Articles |
From the Institut für Prophylaxe und Epidemiologie der Kreislaufkrankheiten (M.A., M.E., E.B., P.C.W.), University of Munich, Germany; and the Department of Microbiology (M.S.), Hiroshima University, Japan.
Correspondence to Martin Aepfelbacher, Institut für Prophylaxe der Kreislaufkrankheiten, Pettenkoferstr. 9, 80336 München, Germany.
| Abstract |
|---|
|
|
|---|
Key Words: vascular endothelium bacterial toxins cell migration ADP ribosylation Rho GTPase
| Introduction |
|---|
|
|
|---|
It has become well established that Ras-related GTPases of the Rho family organize the actin cytoskeleton and focal adhesion formation.11 The family of Rho-like proteins in mammalian cells consists of RhoA, RhoB, RhoC, RhoD, RhoE, and RhoG; Rac1 and Rac2; TC10; TTF, and two CDC42Hs isoforms.12 Rho GTPases bind and hydrolyze GTP, and their cycle between a GDP-bound inactive and a GTP-bound active state is regulated by GTPase-activating proteins, guanine nucleotide exchange factors, and guanine nucleotide dissociation inhibitors.13 RhoA, RhoB, and RhoC can specifically be inactivated by bacterial toxins from C. botulinum and S. aureus, which act as ADP ribosyltransferases,14 or toxins A and B from C. difficile, which act as glucosyltransferases.15 ADP ribosylation and glucosylation take place at Asn41 and Thr37, respectively, in the putative effector region of Rho and presumably block the interaction of Rho with downstream targets.11 By use of these toxins, Rho was identified as a regulator of cell contraction, adhesion, division, and motility.11 The molecular function of Rho thereby seems to be to induce the formation of stress fibers and focal adhesion sites.16
Given the increasing number of naturally occurring bacterial toxins that inactivate one or more Rho GTPases, the question of their pathogenetic role arises. When these toxins enter the bloodstream, they will likely affect ECs and thus could potentially modulate inflammation, angiogenesis, and/or atherogenesis.
We demonstrate here that the ADP ribosyltransferases from C. botulinum and S. aureus as well as the glucosyltransferase from C. difficile inhibit EC migration and wound repair by deactivating Rho and blocking actin filament and focal adhesion formation.
| Methods |
|---|
|
|
|---|
The C3 exoenzyme was expressed as a glutathione S-transferase fusion protein in E. coli strain NM522. The pGEX2T-C3 exoenzyme expression vector was a generous gift from Dr L. Feig (Tufts University, Boston, Mass). Expression of the fusion protein was induced by isopropyl thiogalactopyranoside (Boehringer), bacteria were lysed by sonication, and the fusion protein was purified with glutathione Sepharose 4B beads (Pharmacia) and cleaved with thrombin (Boehringer) as described in detail.17 Purity of the C3 exoenzyme was tested on SDS/12% PAGE, and protein concentration was determined with the BCA method (Pierce), using BSA as standard. EDIN was purified exactly as described.18 C. difficile toxin A was a generous gift from Drs F. Hofmann and I. Just, Universität Freiburg, Freiburg, Germany.
HUVEC Culture and Migration Assay
HUVECs were obtained by cannulating segments of human
umbilical cord veins followed by incubation with
-chymotrypsin
(Sigma) for 30 minutes and gentle irrigation. The irrigant was
collected and harvested cells were plated onto collagen-coated
(collagen G consisting of 90% collagen I and 10% collagen III, from
Biochrom) plastic culture flasks. HUVECs were cultured in endothelial
growth medium (Promo Cell) containing EC growth supplement/Heparin and
10% fetal calf serum at 5% CO2 and 37°C in a humidified
atmosphere. The identity of HUVECs was verified by cobblestone
morphology and positive staining for factor VIII. HUVECs were used
between passages 2 and 4. For wound repair experiments, they were
plated onto collagen-coated six-well dishes (Falcon) at a density of
1x104/cm2 and grown to confluence with medium
changes every 2 to 3 days. After reaching confluence, HUVECs were
cultured for 3 to 5 more days until a homogenous, quiescent monolayer
with the typical cobblestone morphology developed. Thereafter, toxins
were added for indicated time periods. Wounds were made by dragging a
sterile pipette tip across the monolayer to create a cell-free path
1 mm wide. Quantification of cell migration was done under phase
contrast on an inverted microscope with a 10x objective and a 10x
ocular lens equipped with a 1-mmx1-mm grid consisting of 16 squares.
At indicated times after wounding, the grid was positioned over the
wound path and the number of cells that had migrated into the wounded
area was determined. To relocate the grid exactly, two 1- to 2-cm-long
fine scratches forming a cross line were made in the center of the
wound path with a diamond pencil. Each value represents the
mean of three different experiments with a minimum of 500 counted cells
per experiment.
