2 in AI KO/Btg mice (n=27) versus 38, 120±3350 µm2 in Btg mice (n=19), P<.02; males, 20, 720±1980 µm2 in AI KO/Btg mice (n=22) versus 13, 290±1370 µm2 in Btg mice (n=13), P<.03. Increased susceptibility to diet-induced atherosclerosis in female mice has been noted in numerous prior studies.13 14 21



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Mean lesion area in AI KO/Btg and Btg mice. Areas of lipid-staining material in the aorta were quantified as described in "Methods." Five sections from a defined segment of the proximal aorta were quantified for each animal. Error bars represent standard error; n is the number of mice in each group. Mean lesion area in AI KO/Btg mice was significantly higher than in Btg mice in all comparisons (P<.03 by nonparametric Mann-Whitney U test). Mean lesion areas in both AI KO and control mice were <500 µm2.

On the atherogenic diet, non–HDL-C concentrations were significantly higher in AI KO/Btg mice than in Btg mice, primarily because of increased LDL. To exclude the possibility that this increase in non–HDL-C may be solely responsible for the increased mean lesion area observed in the AI KO/Btg group, we further evaluated the relationship between apo A-I genotype and lesion size in subgroups of mice within a similar range of non–HDL-C levels. Two groups were selected from AI KO/Btg and Btg mice of each sex for comparison on the basis of the following criteria: subgroups of each genotype/sex group had approximately equal numbers of mice; subgroups used for comparison had similar numbers of mice for each genotype; and mean non–HDL-C levels in compared groups were no more than 10% different (Fig 2Down). Male AI KO/Btg mice and Btg mice showed significant differences in lesion area in both low (220 to 400 mg/dL) and high (400 to 570 mg/dL) non–HDL-C ranges. In the female mice, lesion area data were segmented in a similar fashion, although the breakpoint was lowered in proportion to their non–HDL-C levels. Among female mice with non–HDL-C between 220 and 360 mg/dL, mean lesion area was significantly greater in AI KO/Btg mice, but between the matched groups with higher non–HDL-C (360 to 500 mg/dL), there was not a significant difference in mean lesion area. In both male and female groups, several AI KO/Btg mice had non–HDL-C levels above the upper range, at which level there were no Btg mice for comparison. These mice were not considered in this analysis.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 2. Mean lesion area by genotype in non–HDL-C subgroups. Mice were grouped according to individual non–HDL-C levels, and mean lesion area was determined for AI KO/Btg and Btg mice above and below the nominal non–HDL-C level. This value was chosen on the basis of the following criteria: subgroups of each genotype/sex group had approximately equal numbers of mice; subgroups used for comparison had similar numbers of mice for each genotype; and the means of non–HDL-C levels in compared groups were no more than 10% different. Non–HDL-C levels in seven mice from both male and female AI KO/Btg groups were above the upper range, with no Btg mice for comparison. These mice were not considered in this analysis. The number of animals in each group is indicated below its respective column. *Significant difference between AI KO/Btg and Btg (P<.05 by nonparametric Mann-Whitney U test).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The findings of this study are complementary to several previous studies in which genetically engineered animals with increased atherosclerosis susceptibility were protected through introduction of a human apo A-I transgene. In the mouse, a high level of expression of the human apo A-I transgene has been shown to significantly reduce atherogenesis in both naturally susceptible C57BL/6 inbred mice4 5 and lines of mice genetically engineered to be susceptible to atherosclerosis [ie, apo E knockout,6 7 apo(a) transgene expression8 ]. Similar studies examining the effect of increased murine apo A-I on atherosclerosis have not been reported. In the current study, the observation that AI KO/Btg mice had increased atherosclerosis relative to Btg mice indicates that normal levels of murine apo A-I and HDL do have a significant effect in mitigating the atherogenic effects of human apo B transgene expression. However, one of the surprising findings of the present study was the very modest effect of apo A-I deficiency on atherogenesis in human apoB transgenic mice. Considering the well-documented correlation between low HDL and atherosclerosis in humans, the difference between AI KO/Btg and Btg mice in this study is less than expected. The difference between prevalence of atherogenesis in these two groups of mice may have been minimized by the very severe atherogenic stimulus of a high-cholesterol diet (1.25%) containing cholic acid (0.5%) in combination with the human apoB transgene. In this case, the data may indicate that the direct antiatherogenic effects of HDL in the mouse are limited under such conditions. Alternatively, compensatory mechanisms operating in AI KO mice12 may confer more protection from atherogenesis than expected.