Microinjection
Cells were microinjected with C3-transferase as described
elsewhere.16 Briefly, recombinant C3-transferase at 25
µg/mL in a buffer containing (in mmol/L) 50 Tris,
pH 7.5; 50 NaCl; 5 MgCl2; and 0.1 DTT was injected into the cytoplasm
of HUVECs with an Eppendorf microinjector. In some experiments,
efficiency of microinjection was tested by coinjection with mouse IgG,
followed by FITC-conjugated goat anti-mouse IgG and fluorescence
microscopy.
ADP Ribosylation, 2D Gel Electrophoresis, and Western Blot
HUVECs were trypsinized, pelleted by
centrifugation (150g, 5 minutes), and washed
once in PBS (pH 7.4). Then they were resuspended at
2x106/mL in ice-cold buffer containing 250
mmol/L sucrose; 1 mmol/L EDTA; 5 mmol/L
MgCl2; 10 mmol/L HEPES (pH 7.4); 1
mmol/L DTT; 0.1 mmol/L GTP; 1 µg/mL
leupeptin, pepstatin, and aprotinin; and 2 mmol/L PMSF and
sonicated for 10 seconds at 50 W with a Labsonic U (B. Braun). This
homogenate (100 µL) was added to 50 µL of a solution
containing 150 mmol/L Tris-HCL (pH 8), 30
mmol/L thymidine, 3 mmol/L DTT, 5 mmol/L
MgCl2, 0.3 mmol/L GTP, and 0.5 µg recombinant
C3 exoenzyme on ice. The reaction was started by adding 1 µCi
[32P]NAD (800 Ci/mmol, NEN) to the sample; then it was
incubated for 15 minutes in a 37°C water bath and precipitated for 45
minutes at -20°C with 6 vol ice-cold acetone. Precipitates were
analyzed by SDS/12% PAGE (Mini-Protean II, Bio-Rad) and
autoradiography with Kodak X-OMAT films. For 2D gel
electrophoresis, acetone-precipitated proteins were dissolved in 50
µL of 9 mol/L urea, 2% Nonidet P-40, 2% mercaptoethanol,
0.8% ampholytes (pH 3 to 10), and 0.1% bromophenol blue and then
subjected to isoelectric focusing on a 4% polyacrylamide gel
containing 4.4% ampholytes, pH 3 to 10, and 0.7% ampholytes, pH 5 to
7 (Biolyte, Bio-Rad), essentially as described by
O'Farrell.19 The pIs of the
[32P]ADP-ribosylated proteins were determined in pH
gradient calibration curves obtained with a mixture of pI markers (4.6,
5.4, 5.9, 6.6, 6.8, 7.2; Sigma). The second dimension was performed
with SDS/12% PAGE, using the Protean II xi system (Bio-Rad). For
Western blot, proteins were electrophoretically transferred to
Immobilon polyvinylidene difluoride membranes (Millipore) for
90 minutes at 195 mA in 20 mmol/L Tris/192
mmol/L glycine. Membranes were blocked for 1 hour in a solution
containing 20 mmol/L Tris-HCL (pH 7.4)/150
mmol/L NaCl/0.3% Tween/10% calf serum; then they were
incubated for 1 hour with mouse monoclonal or rabbit polyclonal
anti-RhoA or rabbit polyclonal anti-RhoB antibody (all 1:2000, IC
Chemikalien). After incubation for 45 minutes with peroxidase-labeled
sheep anti-mouse or donkey anti-rabbit IgG, respectively (1:5000;
Amersham), blots were developed using enhanced chemiluminescence (ECL,
Amersham) and then exposed to X-Omat AR film (Kodak).
Northern Blot
Total cellular RNA from HUVECs was separated on 1% agarose
gels, transferred onto Nytran N membranes (Schleicher & Schuell) with a
vacuum blotter using 10x SSC and fixed under UV. Prehybridization was
performed in 5x SSPE, 50% formamide containing 2x Denhardt's
solution, 0.1% SDS, and 0.1 mg/mL salmon sperm DNA for at least
2 hours at 45°C. Hybridization with the
oligonucleotides was done in the same solution
overnight. Filters were washed three times for 30 minutes each in 0.2x
SSPE and 0.1% SDS. For 32P labeling, 20 pmol of specific
oligonucleotides GGTTTCACAAGACAAGGCAACCA (RhoA),
TTCTGGGAGCCGTAGCGCTTC (RhoB), and CGACGCTTGTTCTTGCGGACC (RhoC) were
incubated with 100 µCi [32P]gATP (Amersham), and 20 U
T4 polynucleotide kinase (Pharmacia) for 1 hour at 37°C.
After addition of 6 µg carrier tRNA, the
phosphorylated oligonucleotides were
precipitated twice with 4 mol/L ammonium acetate and 100%
ethanol. Labeling efficiencies were similar for the RhoA, RhoB, and
RhoC oligonucleotides. The number of radioactive counts
used for hybridizations and the exposure times of the blots were
identical for RhoA, RhoB, and RhoC to ensure comparability of band
intensities. Specificities of the oligonucleotide
probes were tested with rhoA DNA.
Immunofluorescence
Glass coverslips (13.7 mmx13.7 mm, No. 1, Menzel
Gläser) were sonicated in dH2O, soaked for 2 hours in
ether/ethanol (1:1, vol/vol), and dried. These coverslips were
coated for 2 hours or overnight with 100 µg/mL collagen G
(Biochrom) and washed twice with PBS. HUVECs (4x104 cells)
were plated onto the collagen-coated coverslips and grown to
confluence, typically for 5 to 7 days. To label F-actin, cells were
fixed for 10 minutes with 3.7% paraformaldehyde in PBS
containing 1 mmol/L Mg2+ and 0.1
mmol/L Ca2+, permeabilized in cold
acetone (-20°C) for 5 minutes, and air dried. Coverslips were washed
three times, incubated for 20 minutes with rhodamine phalloidin
(Molecular Probes, 1:20 in PBS), and mounted in Mowiol (Calbiochem)
containing 0.2% p-phenylenediamine (Sigma)
as antifading agent. The number of microspikes per cell and the
percentage of cells showing membrane ruffles were determined by
evaluating at least 500 cells at the wound edge, using a 40x objective
(total magnification x400). Actin fibers were quantified by using a
40x objective (total magnification x400) and counting clearly
discernible fibers that had a length of at least 50% of the diameter
of the cell in one microscopic plane.
For vinculin staining, cells were fixed for 10 minutes with 3.7% paraformaldehyde in PBS containing 1 mmol/L Mg2+ and 0.1 mmol/L Ca2+, permeabilized in extraction buffer containing 60 mmol/L PIPES, 25 mmol/L HEPES (pH 6.1), 10 mmol/L EGTA, 3 mmol/L MgCl2, and 0.1% Triton for 5 minutes, blocked for 20 minutes with 10% normal goat serum, reacted with mouse monoclonal anti-vinculin hVIN-1 (Sigma, 1:2000) for 1 hour, and finally incubated with FITC-labeled goat anti-mouse IgG (1:200, Sigma). All steps were performed at room temperature with three washes in PBS/2% BSA between antibody incubations. Fluorescence microscopy was performed with a Zeiss Axiophot and micrographs were recorded on Kodak T-Max 400 panchromatic films.
| Results |
|---|
|
|
|---|
|
|
To demonstrate unambiguously that intracellularly acting C3-transferase
blocks EC migration, we microinjected C3 into cells at the wound edge
and the adjacent two to three cell rows behind the wound edge. Within
12 hours, 221±32 control cells and 118±20 C3-injected cells migrated
into 1 mm2 of area (n=2; mean±SD). Thus, at 12 hours,
the degree of inhibition of migration obtained with microinjection
(
50%) was very similar to what was seen with external addition of
C3. Microinjection was less effective at longer times after wounding,
possibly due to shorter half-life of C3 in the cytosol.
These data indicate that different bacterial toxins known to modify and inactivate Rho GTP-binding proteins are effective inhibitors of EC migration and wound repair in vitro.
Identification of Toxin Targets in ECs
To identify toxin target proteins in HUVECs, we incubated
cell lysates with [32P]NAD+ and
C3-transferase. SDS/PAGE and autoradiography revealed
one [32P]ADP-ribosylated band that migrated at 23 kD (Fig 2B
). In lysates of cells pretreated with increasing concentrations of
C3-transferase, incorporation of [32P]ADP ribose into the
Rho substrate was dose dependently reduced, indicating ADP ribosylation
in situ (Fig 2B
). We conclude that inhibition of cell migration
correlates with in situ ADP ribosylation of Rho.
Pretreatment of HUVECs with EDIN (10 µg/mL, 24 hours) or toxin
A (30 ng/mL, 12 hours) reduced [32P]ADP
ribosylation of the Rho substrate to a similar degree as C3-transferase
(3 µg/mL, 24 hours; Fig 2C
). Together, these data suggest that
different bacterial toxins are able to ADP ribosylate (C3, EDIN) or
glucosylate (toxin A) Rho in intact HUVECs.
In 2D gels of the in vitro [32P]ADP-ribosylation
substrates, three [32P]ADP-ribosylated protein spots of
different intensities and pIs, designated A, B, and C were detected
(Fig 3
). The intensities of all three
spots were diminished in lysates from C3- or toxin Apretreated cells
(data not shown), indicating that they all were subject to in situ
modification. The most abundant spot, A, consisted of one major and one
minor spot with pIs of 6.3 and 6.2, respectively. These protein spots
most likely represent RhoA because they (1) have the calculated
pI of RhoA (6.2), (2) comigrate with RhoA present in platelets
and monocytic cells,20 and (3) react with specific
monoclonal and polyclonal antibodies to RhoA in Western blots (Fig 3
).