Although the inverse relationship between HDL concentrations and atherosclerosis risk has been recognized for many years, the antiatherogenic properties of HDL have yet to be defined mechanistically. A variety of mechanisms have been proposed to explain the protective effect of HDL, including antioxidant effects and protection of the vessel wall from injury. One hypothesis that has received wide support is based on the central role of HDL in reverse cholesterol transport, a process in which HDL facilitates removal of excess cholesterol by acting as an acceptor of free cholesterol from cell membranes. According to this model, esterified cholesterol may then be eliminated from the circulation by HDL-mediated delivery to acceptor tissues such as the liver, either directly or via transfer to non-HDL particles. A number of studies have demonstrated that cholesterol esters can be transferred from HDL to cell membranes without significant uptake of the HDL particle.22 23 24 AI KO mice have recently been shown to be severely deficient in delivery of cholesterol ester to the adrenal glands through this pathway.25 Consistent with this observation, which demonstrated a critical role for apo A-I–containing HDL in delivery of cholesterol esters to acceptor tissues, the current study shows accelerated atherogenesis in apo B transgenic mice lacking apo A-I, possibly as a direct result of diminished clearance of cholesterol from the vasculature of AI KO/Btg mice relative to Btg mice.

The lack of significant differences observed in lesion formation in AI KO versus controls and the significant differences detected from analysis of large numbers of AI KO/Btg mice versus Btg mice support the conclusion of the present study that HDL deficiency increases atherosclerosis susceptibility in the mouse only in the setting of other risk factors. In both male and female AI KO/Btg mice, the lack of apo A-I was associated with increased non–HDL-C levels. This necessitated stratification of the data according to non–HDL-C levels to determine the effects of the lack of apo A-I without the confounding effect of different LDL levels between the two groups. In the lower range of non–HDL-C, we found that atherosclerosis was more advanced in both female and male AI KO/Btg mice relative to a matched group of Btg mice with similar non–HDL-C levels. In male mice, lesion areas were significantly different even at higher non–HDL-C levels, but in females, there appeared to be a threshold non–HDL-C level beyond which the HDL deficiency brought about by the lack of apo A-I did not cause a significant difference in lesion development. This suggests either a limited capacity of HDL to protect against further increases in the atherogenic stimulus or a point in lesion development at which further growth of the lesion is not accurately quantifiable. These findings that genetic modifiers have a diminished impact on severe atherosclerosis are consistent with a previous study of the effects of human apo A-I transgene expression on atherogenesis in apo E knockout mice.7 In that study, expression of the human apo A-I transgene led to a highly significant reduction in atherogenesis in mice examined at 4 months of age, but in 8-month-old mice, the more prolonged exposure to marked hyperlipidemia dramatically increased lesion areas in both apo A-I transgenic and nontransgenic mice, reducing the difference in lesion areas to minimal significance.

The results of the present study indicate that the lack of apo A-I may result in the breakdown of mechanisms that normally provide protection from the atherogenic effects of LDL. In the absence of high LDL levels, however, apo A-I deficiency does not itself contribute to the development of atherosclerosis. These results are consistent with evidence for a protective role of HDL derived from numerous human epidemiological studies.1 2 3 Together they suggest that individuals having low HDL but lacking other risk factors may not necessarily be at increased risk of atherosclerosis, although low HDL in the presence of other risk factors, such as increased LDL, can markedly enhance the risk of developing CHD.