Spot B, with a pI of 5.2, likely represents RhoB because (1)
its pI is similar to the calculated pI of RhoB (5.3) and (2) it reacted
with a specific polyclonal antibody to RhoB (Fig 3
). The least abundant
spot, C, likely represents RhoC because its pI of 6.7
resembles the calculated pI of RhoC (6.8). So far we were
unable to detect Rac1 or Rac2 in HUVECs by Western blot
(Aepfelbacher et al, unpublished data, 1997).
|
To further confirm the presence of RhoA, RhoB, and RhoC in
HUVECs, we analyzed mRNA expression.
Oligonucleotide probes specific for rhoA,
rhoB, or rhoC genes hybridized to distinct bands
in Northern blot analysis (Fig 4
). The rhoC signal in the
Northern blot was considerably weaker than the rhoA and
rhoB signals. This finding is consistent with the
low abundance of spot C (which likely represents the RhoC
protein) in the 2D gel.
|
Taken together, these data indicate that RhoA, RhoB, and most likely RhoC are in vivo substrates of C3-transferase, EDIN, and toxin A in HUVECs. Due to its availability as recombinant protein, most remaining experiments were performed with C3-transferase.
C3-Transferase Selectively Affects Actin Stress Fibers and Focal
Adhesion Sites in Migrating ECs
Rho family GTPases have been implicated in the formation of
distinct filamentous actin structures,22 namely
microspikes/filopodia (CDC42Hs), membrane ruffles/lamellipodia (Rac)
and stress fibers (Rho). To test whether such structures are expressed
in migrating HUVECs, we stained cells with rhodamine-phalloidin before
and at various intervals after wounding. As demonstrated in Fig 5
, microspikes, membrane ruffles, and
stress fibers were largely absent from untreated and C3-treated cells
in the confluent monolayer (A and B). C3 slightly reduced actin at the
cell-to-cell contacts and induced few gaps between adjacent cells, but
in contrast to fibroblasts11 and similar to
monocytes23 and neurons,24 C3 caused
flattening of most cells rather than rounding. Approximately 5% to
10% of cells in the confluent monolayer were elongated and contained
stress fibers, even in the presence of C3-transferase. We think that
these cells take up external C3 inefficiently, because microinjection
of C3 into these particular cells was able to abolish stress fibers
(not shown). Within 10 minutes after wounding, nearly all of the cells
at the wound edge expressed microspikes that pointed into the wounded
area (Fig 5C
). Approximately seven microspikes per cell were expressed
10 minutes after wounding; thereafter, this number decreased to
approximately one at 24 hours. Microspikes were also found in cells
pretreated with C3-transferase (Fig 5D
). Quantification of microspikes
in control and C3-treated cells at 10 minutes after wounding revealed
6.5±1.1 and 6.8±2 microspikes per cell, respectively (mean±SD, n=3,
500 cells counted per experiment). The membrane ruffles that developed
in cells at the wound edge were oriented toward the direction of
migration (Fig 5E
). The appearance of membrane ruffles occurred in two
phases: between 10 minutes and 4 hours after wounding,
20% of cells
showed ruffles. This percentage increased to 70% between 4 and 12
hours. Ruffles were also found in C3-treated cells (Fig 5F
), and
quantification at 6 hours after wounding demonstrated that the
percentage of cells showing ruffles was 33±11 in control and 31±8 in
C3-treated cells (mean±SD, n=3, 500 cells counted per experiment).
Finally, the number of actin filaments per cell increased dramatically
in HUVECs at the wound edge (compare Fig 5G
with 5A). Stress fibers
were hardly detectable until 2 hours after wounding, and thereafter
their number increased to a maximum after 12 to 24 hours.
C3-Transferase almost completely abolished the formation of actin
fibers (compare Fig 5H
with 5G). Similar to C3-transferase, EDIN and
toxin A were able to prevent stress fiber formation (data not shown).
Microinjection of C3 produced essentially identical results as external
addition of C3 (data not shown).
|
We next investigated the effect of toxins on vinculin
reorganization during wound repair. By immunostaining
with anti-vinculin antibodies, a few tear-shaped focal adhesions were
detected at the ventral surface of cells in the intact or C3-treated
monolayer (Fig 5I
and 5J
). Vinculin staining was mainly concentrated at
the cell boundaries in cell-to-cell contacts. On wounding of the
monolayer, cells at the wound edge showed a rapid (within 10 minutes)
redistribution of vinculin into microspikes (Fig 5K
). C3-Transferase
did not prevent relocation of vinculin to microspikes (Fig 5L
). The
formation of vinculin-containing focal adhesions paralleled the
generation of stress fibers. They were first seen after 2 to 4 hours
and were maximally expressed at 12 hours (Fig 5M
). C3-Transferase
completely inhibited the formation of the tear-shaped focal adhesions
(Fig 5N
), which by double immunostaining were found to
be mainly located at the tip of stress fibers. Interestingly, however,
C3-transferase did not abolish vinculin accumulation in punctate-like
focal complexes at the cell periphery, indicating that these were
assembled independent of Rho.
| Discussion |
|---|
|
|
|---|
20%), allowing for a
valid and quantitative evaluation of actin structures. The 2D gel electrophoresis of the [32P]ADP-ribosylation substrates and the Northern blots suggested that RhoA, RhoB, and RhoC are expressed in HUVECs and that RhoA is by far the most abundant Rho isoform. The reduced in vitro [32P]ADP ribosylation in lysates of C3- or toxin Apretreated cells indicated that RhoA, RhoB, and RhoC can all be ADP ribosylated by C3-transferase or glucosylated by toxin A, respectively, in intact HUVECs. The functions of Rho proteins in cytoskeletal organization have mostly been attributed to RhoA, because it was identified as the sole ADP-ribosylation substrate in fibroblasts,26 human blood platelets,27 lymphocytes,28 neuronal cells,24 and monocytic cell lines.20 29 Because RhoA and RhoC are 98% homologous on the level of amino acid sequence, they most likely are redundant with respect to function. In contrast, RhoB is only 88% homologous to RhoA and RhoC and is inducible by growth factors30 and DNA-damaging agents in quiescent fibroblasts.31 Whether RhoB is also involved in actin organization is controversial.31 32 Hence, the toxin effects described herein can most likely be attributed to inhibition of RhoA.
HUVECs at the wound edge expressed microspikes, lamellipodia/ruffles, and actin fibers, all of which have been implicated in cell migration.10 In quiescent fibroblasts stimulated with bradykinin or microinjected with activated CDC42Hs, a hierarchical cascade exists whereby CDC42Hs induces filopodia and activates Rac, Rac in turn produces lamellipodia and activates Rho, and Rho finally stimulates formation of actin fibers.22 This sequence of events takes place within 30 minutes after stimulation of cells. In contrast, HUVECs at the wound edge expressed microspikes and some membrane ruffles (in 20% of cells) within 30 minutes after wounding, but formation of actin fibers and the majority of membrane ruffling occurred between 2 and 24 hours.
Actin structures in migrating HUVECs were closely associated with
vinculin-containing focal complexes. We found that C3 inhibited neither
the rapid vinculin relocation to microspikes nor the formation of
punctate-like focal complexes at the cell periphery, which is
consistent with its lacking effect on microspike or ruffle
formation. Consequently, C3 completely prevented the formation of focal
adhesions, which are located at the end of stress fibers. Hence, the
wound repair response of ECs seems to involve the temporally and
spatially controlled formation of at least three distinct combinations
of actin/vinculin structures that most probably are controlled by
individual Rho family GTPases (summarized in Fig 6
). In the early phase (10 minutes to 2
hours after wounding), cells express actin microspikes and ruffles,
potentially through activation of CDC42Hs and Rac, respectively. In the
late phase (2 to 24 hours after wounding), Rho induces formation of
actin filaments/focal adhesions. Further experiments should
analyze the role of Rac and CDC42Hs in wound repair and
determine the hierarchy and temporal and spatial coordination of Rho,
Rac, and CDC42Hs activities in migrating ECs.
|
In summary, EC migration is crucial for the repair of injured blood vessels,1 angiogenesis,3 and atherogenesis33 and depends on assembly of specific actin structures and focal adhesions (see References 8 and 348 34 and the present study). Our data suggest that Rho family GTP-binding proteins control the complex cytoskeletal reorganizations in migrating ECs and should promote further investigations about the influence of Rho-inhibiting bacterial toxins on tumor angiogenesis, inflammation, and atherogenesis.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received October 2, 1996; accepted January 16, 1997.
| References |
|---|
|
|
|---|
2. Haudenschild CC, Schwartz SM. Endothelial regeneration, II: restitution of endothelial continuity. Lab Invest. 1979;41:407-418.[Medline] [Order article via Infotrieve]
3.
Folkman J, Shing Y. Angiogenesis.
J Biol Chem. 1992;267:10931-10934.
4.
Coomber BL, Gotlieb AI. In vitro
endothelial wound repair: interaction of cell migration
and proliferation.
Arteriosclerosis. 1990;10:215-222.
5. Sholley MM, Gimbrone MA, Cotran RS. Cellular migration and replication in endothelial regeneration: a study using irradiated endothelial cultures. Lab Invest. 1977;36:18-25.[Medline] [Order article via Infotrieve]
6.
Selden SC, Schwartz SM. Cytochalasin B
inhibition of endothelial proliferation at wound edges
in vitro. J Cell Biol. 1979;81:348-354.