*    Selected Abbreviations and Acronyms
 
AI KO = apolipoprotein A-I knockout mice
apo = apolipoprotein
CHD = coronary heart disease
HDL-C = HDL cholesterol
TC = total cholesterol


*    Acknowledgments
 
This work was supported by National Institutes of Health grants to E.M.R. (PPG HL-18574) and a grant funded by the National Dairy Promotion and Research Board and administered in cooperation with the National Dairy Council. E.M.R. is an American Heart Association Established Investigator. This research was conducted at the Lawrence Berkeley Laboratory (Department of Energy contract DE-AC0376SF00098), University of California, Berkeley. We thank Shahla Ighani, Phil Cooper, and Laura Glines Holl for technical assistance.

Received September 27, 1996; accepted December 2, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Castelli WP, Garrison RJ, Wilson PWF, Abbott RF, Kalousdian S, Kannel WB. Incidence of coronary heart disease and lipoprotein cholesterol levels: the Framingham study. JAMA. 1986;256:2835-2842.[Abstract/Free Full Text]

2. Gordon DJ, Knoke J, Probstfield JL, Superko R, Tryoler HA. High-density lipoprotein cholesterol and coronary heart disease in hypercholesterolemic men: the Lipid Research Clinics Coronary Primary Prevention Trial. Circulation. 1986;74:1217-1223.[Abstract/Free Full Text]

3. Miller NE. Associations of high-density lipoprotein subclasses with ischemic heart disease and coronary atherosclerosis. Am Heart J. 1987;113:589-597.[Medline] [Order article via Infotrieve]

4. Rubin EM, Krauss RM, Spangler EA, Verstuyft JG, Clift SM. Inhibition of early atherogenesis in transgenic mice by human apolipoprotein AI. Nature. 1991;353:265-267.[Medline] [Order article via Infotrieve]

5. Schultz JR, Verstuyft JG, Gong EL, Nichols AV, Rubin ER. Protein composition determines the anti-atherogenic properties of HDL in transgenic mice. Nature. 1993;365:762-765.[Medline] [Order article via Infotrieve]

6. Paszty C, Maeda N, Verstuyft J, Rubin EM. Apolipoprotein A-I transgene corrects apolipoprotein E deficiency-induced atherosclerosis in mice. J Clin Invest. 1994;94:899-903.

7. Plump AS, Scott CJ, Breslow JL. Human apolipoprotein A-I gene expression increases high-density lipoprotein and suppresses atherosclerosis in the apolipoprotein E-deficient mouse. Proc Natl Acad Sci U S A. 1994;91:9607-9611.[Abstract/Free Full Text]

8. Liu AC, Lawn RM, Verstuyft JG, Rubin EM. Human apolipoprotein A-I prevents atherosclerosis associated with apolipoprotein(a) in transgenic mice. J Lipid Res. 1994;35:2263-2267.[Abstract]

9. Breslow J. Familial disorders of high-density lipoprotein metabolism. In: Scriver C, Beaudet A, Sly W, Valle D, eds. The Metabolic and Molecular Basis of Inherited Disease. New York, NY: McGraw-Hill Publishing Co; 1995:1251-1266.

10. Ng DS, Vezina C, Wolever TS, Kuksis A, Hegele RA, Connelly PW. Apolipoprotein A-I deficiency: biochemical and metabolic characteristics. Arterioscler Thromb Vasc Biol. 1995;15:2157-2164.[Abstract/Free Full Text]

11. Williamson R, Lee D, Hagaman J, Maeda N. Marked reduction of high-density lipoprotein cholesterol in mice genetically modified to lack apolipoprotein A-I. Proc Natl Acad Sci U S A. 1992;89:7134-7138.[Abstract/Free Full Text]

12. Li H, Reddick RL, Maeda N. Lack of apo A-I is not associated with increased susceptibility to atherosclerosis in mice. Arterioscler Thromb. 1993;13:1814-1821.[Abstract/Free Full Text]

13. Callow MJ, Verstuyft J, Tangirala R, Palinski W, Rubin EM. Atherogenesis in transgenic mice with human apolipoprotein(a), apolipoprotein B, and lipoprotein(a). J Clin Invest. 1995;96:1636-1646.

14. Purcell-Huynh DA, Farese RV Jr, Johnson DF, Flynn LM, Pierotti V, Newland DL, Linton MF, Sanan DA, Young SG. Transgenic mice expressing high levels of human apolipoprotein B develop severe atherosclerotic lesions in response to a high-fat diet. J Clin Invest. 1995;95:2246-2257.

15. Callow MJ, Stoltzfus LJ, Lawn RM, Rubin EM. Expression of human apolipoprotein B and assembly of lipoprotein(a) in transgenic mice. Proc Natl Acad Sci U S A. 1994;91:2130-2136.[Abstract/Free Full Text]

16. Nishina PM, Verstuyft J, Paigen B. Synthetic low and high fat diets for the study of atherosclerosis in the mouse. J Lipid Res. 1990;31:859-869.[Abstract]

17. Rubin EM, Ishida BY, Clift SM, Krauss RM. Expression of human apolipoprotein A-I in transgenic mice results in reduced plasma levels of murine apolipoprotein A-I and the appearance of two new high-density lipoprotein size subclasses. Proc Natl Acad Sci U S A. 1991;88:434-438.[Abstract/Free Full Text]

18. Izzo C, Grillo F, Murador E. Improved method for determination of HDL cholesterol. Clin Chem. 1981;27:371-378.[Abstract/Free Full Text]

19. Nichols AV, Krauss RM, Musliner TA. Nondenaturing polyacrylamide gradient gel electrophoresis. In: Segrest JP, Albers JJ, eds. Methods in Enzymology: Plasma Lipoproteins. New York, NY: Academic Press; 1986:417-431.

20. Blanche P, Callow M, Holl L, Rubin E, Krauss R. Similar low density lipoprotein subclasses in fat-fed human-apoB transgenic mice and humans. Circulation. 1995;92(suppl I):I-104. Abstract.

21. Paigen B, Holmes P, Mitchell D, Albee D. Comparison of atherosclerotic lesions and HDL-lipid levels in male, female, and testosterone-treated female mice from strains C57BL/6, BALB/c, and C3H. Atherosclerosis. 1987;64:215-221.[Medline] [Order article via Infotrieve]

22. Glass CK, Pittman RC, Weinstein DB, Steinberg D. Dissociation of tissue uptake of cholesterol ester from that of apolipoprotein A-I of rat plasma high-density lipoprotein: selective delivery of cholesterol to liver, adrenal and gonad. Proc Natl Acad Sci U S A. 1983;80:5435-5439.[Abstract/Free Full Text]

23. Pittman RC, Knecht TP, Rosenbaum MS, Taylor CA Jr. A nonendocytotic mechanism for the selective uptake of high-density lipoprotein associated cholesterol esters. J Biol Chem. 1987;262:2443-2450.[Abstract/Free Full Text]

24. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high-density lipoprotein receptor. Science. 1996;271:518-520.[Abstract]