7. Wong MKK, Gotlieb AI. In vitro reendothelialization of a single-cell wound: role of microfilament bundles in rapid lamellipodia-mediated wound closure. Lab Invest. 1984;51:75-81.[Medline] [Order article via Infotrieve]
8. Romer LH, McLean N, Turner CE, Burridge K. Tyrosine kinase activity, cytoskeletal organization, and motility in human vascular endothelial cells. Mol Biol Cell. 1994;5:349-361.[Abstract]
9. Burridge K, Fath K, Kelly T, Nuckolls G, Turner C. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu Rev Cell Biol. 1988;4:487-525.
10. Huttenlocher A, Sandborg RR, Horwitz AF. Adhesion in cell migration. Curr Opin Cell Biol. 1995;7:697-706.[Medline] [Order article via Infotrieve]
11. Hall A. Small GTP-binding proteins and the regulation of the actin cytoskeleton. Annu Rev Cell Biol. 1994;10:31-54.
12. Ridley AJ. Rho: theme and variations. Curr Biol. 1996;6:1256-1264.[Medline] [Order article via Infotrieve]
13. Boguski MS, McCormick F. Proteins regulating ras and its relatives. Nature. 1993;366:643-654.[Medline] [Order article via Infotrieve]
14. Aktories K, Just I. In vitro ADP-ribosylation of Rho by bacterial ADP-ribosyltransferases. Methods Enzymol.1995;256:184-195.
15. Aktories K, Just I. Monoglucosylation of low-molecular mass GTP-binding Rho proteins by clostridial cytotoxins. Trends Cell Biol. 1995;5:441-443.[Medline] [Order article via Infotrieve]
16. Ridley AJ, Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell. 1992;70:389-399.[Medline] [Order article via Infotrieve]
17. Smith DB, Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene. 1988;67:31-40.[Medline] [Order article via Infotrieve]
18. Sugai M, Enomoto T, Hashimoto K, Matsumoto K, Matsuo Y, Ohgai H, Hong YM, Inoue S, Yoshikawa K, Suginawa H. A novel epidermal cell differentiation inhibitor (EDIN): purification and characterization from Staphylococcus aureus. Biochem Biophys Res Commun. 1990;173:92-98.[Medline] [Order article via Infotrieve]
19.
O'Farrell PH. High resolution two-dimensional
electrophoresis of proteins. J Biol Chem. 1975;250:4007-4012.
20. Aepfelbacher M, Essler M, Luber De Quintana K, Weber PC. ADP-ribosylation of the GTP-binding protein RhoA blocks cytoplasmic division in human myelomonocytic cells. Biochem J. 1995;308:853-858.
21. Dillon ST, Feig LA. Purification and assay of recombinant C3-transferase. Methods Enzymol. 1995;256:174-184.[Medline] [Order article via Infotrieve]
22. Nobes CD, Hall A. Rho, Rac, and Cdc42 GTPase regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell. 1995;81:53-62.[Medline] [Order article via Infotrieve]
23. Aepfelbacher M, Essler M, Huber E, Czech A, Weber PC. Rho is a negative regulator of human monocyte spreading. J Immunol. 1996;157:5070-5075.[Abstract]
24.
Jalink K, van Corven EJ, Hengeveld T, Morii N, Narumiya
S, Moolenaar WH. Inhibition of lysophosphatidate- and
thrombin-induced neurite retraction and neuronal cell rounding by ADP
ribosylation of the small GTP-binding protein Rho. J Cell
Biol. 1994;126:801-810.
25.
Sugai M, Hashimoto K, Kikuchi A, Inoue S, Okumura H,
Matsumoto K, Goto Y, Ohgai H, Moriishi K, Syuto B, Yoshikawa
K, Suginaka H, Takai Y. Epidermal cell differentiation
inhibitor ADP-ribosylates small GTP-binding proteins and
induces hyperplasia of epidermis. J Biol Chem. 1992;267:2600-2604.
26. Yamamoto M, Marui N, Sakai T, Morii N, Kozaki S, Ikai K, Imamura S, Narumiya S. ADP-ribosylation of the rhoA gene product by botulinum C3 exoenzyme causes Swiss 3T3 cells to accumulate in the G1 phase of the cell cycle. Oncogene. 1993;8:1449-1455.[Medline] [Order article via Infotrieve]
27.
Nemoto Y, Namba T, Teru-uchi T, Ushikubi F, Morii N,
Narumiya S. A rho gene product in human blood
platelets. J Biol Chem. 1992;267:20916-20920.
28.
Lang P, Guizani L, Vitté-Mony I, Stancou R,
Dorseuil O, Gacon G, Bertoglio J. ADP-ribosylation of the
ras-related, GTP-binding protein rhoA inhibits lymphocyte-mediated
cytotoxicity. J Biol Chem. 1992;267:11677-11680.
29.
Aepfelbacher M. ADP-ribosylation of Rho enhances
adhesion of U937 cells to fibronectin via the
5ß1 integrin
receptor. FEBS Lett. 1995;363:78-80.[Medline]
[Order article via Infotrieve]
30.