25. Plump AS, Erickson SK, Weng W, Partin JS, Breslow JL, Williams DL. Apolipoprotein A-I required for cholesteryl ester accumulation in steroidogenic cells and for normal adrenal steroid production. J Clin Invest. 1996;97:2660-2671.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J BiochemHome page
S. Acin, M. A. Navarro, J. M. Arbones-Mainar, N. Guillen, A. J. Sarria, R. Carnicer, J. C. Surra, I. Orman, J. C. Segovia, R. d. l. Torre, et al.
Hydroxytyrosol Administration Enhances Atherosclerotic Lesion Development in Apo E Deficient Mice
J. Biochem., September 1, 2006; 140(3): 383 - 391.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Y. Han, T. Chiba, J. S. Campbell, N. Fausto, M. Chaisson, G. Orasanu, J. Plutzky, and A. Chait
Reciprocal and Coordinate Regulation of Serum Amyloid A Versus Apolipoprotein A-I and Paraoxonase-1 by Inflammation in Murine Hepatocytes
Arterioscler. Thromb. Vasc. Biol., August 1, 2006; 26(8): 1806 - 1813.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. E. Moore, M.-a. Kawashiri, K. Kitajima, A. Secreto, J. S. Millar, D. Pratico, and D. J. Rader
Apolipoprotein A-I Deficiency Results in Markedly Increased Atherosclerosis in Mice Lacking the LDL Receptor
Arterioscler. Thromb. Vasc. Biol., October 1, 2003; 23(10): 1914 - 1920.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Zabalawi, S. Bhat, T. Loughlin, M. J. Thomas, E. Alexander, M. Cline, B. Bullock, M. Willingham, and M. G. Sorci-Thomas
Induction of Fatal Inflammation in LDL Receptor and ApoA-I Double-Knockout Mice Fed Dietary Fat and Cholesterol
Am. J. Pathol., September 1, 2003; 163(3): 1201 - 1213.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. van Haperen, A. van Tol, T. van Gent, L. Scheek, P. Visser, A. van der Kamp, F. Grosveld, and R. de Crom
Increased Risk of Atherosclerosis by Elevated Plasma Levels of Phospholipid Transfer Protein
J. Biol. Chem., December 6, 2002; 277(50): 48938 - 48943.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Furbee Jr., J. K. Sawyer, and J. S. Parks
Lecithin:Cholesterol Acyltransferase Deficiency Increases Atherosclerosis in the Low Density Lipoprotein Receptor and Apolipoprotein E Knockout Mice
J. Biol. Chem., January 25, 2002; 277(5): 3511 - 3519.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. M. Martin-Campos, J. Julve, J. C. Escola, J. Ordonez-Llanos, J. Gomez, J. Binimelis, F. Gonzalez-Sastre, and F. Blanco-Vaca
ApoA-IMALLORCA impairs LCAT activation and induces dominant familial hypoalphalipoproteinemia
J. Lipid Res., January 1, 2002; 43(1): 115 - 123.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. K. Shah, S. Kaul, J. Nilsson, and B. Cercek
Exploiting the Vascular Protective Effects of High-Density Lipoprotein and Its Apolipoproteins: An Idea Whose Time for Testing Is Coming, Part I
Circulation, November 6, 2001; 104(19): 2376 - 2383.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. G. Sorci-Thomas, M. Thomas, L. Curtiss, and M. Landrum
Single Repeat Deletion in ApoA-I Blocks Cholesterol Esterification and Results in Rapid Catabolism of Delta 6 and Wild-type ApoA-I in Transgenic Mice
J. Biol. Chem., April 14, 2000; 275(16): 12156 - 12163.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. F. Kozarsky, M. H. Donahee, J. M. Glick, M. Krieger, and D. J. Rader
Gene Transfer and Hepatic Overexpression of the HDL Receptor SR-BI Reduces Atherosclerosis in the Cholesterol-Fed LDL Receptor-Deficient Mouse
Arterioscler. Thromb. Vasc. Biol., March 1, 2000; 20(3): 721 - 727.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Calleja, M. A. Paris, A. Paul, E. Vilella, J. Joven, A. Jimenez, G. Beltran, M. Uceda, N. Maeda, and J. Osada
Low-Cholesterol and High-Fat Diets Reduce Atherosclerotic Lesion Development in ApoE-Knockout Mice
Arterioscler. Thromb. Vasc. Biol., October 1, 1999; 19(10): 2368 - 2375.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
A. Plump and M. W. Ketterer
Cardiovascular Medicine at the Turn of the Millennium
N. Engl. J. Med., March 26, 1998; 338(13): 919 - 920.
[Full Text]


Home page
J. Biol. Chem.Home page
H.-h. Li, D. S. Lyles, M. J. Thomas, W. Pan, and M. G. Sorci-Thomas
Structural Determination of Lipid-bound ApoA-I Using Fluorescence Resonance Energy Transfer
J. Biol. Chem., November 17, 2000; 275(47): 37048 - 37054.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hughes, S. D.
Right arrow Articles by Rubin, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hughes, S. D.
Right arrow Articles by Rubin, E. M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
*Genetics Home Reference