Jähner D, Hunter T. The
ras-related gene rhoB is an immediate-early gene
inducible by v-fps, epidermal growth factor, and
platelet-derived growth factor in rat fibroblasts. Mol Cell
Biol. 1991;11:3682-3690.
31.
Fritz G, Kaina B, Aktories K. The
ras-related small GTP-binding protein rhoB is
immediate-early inducible by DNA-damaging treatments. J Biol
Chem. 1995;270:25172-25177.
32.
Adamson P, Paterson H, Hall A. Intracellular
localization of the p21rho proteins. J Cell Biol. 1992;119:617-627.
33. Ross R, Glomset JA. The pathogenesis of atherosclerosis. N Engl J Med. 1976;295:369-377.[Medline] [Order article via Infotrieve]
34.
Lampugnani MG, Corada M, Caveda L, Breviario F, Ayalon
O, Geiger B, Dejana E. The molecular organization of
endothelial cell to cell junctions: differential
association of plakoglobin, ß-catenin, and
-catenin with vascular
endothelial cadherin (VE-cadherin).
J Cell Biol. 1995;129:203-217.
This article has been cited by other articles:
![]() |
E. Ispanovic, D. Serio, and T. L. Haas Cdc42 and RhoA have opposing roles in regulating membrane type 1-matrix metalloproteinase localization and matrix metalloproteinase-2 activation Am J Physiol Cell Physiol, September 1, 2008; 295(3): C600 - C610. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Schubert, A. Benarroch, J. Ostvang, and E. R. Edelman Regulation of Endothelial Cell Proliferation by Primary Monocytes Arterioscler. Thromb. Vasc. Biol., January 1, 2008; 28(1): 97 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Singleton, R. Salgia, L. Moreno-Vinasco, J. Moitra, S. Sammani, T. Mirzapoiazova, and J. G. N. Garcia CD44 Regulates Hepatocyte Growth Factor-mediated Vascular Integrity: ROLE OF c-Met, Tiam1/Rac1, DYNAMIN 2, AND CORTACTIN J. Biol. Chem., October 19, 2007; 282(42): 30643 - 30657. [Abstract] [Full Text] [PDF] |
||||
![]() |
Hardev Ramandeep Singh Girn, S. Ahilathirunayagam, A. I. D. Mavor, and S. Homer-Vanniasinkam Reperfusion Syndrome: Cellular Mechanisms of Microvascular Dysfunction and Potential Therapeutic Strategies Vascular and Endovascular Surgery, September 1, 2007; 41(4): 277 - 293. [Abstract] [PDF] |
||||
![]() |
K. Aase, M. Ernkvist, L. Ebarasi, L. Jakobsson, A. Majumdar, C. Yi, O. Birot, Y. Ming, A. Kvanta, D. Edholm, et al. Angiomotin regulates endothelial cell migration during embryonic angiogenesis Genes & Dev., August 15, 2007; 21(16): 2055 - 2068. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oktem, I. Esinler, D. Eroglu, N. Haberal, N. Bayraktar, and H. B. Zeyneloglu High-dose atorvastatin causes regression of endometriotic implants: a rat model Hum. Reprod., May 1, 2007; 22(5): 1474 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gojova and A. I. Barakat Vascular endothelial wound closure under shear stress: role of membrane fluidity and flow-sensitive ion channels J Appl Physiol, June 1, 2005; 98(6): 2355 - 2362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chifflet, J. A. Hernandez, and S. Grasso A possible role for membrane depolarization in epithelial wound healing Am J Physiol Cell Physiol, June 1, 2005; 288(6): C1420 - C1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Voth and J. D. Ballard Clostridium difficile Toxins: Mechanism of Action and Role in Disease Clin. Microbiol. Rev., April 1, 2005; 18(2): 247 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Evans, J. M. Sutton, D. E. Holloway, J. Ayriss, C. C. Shone, and K. R. Acharya The Crystal Structure of C3stau2 from Staphylococcus aureus and Its Complex with NAD J. Biol. Chem., November 14, 2003; 278(46): 45924 - 45930. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Adini, I. Rabinovitz, J. F. Sun, G. C. Prendergast, and L. E. Benjamin RhoB controls Akt trafficking and stage-specific survival of endothelial cells during vascular development Genes & Dev., November 1, 2003; 17(21): 2721 - 2732. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. GRATZINGER, S. CANOSA, B. ENGELHARDT, and J. A. MADRI Platelet endothelial cell adhesion molecule-1 modulates endothelial cell motility through the small G-protein Rho FASEB J, August 1, 2003; 17(11): 1458 - 1469. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. van Nieuw Amerongen, P. Koolwijk, A. Versteilen, and V. W.M. van Hinsbergh Involvement of RhoA/Rho Kinase Signaling in VEGF-Induced Endothelial Cell Migration and Angiogenesis In Vitro Arterioscler. Thromb. Vasc. Biol., February 1, 2003; 23(2): 211 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Weis, C. Heeschen, A. J. Glassford, and J. P. Cooke Statins Have Biphasic Effects on Angiogenesis Circulation, February 12, 2002; 105(6): 739 - 745. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamaguchi, T. Hayashi, H. Takami, M. Ohnishi, T. Murata, K. Nakayama, K. Asakawa, M. Ohara, H. Komatsuzawa, and M. Sugai Complete Nucleotide Sequence of a Staphylococcus aureus Exfoliative Toxin B Plasmid and Identification of a Novel ADP-Ribosyltransferase, EDIN-C Infect. Immun., December 1, 2001; 69(12): 7760 - 7771. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Verin, A. Birukova, P. Wang, F. Liu, P. Becker, K. Birukov, and J. G. N. Garcia Microtubule disassembly increases endothelial cell barrier dysfunction: role of MLC phosphorylation Am J Physiol Lung Cell Mol Physiol, September 1, 2001; 281(3): L565 - L574. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. van Nieuw Amerongen and V. W.M. van Hinsbergh Cytoskeletal Effects of Rho-Like Small Guanine Nucleotide-Binding Proteins in the Vascular System Arterioscler. Thromb. Vasc. Biol., March 1, 2001; 21(3): 300 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Yamada, M Sugai, M Woo, N Nishida, and T Sugimoto Acquired subglottic stenosis caused by methicillin resistant Staphylococcus aureus that produce epidermal cell differentiation inhibitor Arch. Dis. Child. Fetal Neonatal Ed., January 1, 2001; 84(1): 38F - 39. [Abstract] [Full Text] |
||||
![]() |
J. M. Carbajal, M. L. Gratrix, C.-H. Yu, and R. C. Schaeffer Jr. ROCK mediates thrombin's endothelial barrier dysfunction Am J Physiol Cell Physiol, July 1, 2000; 279(1): C195 - C204. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Moldovan, N. I. Moldovan, R. H. Sohn, S. A. Parikh, and P. J. Goldschmidt-Clermont Redox Changes of Cultured Endothelial Cells and Actin Dynamics Circ. Res., March 17, 2000; 86(5): 549 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lee, E. J. Goetzl, and S. An Lysophosphatidic acid and sphingosine 1-phosphate stimulate endothelial cell wound healing Am J Physiol Cell Physiol, March 1, 2000; 278(3): C612 - C618. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Carbajal and R. C. Schaeffer Jr. RhoA inactivation enhances endothelial barrier function Am J Physiol Cell Physiol, November 1, 1999; 277(5): C955 - C964. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. C. Weber, P. J. Nelson, H.-J. Grone, and C. Weber Expression of CCR2 by Endothelial Cells : Implications for MCP-1 Mediated Wound Injury Repair and In Vivo Inflammatory Activation of Endothelium Arterioscler. Thromb. Vasc. Biol., September 1, 1999; 19(9): 2085 - 2093. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Island, X. Cui, and J. W. Warren Effect of Escherichia coli Cytotoxic Necrotizing Factor 1 on Repair of Human Bladder Cell Monolayers In Vitro Infect. Immun., July 1, 1999; 67(7): 3657 - 3661. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nilius, T. Voets, J. Prenen, H. Barth, K. Aktories, K. Kaibuchi, G. Droogmans, and J. Eggermont Role of Rho and Rho kinase in the activation of volume-regulated anion channels in bovine endothelial cells J. Physiol., April 1, 1999; 516(1): 67 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Essler, K. Hermann, M. Amano, K. Kaibuchi, J. Heesemann, P. C. Weber, and M. Aepfelbacher Pasteurella multocida Toxin Increases Endothelial Permeability via Rho Kinase and Myosin Light Chain Phosphatase J. Immunol., November 15, 1998; 161(10): 5640 - 5646. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Moore, G. H. Brough, P. Babal, J. J. Kelly, M. Li, and T. Stevens Store-operated calcium entry promotes shape change in pulmonary endothelial cells expressing Trp1 Am J Physiol Lung Cell Mol Physiol, September 1, 1998; 275(3): L574 - L582. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Essler, M. Amano, H.-J. Kruse, K. Kaibuchi, P. C. Weber, and M. Aepfelbacher Thrombin Inactivates Myosin Light Chain Phosphatase via Rho and Its Target Rho Kinase in Human Endothelial Cells J. Biol. Chem., August 21, 1998; 273(34): 21867 - 21874. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Friebel, H. Ilchmann, M. Aepfelbacher, K. Ehrbar, W. Machleidt, and W.-D. Hardt SopE and SopE2 from Salmonella typhimurium Activate Different Sets of RhoGTPases of the Host Cell J. Biol. Chem., August 31, 2001; 276(36): 34035 - 34040. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |