© 1997 American Heart Association, Inc.
Articles |
Downregulation of the Selectin Ligand-Producing Fucosyltransferases Fuc-TIV and Fuc-TVII During Foam Cell Formation in Monocyte-Derived Macrophages
From the Institut für Arterioskleroseforschung (P.C., S.M., B.B., A.C., G.A.), Institut für Allgemeine Zoologie und Genetik (S.M.), and Institut für Klinische Chemie und Laboratoriumsmedizin (G.A.), Westfälische Wilhelms-Universität Münster, Münster, Germany.
Correspondence to Dr Paul Cullen, Institut für Arterioskleroseforschung, Domagkstraße 3, 48149 Münster, Germany. E-mail cullen{at}uni-muenster.de.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract Identification of genes expressed during foam cell formation is important for understanding the molecular basis of atherosclerosis. We used polymerase chain reaction (PCR)–based differential display to isolate differentially expressed cDNA species in foam cells induced by incubation of human monocyte-derived macrophages in the presence of acetylated or oxidized LDL. This led to identification of a 306-bp cDNA with 100% homology to type IV fucosyltransferase (Fuc-TIV), which was downregulated by factors of 20 and 3 in acetylated LDL– and oxidized LDL–loaded macrophages, respectively. This enzyme is sufficient for the expression of Lewis X and sialyl Lewis X, carbohydrate adhesion molecules that bind to receptors of the selectin family. Expression of a second fucosyltransferase (Fuc-TVII) that synthesizes sialyl Lewis X but not Lewis X was shown by quantitative reverse transcription–PCR to also be reduced, by 40% and 20% in acetylated LDL– and oxidized LDL–loaded macrophages, respectively.
-(1,3)-Fucosyltransferase enzyme activity was reduced in lysates
from both acetylated LDL– and oxidized LDL–loaded cells.
Analysis by flow cytometry showed reduced expression of the
CD15 (corresponding to Lewis X) and CD15s (sialyl Lewis X) antigens on
the surface of cells loaded with either acetylated or oxidized
LDL. Transformation of macrophages into foam cells results in
reduced expression of selectin-binding ligands on the surface of such
cells.
Key Words: atherosclerosis • monocyte-derived macrophages • foam cells • differential display • fucosyltransferase IV
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
One of the most characteristic features of atherosclerotic lesions is the accumulation of foam cells.1 Previous work has shown that most of these foam cells are of macrophage origin and develop from circulating monocytes that enter the subendothelial space of the arterial wall.2 3 4 The foamy appearance of their cytoplasm is due to the intracellular accumulation of droplets of cholesteryl ester.5 6 A portion of the cholesterol in such macrophages is either synthesized de novo, internalized as lipoprotein (a),7 or taken up as VLDL or LDL via the LDL receptor. However, most of this cholesterol probably originates from cell detritus ingested during phagocytosis and from chemically modified lipoproteins taken up via the scavenger receptor and the putative receptor for OxLDL.8 9 10 11 Whereas the uptake of cholesterol via the LDL receptor is subject to tightly regulated negative feedback, no such control exists over the uptake of LDL via the scavenger or putative OxLDL receptors.12 13
To be recognized by the scavenger or OxLDL receptors, LDL must undergo chemical modification, a process that probably occurs in the microenvironment of the subendothelial space.14 Such chemically modified LDL acts as an irritant. For example, many of the compounds found in OxLDL are highly reactive and have cytotoxic effects.15 The formation of foam cells is also associated with the production of numerous immune mediators that further intensify the inflammatory process.15 On the other hand, subendothelial macrophages may serve a protective function by neutralizing reactive modified lipoproteins. It has also been reported that cholesterol-loaded macrophages may exit from the atherosclerotic plaque, a process that may slow progression of the lesion.16 Thus, it is unclear at present whether the process of macrophage-derived foam cell formation promotes or retards the development of atherosclerosis.
To investigate this question we examined the pattern of gene expression during AcLDL- and OxLDL-induced foam cell formation in vitro using PCR-based differential display of mRNA as described by Liang and Pardee.17 This technique uses a combination of arbitrary and anchored primers to generate a set of 3' fragments from cDNA derived from the total mRNA of a cell and represents a considerable advance in the method of differential cDNA hybridization. These experiments led to isolation of a cDNA with 100% homology to Fuc-TIV, which was downregulated on loading of the cells with AcLDL and, to a lesser extent, OxLDL. Some,18 19 though not all,20 21 previous studies have suggested that Fuc-TIV is sufficient for the expression of Lewis X, the carbohydrate ligand for the selectin family of adhesion. Investigation by quantitative RT-PCR showed that expression of Fuc-TVII, which synthesizes sialyl Lewis X but not Lewis X, was also reduced in loaded cells. Thus, the transformation of macrophages into foam cells may modulate the adhesive properties of such cells.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Monocyte Isolation and Culture
Monocytapheresis and phlebology procedures were approved by the University of Münster ethics committee. White blood cells from healthy volunteers were obtained by monocytapheresis using a CS3000 cell separator. The monocytes were separated by countercurrent centrifugation in an elutriation chamber as described by Schmitz et al.22 Aliquots of the fractions were examined for their purity using a forward-scatter versus a side-scatter plot in a FACScan. Fractions containing more than 95% monocytes were pooled. The cells were plated at a density of 106 cells/mL in 35-mm cell culture dishes in RPMI 1640 and incubated at 37°C in a humidified incubator (5% CO2). After 1 hour, when the monocytes had adhered to the surface of the dishes, the nonadherent cells were removed by washing. The monocytes were then cultured for 14 days in RPMI 1640 supplemented with 20% human serum obtained from healthy volunteers.
Preparation of AcLDL and OxLDL
LDL (d=1.019 to 1.063 g/mL) was
acetylated by repeated additions of acetic anhydride as
previously described.5 AcLDL showed enhanced mobility on
agarose gel electrophoresis at pH 8.6. OxLDL was prepared by incubation
of LDL with 10 µmol/L CuSO4 for 6 hours at
37°C. The reaction was then stopped by placing the preparation on ice
and addition of 2 mmol/L EDTA. The OxLDL was copiously
dialyzed for 16 hours against 0.9% NaCl alternated with 0.9% NaCl
supplemented with 5 mmol/L EDTA. All preparations of OxLDL
showed a concentration of thiobarbituric acid–reacting substances of
between 50 and 100 nmol/mg LDL protein. Monocyte-derived
macrophages were incubated for 48 hours with 80 µg of
OxLDL/mL culture medium. Cellular cholesterol and
cholesteryl ester content was determined by reverse-phase
high-performance liquid chromatography using a
method developed in our laboratory.22A
PCR-Based Differential Display
Differential display was performed using a commercially
available kit and a standard protocol. Total cellular RNA was isolated
as follows: The cell monolayer (approximately 1.5x107
cells) was washed with PBS and then flooded with 2 mL of an acid
guanidinium thiocyanate solution. The RNA was extracted with
phenol/chloroform as described by Chomczynski and
Sacchi.23 DNA-free RNA was obtained using a MessageClean(TM)
kit and checked for integrity by agarose gel electrophoresis.
Nine single-stranded cDNA synthesis reactions were then performed using the following oligonucleotide primers: T12AA, -AC, -AG, -CA, -CC, -CG, -GA, -GC, or -GG according to a standard protocol (cDNA synthesis kit). PCR was then performed in reaction mixtures containing 0.1 vol of reverse transcription reaction mixture; 1xPCR buffer; 2 µmol/L each of dGTP, dATP, dTTP, and dCTP; 10 µCi 35S-dATP; 1 µmol/L of the respective T12NN oligonucleotide primer; 0.2 µmol/L of the specific arbitrary 10-mer oligonucleotide; and 2.5 units of AmpliTaq DNA polymerase using 40 cycles of 94°C for 30 seconds, 40°C for 60 seconds, and 72°C for 60 seconds, followed by 72°C for 5 minutes. Loading buffer was added to the samples, which were heated at 80°C for 2 minutes before they were loaded onto 6% denaturing polyacrylamide sequencing gels. After electrophoresis, the gels were exposed to Kodak XAR-5 film for 48 hours. To avoid identification of spurious changes in the band pattern (false positives), all experiments were performed in duplicate, and corresponding PCR products from each reaction were loaded in adjacent lanes.
Band Recovery, Reamplification, and Cloning of cDNAs
Bands showing differential expression were cut out, and DNA was
eluted by boiling in 100 µL of H2O for 10 minutes. The
DNA was reamplified by PCR using appropriate primers and the conditions
described above, except for dNTP concentrations, which were changed to
20 µmol/L, and the absence of radioisotope. The PCR
product was visualized on a 2% agarose gel, eluted, and used as a
probe for Northern blot analysis or cloned into the pUC 18 Sma
I/BAP vector for sequencing using the Sure Clone(TM) ligation kit. DNA
sequencing was performed on an automatic laser fluorescent
analyzer using the AutoRead(TM) sequencing kit. Sequence database
searching was carried out using the BLAST program.24
Northern Blot Analysis
Poly(A)+ RNA (2 µg) was isolated from total RNA
using magnetic beads, size fractionated on formaldehyde-denaturing 1%
agarose gels, and transferred to a positively charged nylon membrane
with 20xSSC by capillary transfer according to standard methods. After
UV cross-linking, blots were prehybridized for 1 hour at 50°C in DIG
Easy Hyb and then hybridized in DIG Easy Hyb for 16 to 24 hours at
50°C with digoxigenin-labeled probes prepared by random priming using
a commercially available kit. After hybridization, blots were washed
twice with 2xSSC supplemented with 0.1% SDS for 15 minutes at room
temperature, followed by two washes with 0.5xSSC supplemented with
0.1% SDS for 5 minutes at 68°C. For chemiluminescent detection the
membranes were incubated with a dilution of anti-digoxigenin Fab
fragments conjugated to alkaline phosphatase. The blots were then
incubated with the chemiluminescent substrate CDP-Star(TM) and exposed to
Kodak XAR-5 film for 3 minutes. Lane-loading differences were
normalized with a probe directed against the mRNA of the housekeeping
gene GAPDH.
Measurement of -(1,3)-Fucosyltransferase Activity
The fucosyltransferase assay with low-molecular-weight acceptor
substances was performed as described previously.18
Briefly, cells were washed and harvested in PBS before pelleting by
centrifugation. Cell extracts were prepared by
resuspending the cell pellets in 1% Triton X-100 such that the final
protein concentration in the extracts was approximately 5 mg/mL
(Lowry assay). The fucosyltransferase assay was performed in 50
mmol/L MOPS (pH 6.5), 25 mmol/L MnCl2,
10 mmol/L L-fucose, 5 mmol/L ATP,
3 µmol/L GDP-[14C]fucose (specific
activity, 600 000 cpm/nmol), 20 mmol/L acceptor
(N-acetyllactosamine), and up to 10 µL of cell extract in
a final volume of 20 µL. Reactions were incubated at 37°C for 2
hours and terminated by the addition of 20 µL of ethanol, followed by
dilution with 500 µL of H2O. The reaction was then
centrifuged at 15 000xg for 5 minutes. Fifty
microliters of the reaction supernatant was counted to determine total
radioactivity, and 200 µL was fractionated by Dowex-L
chromatography as described by Rajan et
al.25 The neutral radiolabeled material eluting from
the column was counted directly as a measure of product formation.
Parallel reactions were done in the absence of added acceptor to allow
correction for transfer to endogenous acceptor molecules
and for substrate and product hydrolysis. These control experiments
indicated that less than 5% of the radioactivity of
GDP-[14C]fucose was found as a neutral product in the
absence of an acceptor.
Flow Cytometry
Cells were harvested from a confluent T75 culture flask using
5 mmol/L EDTA in PBS, centrifuged, and resuspended
in FACS buffer (PBS, 3% fetal calf serum, and 0.1% NaN3).
Cells (5x105) were then incubated on ice with 20 µL of
the appropriate monoclonal antibody. The antibodies used were a gift
from Dr Marion Schneider, Immunologisches Labor,
Heinrich-Heine-Universität, Düsseldorf, Germany. After 30
minutes the cells were washed and resuspended in 20 µL of FACS buffer
containing 0.5 µg of FITC-labeled goat anti-mouse IgG and incubated
for 30 minutes on ice in the dark. One milliliter of FACS buffer was
added, and the cells were centrifuged, washed with 1 mL of FACS
buffer, and resuspended in 250 µL of FACS buffer. To assess
nonspecific binding of the FITC-IgG, one aliquot of the cells was
incubated in the absence of the monoclonal antibodies. The cells were
then analyzed on a FACScan equipped with an argon ion laser and
linked to a Hewlett-Packard computer. The 488-nm line of the laser, run
at an output power of 0.2 W, was used for excitation. FITC
fluorescence was measured at 520 to 540 nm (FL1). The
acquisition number of the cells was set to 1x104.
Forward-scatter versus side-scatter gates were set to exclude dead
cells. Fluorescence signals were recorded to produce a
histogram of the gated monocytes versus relative fluorescence
intensity after logarithmic amplification. The results were expressed
in mean fluorescence of the gated monocytes in the FL1 channel.
Mean fluorescence values were transformed into a linear scale
by the software of the flow cytometer.
Quantitative RT-PCR Analysis of Fuc-TVII
Quantitative RT-PCR was carried out essentially as previously
described.26 Briefly, competitor RNA for Fuc-TVII was
obtained by in vitro transcription from a DNA fragment template having
the same sequence as the Fuc-TVII product, except for the addition
of a 20-bp sequence in the middle and of a 5' extension of the coding
strand corresponding to the promoter sequence of T7 RNA polymerase.
Increasing amounts (0.1 to 5.0 pg) of this competitor were added to 300
ng of macrophage RNA. The mixture was reverse transcribed and
amplified using previously published forward (CACCTCCGAGGCATCTTCAACTG)
and reverse (CGTTGGTATCGGCTCTCATTCATG) primers.27 PCR was
performed at 94°C for 2 minutes, followed by five cycles of 94°C
for 30 seconds, 60°C for 1 minute, and 72°C for 2 minutes, followed
by 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, and 72°C
for 2 minutes, followed by one cycle of 72°C for 5 minutes. The
amplification products were resolved on a 2.5% agarose gel,
detected by ethidium bromide staining, and quantified by densitometric
scanning.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture and Loading With Modified Lipoproteins
After 14 days in culture the phenotype of the cells changed from that of circulating monocytes to that of mature macrophages with a decrease in the expression of the monocyte markers CD14, CD64, and CD4 and an increase in the macrophage markers HLA-DR and CD16 (not shown). In addition, the cells gained the ability to phagocytose latex particles (not shown) and grew in size to a variable extent. The 14-day-old monocyte-derived macrophages internalized both AcLDL and OxLDL. Incubation of the cells with 80 µg/mL AcLDL for 48 hours increased the intracellular cholesteryl ester from a virtually unmeasurable baseline value to 460±30 µg/mg cell protein (mean±SD). An increase of 60% in the free cholesterol concentration from 220±10 to 350±10 µg/mg cell protein also occurred (Fig 1
). Incubation of the cells for 48 hours
with 80 µg/mL OxLDL did not produce intracellular cholesteryl
ester accumulation but increased the free cholesterol
content by 80% to 400±10 µg/mg cell protein (Fig 1). This
concentration of OxLDL did not produce appreciable cell toxicity as
assessed by standardized counts of the number of adherent cells (data
not shown). The cholesterol and cholesteryl ester
concentrations of the control and loaded cells were compared using an
unpaired Student's t test. Because of the increased
sensitivity of the high-performance liquid
chromatography method used, the concentrations of
intracellular free cholesterol and cholesteryl ester
reported here are markedly higher than those generally reported in the
literature.28 29
|
Differential Display
Differential display revealed the presence of a band 306 bp in
size in the control (unloaded) cells (Fig 2, lane
1) that disappeared completely after the
cells were loaded with AcLDL (Fig 2, lane 2) and that was noticeably
fainter after the cells were loaded with OxLDL (Fig 2, lane 3). On
excision, secondary amplification, cloning, and sequencing, this band
was revealed to be a cDNA fragment 306 bp in length with 100% homology
to human ELAM-1 ligand fucosyltransferase, also known as Fuc-TIV (Fig 3).
|
|
Northern Blot Analysis
Northern blotting in the control (unloaded) cells with a probe
generated by PCR amplification of the differentially expressed band
revealed a major band of 2.3 kb and a minor band of 6.0 kb,
corresponding to published data on Fuc-TIV18 (Fig 4, lane
1). In the Northern blot of
poly(A)+ RNA isolated from cells that had been loaded with
80 µg/mL OxLDL for 48 hours, the major 2.3-kb band was reduced
in relative intensity by a factor of 3, and the 6.0-kb band was no
longer visible (Fig 4, lane 2). In the blot of poly(A)+ RNA
isolated from the cells that had been loaded with 80 µg/mL
AcLDL, the 2.3-kb band corresponding to Fuc-TIV was reduced in
relative intensity by a factor of 20, and the 6.0-kb band was no longer
visible (Fig 4, lane 3). Thus, Northern blot analysis confirmed
the results of the differential display experiment, showing a moderate
downregulation of Fuc-TIV in the OxLDL-loaded cells and a marked
downregulation in the AcLDL-loaded cells. Northern blot
analysis of RNA from cells loaded for 48 hours with 20, 40,
and 80 µg AcLDL/mL cell culture medium showed a dose-dependent
downregulation of the Fuc-TIV mRNA (Fig 5).
|
|
Assessment of -(1,3)-Fucosyltransferase Activity in Cell
Extracts
Analysis of the -(1,3)-fucosyltransferase in cell
extracts using N-acetyllactosamine as an acceptor showed a
reduction in transfer activity of approximately 50% in both the AcLDL-
and OxLDL-loaded cells (unloaded cells, 40.4±5.3 pmol fucose
transferred/mg cell protein · h-1 [mean±SD];
AcLDL-loaded cells, 22.7±1.3 pmol/mg cell protein ·
h-1; and OxLDL-loaded cells, 23.4±1.5 pmol/mg cell
protein · h-1) (Fig 6).
|
Quantitative RT-PCR Analysis of Fuc-TVII
Analysis of the concentration of Fuc-TVII mRNA by
quantitative RT-PCR showed that the expression of this gene is also
downregulated by loading of the cells by both AcLDL and OxLDL (unloaded
cells, 4.6x106 molecules Fuc-TVII mRNA/µg total RNA;
AcLDL-loaded cells, 2.8x106 molecules Fuc-TVII mRNA/µg
total RNA; and OxLDL-loaded cells, 3.8x106 molecules
Fuc-TVII/µg total RNA). The results of this experiment are shown in
Fig 7.
|
Surface Expression of Lewis X and Sialyl Lewis X
Freshly isolated peripheral blood monocytes, unloaded
monocyte-derived CD14+ macrophages (after 14 days
in culture), and CD14+ macrophages that had been
exposed for 48 hours to 80 µg/mL OxLDL or 80 µg/mL
AcLDL were analyzed for surface expression of CD15 (thought to
correspond to the Lewis X antigen) and CD15s (thought to correspond to
the sialyl Lewis X antigen). Loading of the cells with either AcLDL or
OxLDL was associated with a reduction in CD15 expression of 84% or
16%, respectively, and a reduction in CD15s expression of 34% or
19%, respectively (Fig 8).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We used PCR-based differential display to isolate differentially expressed cDNA species in human monocyte-derived macrophages loaded with AcLDL or OxLDL. This led to the isolation of a cDNA with 100% homology to Fuc-TIV, also known as ELAM-1 ligand-specific fucosyltransferase. Fuc-TIV is one of a family of
-(1,3)-fucosyltransferases that synthesize oligosaccharides
called Lewis antigens, in which fucose is -(1,3) or -(1,4) linked
to the subterminal and/or internal N-acetyllactosamine
residues on glycolipids or glycoproteins. Fuc-TIV is
expressed in cells of the myeloid lineage18 30 31 32 33 and has
also been detected in all tissues of 5 to 10-week-old human embryos,
suggesting that it may play a role in cell adhesion during
development.33
Differential display and Northern blot analysis revealed a
threefold downregulation of Fuc-TIV mRNA on loading of the cells with
OxLDL and a dose-dependent (maximum, 20-fold) downregulation on loading
of the cells with AcLDL. Measurement of the activity of
-(1,3)-fucosyltransferase in cell lysates also showed downregulation
by approximately 50% in both AcLDL- and OxLDL-loaded
macrophages (Fig 6
).
On analysis by flow cytometry, the expression of CD15 (Lewis X) was reduced by 84% in the AcLDL-loaded cells and by 16% in the OxLDL-loaded cells. This finding agrees with those of both differential display and Northern blot analysis showing a more marked downregulation of Fuc-TIV on loading with AcLDL compared with loading with OxLDL.
In the biosynthesis of the sialyl Lewis X structure, sialylation must
precede fucosylation because the -3-sialyltransferase is known not
to act on fucosylated substrates.34 Cells of the myeloid
lineage, which includes peripheral blood monocytes, have
recently been shown to contain a second -(1,3)-fucosyltransferase,
Fuc-TVII, in addition to Fuc-TIV.27 35 Fuc-TVII shares
40% homology with Fuc-TIV.27 35 Fuc-TIV transfers fucose
readily onto H type 2 (Fuc1
2Galß1 4GlcNacR)
trisaccharide acceptors and, to a lesser extent, onto
sialyl-N-acetyllactosamine. Thus, Fuc-TIV is capable of
synthesizing both the Lewis X and sialyl Lewis X antigens on the
monocyte and macrophage surfaces. Fuc-TVII also synthesizes
sialyl Lewis X but appears to be incapable of synthesizing Lewis X (Fig 9).35 It is not known at present which of these two
enzymes is primarily responsible for synthesizing sialyl Lewis X on
macrophages in vivo. Data from in vitro transfection
experiments are confusing because the nature of fucosylated antigens
expressed depends critically on the glycosylation phenotype of
the host cell.36 Expression of CD15s (sialyl Lewis X) was
reduced by 19% and 34% in AcLDL- and OxLDL-loaded foam cells,
respectively. This may have been due to the observed downregulation in
Fuc-TIV, but because expression of Fuc-TVII mRNA was also reduced in
our cells (Fig 7), our data cannot provide information on the
contributions of Fuc-TIV and Fuc-TVII to sialyl Lewis X synthesis and
expression in macrophages. The nearly identical drop in total
fucosyltransferase activity (Fig 6) and sialyl Lewis X expression
between AcLDL- and OxLDL-loaded cells may suggest that multiple
fucosyltransferases exist that are collectively downregulated to a
similar extent after treatment with AcLDL and OxLDL.
|
Loading of monocyte-derived macrophages with AcLDL produced a
much greater degree of cholesteryl ester storage than loading with
OxLDL (Fig 1), and Fuc-TIV was downregulated to a much greater extent
in AcLDL-loaded than in OxLDL-loaded cells. In addition, Fuc-TIV
downregulation in AcLDL-loaded cells showed dose dependency in relation
to loading with AcLDL (Fig 5). Thus, it is possible that the level of
expression of Fuc-TIV within the cells is related to the degree of
intracellular cholesteryl ester storage, although our experiments do
not exclude the possibility that other factors in AcLDL unrelated to
its capacity to produce cholesteryl ester storage may affect Fuc-TIV
transcription and expression in a dose-dependent manner.
Sialyl Lewis X (CD15s) is the ligand for E-selectin (also known as ELAM-1) and P-selectin21 37 38 39 and also binds L-selectin.40 Lewis X has been shown to bind to itself.41 42 It has also been proposed that Lewis X also binds to P-selectin in a weak manner.43 The process by which circulating monocytes leave the bloodstream and enter the vessel wall proceeds in two stages, the first of which, capture and rolling, is mediated by selectins expressed by activated endothelial cells.44 It is not known to what extent selectin-mediated binding contributes to cell adhesion within the arterial wall.
To our knowledge, this is the first report showing alteration in the expression of Fuc-TIV, Fuc-TVII, and cell surface adhesion molecules during foam cell development. As noted in the introduction, it has been reported that foam cells may leave the subendothelial space and enter the circulation,16 thus removing chemically modified lipoproteins from the arterial wall and slowing lesion progression. It is possible that the downregulation of Fuc-TIV and Fuc-TVII and the modulation of adhesion molecules shown in our experiments may play a role in this process. A second possibility is that reduced expression of selectin ligands on the cell surface may hinder reuptake by the arterial wall of circulating foam cells that have left the subendothelial space. Such mechanisms, should they be shown to be operative in vivo, would be of particular interest because of their potential for pharmacological manipulation by means of externally administered compounds that interfere with selectin-mediated binding.45 46 47 48 49 50 51
|
Selected Abbreviations and Acronyms |
|---|
|
|
Acknowledgments |
|---|
This work was supported by grant Cu 31/2-1 to Dr Cullen from the Deutsche Forschungsgemeinschaft. We are indebted to Karin Tegelkamp for her expert technical assistance. We are also grateful to Professor Karl Müller, Institut für Allgemeine Zoologie, University of Münster, and to Andrea Hötte and Dr Frans van Valen, Institut für Experimentelle Orthopädie, University of Münster, for helpful advice and criticism and in particular for help with the FACS analysis. We thank Heiko Wiebusch and Dr Harald Funke, Institut für Arterioskleroseforschung, University of Münster, for assistance with the automated DNA sequencing.
Received September 9, 1996; accepted November 11, 1996.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791-804.[Medline] [Order article via Infotrieve]
2. Schaffner T, Taylor K, Bartucci EJ, et al. Arterial foam cells with distinctive immunomorphologic and histochemical features of macrophages. Am J Pathol. 1980;100:57-80.[Abstract]
3. Klurfeld DM. Identification of foam cells in human atherosclerotic lesions as macrophages using monoclonal antibodies. Arch Pathol Lab Med. 1985;109:445-449.[Medline] [Order article via Infotrieve]
4. Brown MS, Goldstein JL. Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Annu Rev Biochem. 1983;52:223-261.[Medline] [Order article via Infotrieve]
5.
Brown MS, Goldstein JL, Krieger M, Ho, Anderson
RG. Reversible accumulation of cholesteryl esters in
macrophages incubated with acetylated
lipoproteins. J Cell Biol. 1979;82:597-613.
6.
Brown MS, Ho YK, Goldstein JL. The cholesteryl
ester cycle in macrophage foam cells: continual hydrolysis and
re-esterification of cytoplasmic cholesteryl esters.
J Biol Chem. 1980;255:9344-9352.
7.
Bottalico LA, Keesler GA, Fless GM, Tabas I.
Cholesterol loading of macrophages leads to marked
enhancement of native lipoprotein(a) and apoprotein(a) internalization
and degradation. J Biol Chem. 1993;268:8569-8573.
8.
Mazzone T, Lopez C, Bergstraesser L.
Modification of very low density lipoproteins leads to
macrophage scavenger receptor uptake and cholesteryl ester
deposition. Arteriosclerosis. 1987;7:191-196.
9.
Quinn MT, Parthasarathy S, Fong LG, Steinberg
D. Oxidatively modified low density lipoproteins: a potential
role in recruitment and retention of monocyte/macrophages
during atherogenesis. Proc Natl Acad Sci U S A. 1987;84:2995-2298.
10.
Goldstein JL, Ho YK, Basu SK, Brown MS. Binding
site on macrophages that mediates uptake and degradation of
acetylated low density lipoprotein, producing massive
cholesterol deposition. Proc Natl Acad Sci
U S A. 1979;76:333-337.
11.
Ottnad E, Parthasarathy S, Sambrano GR, et al. A
macrophage receptor for oxidized low density lipoprotein
distinct from the receptor for acetyl low density-lipoprotein—partial
purification and role in recognition of oxidatively damaged cells.
Proc Natl Acad Sci U S A. 1995;92:1391-1395.
12.
Krieger M, Acton S, Ashkenas J, Pearson A, Penman M,
Resnick D. Molecular flypaper, host defense, and
atherosclerosis: structure, binding properties, and
functions of macrophage scavenger receptors.
J Biol Chem. 1993;268:4569-4572.
13. Krieger M, Herz J. Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Annu Rev Biochem. 1994;63:601-637.[Medline] [Order article via Infotrieve]
14. Witztum JL, Steinberg D. Role of oxidized low density lipoprotein in atherogenesis. J Clin Invest. 1991;88:1785-1792.
15. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801-809.[Medline] [Order article via Infotrieve]
16.
Faggiotto A, Ross R, Harker L. Studies of
hypercholesterolemia in the nonhuman primate,
I: Changes that lead to fatty streak formation.
Arteriosclerosis. 1984;4:323-340.
17.
Liang P, Pardee AB. Differential display of
eukaryotic messenger RNA by means of the polymerase chain
reaction. Science. 1992;257:967-971.
18. Goelz SE, Hession C, Goff D, et al. ELFT: a gene that directs the expression of an ELAM-1 ligand. Cell. 1990;63:1349-1356.[Medline] [Order article via Infotrieve]
19.
Goelz S, Kumar R, Potvin B, Sundaram S, Brickelmaier M,
Stanley P. Differential expression of an E-selectin ligand
[SLe(X)] by two Chinese hamster ovary cell lines transfected with the
same (1,3)fucosyltransferase gene (ELFT). J Biol
Chem. 1994;269:1033-1040.
20.
Sueyoshi S, Tsuboi S, Sawadahirai R, Dang UN, Lowe JB,
Fukuda M. Expression of distinct fucosylated
oligosaccharides and carbohydrate-mediated adhesion efficiency
directed by 2 different -1,3- fucosyltransferases—comparison of
E-selectin-mediated and L-selectin-mediated adhesion.
J Biol Chem. 1994;269:32342-32350.
21. Lowe JB, Stoolman LM, Nair RP, Larsen RD, Behrend TL, Marks RM. ELAM 1-dependent cell adhesion to vascular endothelium determined by a transfected human fucosyl transferase cDNA. Cell. 1990;63:475-484.[Medline] [Order article via Infotrieve]
22. Schmitz G, Beuck M, Fischer H, Nowicka G, Robenek H. Regulation of phospholipid biosynthesis during cholesterol influx and high density lipoprotein-mediated cholesterol efflux in macrophages. J Lipid Res. 1990;31:1741-1752.[Abstract]
22A. Cullen P, Fobker M, Tegelkamp K, Meyer K, Kannenberg F, Cignarella A, Benninghoven A, Assmann G. An improved method for the quantification of cholesterol and cholesteryl esters in human monocyte-derived macrophages by high performance liquid chromatography with identification of unassigned cholesteryl ester species by means of secondary ion mass spectrometry. J Lipid Res. 1997;38:401-409.[Abstract]
23. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]
24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410.[Medline] [Order article via Infotrieve]
25.
Rajan VP, Larsen RD, Ajmera S, Ernst LK, Lowe
JB. A cloned human DNA restriction fragment determines
expression of a GDP-L-fucose:ß-D-galactoside
2--L-fucosyltransferase in transfected cells: evidence for isolation
and transfer of the human H blood group locus. J
Biol Chem. 1989;264:11158-11167.
26.
Grassi G, Zentilin L, Tafuro S, et al. A rapid
procedure for the quantitation of low abundance RNAs by competitive
reverse transcription-polymerase chain reaction. Nucleic Acids
Res. 1994;22:4547-4549.
27.
Sasaki K, Kurata K, Funayama K, et al. Expression
cloning of a novel -1,3-fucosyl-transferase that is involved in
biosynthesis of the sialyl-Lewis-X carbohydrate determinants in
leukocytes. J Biol Chem. 1994;269:14730-14737.
28. Maor I, Aviram M. Oxidized low density lipoprotein leads to macrophage accumulation of unesterified cholesterol as a result of lysosomal trapping of the lipoprotein hydrolyzed cholesteryl ester. J Lipid Res. 1994;35:803-819.[Abstract]
29. Keidar S, Aviram M, Maor I, Oiknine J, Brook JG. Pravastatin inhibits cellular cholesterol synthesis and increases low density lipoprotein receptor activity in macrophages—in vitro and in vivo studies. Br J Clin Pharmacol. 1994;38:513-519.[Medline] [Order article via Infotrieve]
30. Mollicone R, Cailleau A, Oriol R. Molecular genetics of H, Se, Lewis and other fucosyltransferase genes. Transfus Clin Biol. 1995;2:235-242.[Medline] [Order article via Infotrieve]
31.
Reguigne I, James MR, Richard CW, et al. The gene
encoding myeloid -3-fucosyltransferase(FUT4) is located between
d11s388 and d11s919 on 11q21. Cytogenet Cell Genet. 1994;66:104-106.[Medline]
[Order article via Infotrieve]
32.
Mollicone R, Gibaud A, François A, Ratcliffe M,
Oriol R. Acceptor specificity and tissue distribution of three
human -3-fucosyltransferases. Eur J Biochem. 1990;191:169-176.[Medline]
[Order article via Infotrieve]
33.
Mollicone R, Candelier JJ, Mennesson B, Couillin P,
Venot AP, Oriol R. Five specificity patterns of
(1,3)--L-fucosyl-transferase activity defined by use of synthetic
oligosaccharide acceptors—differential expression of the
enzymes during human embryonic development and in adult
tissues. Carbohydr Res. 1992;228:265-276.[Medline]
[Order article via Infotrieve]
34.
Holmes EH, Ostrander GK, Hakomori S-I.
Biosynthesis of the sialyl-Lex determinant by type 2 chain
glycosphingolipids
(IV3NeuAcIII3FucnLc4,
VI3NeuAcV3FucnLc6, and
VI3NeuAcIII3-V3Fuc2
nLc6) in human lung carcinoma PC9 cells.
J Biol Chem. 1986;261:3737-3743.
35.
Natsuka S, Gersten KM, Zenita K, Kannagi R, Lowe
JB. Molecular cloning of a cDNA encoding a novel human leukocyte
-1,3-fucosyltransferase capable of synthesizing the sialyl Lewis-X
determinant. J Biol Chem. 1994;269:16789-16794.
36. Natsuka S, Lowe JB. Enzymes involved in mammalian oligosaccharide biosynthesis. Curr Opin Struct Biol. 1994;4:683-691.
37. Phillips ML, Nudelman E, Graeta FCA, et al. ELAM-1 mediated cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science. 1991;250:1130-1132.
38.
Walz G, Aruffo A, Kolanus W, Bevilacqua M, Seed
B. Recognition by ELAM-1 of the sialyl-Lex
determinant on myeloid and tumor cells. Science. 1990;250:1132-1135.
39.
Polley MJ, Phillips ML, Wayner E, et al. CD62 and
endothelial cell-leukocyte adhesion molecule 1 (ELAM-1)
recognize the same carbohydrate ligand, sialyl-Lewis X.
Proc Natl Acad Sci U S A. 1991;88:6224-6228.
40.
Imai Y, Lasky LA, Rosen SD. Further
characterization of the interaction between L-selectin and its
endothelial ligands. Glycobiology. 1992;2:373-381.
41.
Eggens I, Fenderson B, Joyokuni T, Dean B, Stroud M,
Hakomori S. Specific interaction between Lex and
Lex determinants. J Biol Chem. 1989;264:9476-9484.
42. Siuzdak G, Ichikawa Y, Caufield TJ, Munoz B, Wong C-H, Nicoloau KC. Evidence of a Ca2+-dependent carbohydrate association through ion spray mass spectrometry. J Am Chem Soc. 1993;115:2877-2881.
43. Hakomori S. Lex and related structures as adhesion molecules. Histochem J. 1992;24:771-776.[Medline] [Order article via Infotrieve]
44.
Luscinskas FW, Kansas GS, Ding H, et al. Monocyte
rolling, arrest and spreading on Il-4-activated vascular
endothelium under flow is mediated via sequential
action of L- selectin, beta(1)-integrins, and beta(2)-integrins.
J Cell Biol. 1994;125:1417-1427.
45. Nematalla A, Abbas S, Nashed MA, Peng CT. Synthesis of a sulfo-Lewis-X analog. Abstr Pap Am Chem Soc. 1994;208:29-CARB. Abstract.
46. Buerke M, Weyrich AS, Zheng ZL, Gaeta FCA, Forrest MJ, Lefer AM. Sialyl Lewis(x)-containing oligosaccharide attenuates myocardial reperfusion injury in cats. J Clin Invest. 1994;93:1140-1148.
47. Lefer DJ, Flynn DM, Jeffords PR, Vo KD, Buda AJ. A sialyl Lewis(x) containing carbohydrate reduces infarct size following myocardial ischemia and prolonged reperfusion. Circulation. 1995;92:3420.
48.
Kogan TP, Dupre B, Keller KM, et al. Rational design
and synthesis of small-molecule, non-oligosaccharide selectin
inhibitors—(-D-mannopyranosyloxy)biphenyl-substituted
carboxylic acids. J Med Chem. 1995;38:4976-4984.[Medline]
[Order article via Infotrieve]
49. Prodger JC, Bamford MJ, Gore PM, Holmes DS, Saez V, Ward P. Synthesis of a novel analog of sialyl Lewis X. Tetrahedron Lett. 1995;36:2339-2342.
50. Toepfer A, Kretzschmar G, Bartnik E. Synthesis of novel mimetics of the sialyl Lewis X determinant. Tetrahedron Lett. 1995;36:9161-9164.
51. Park JL, Kilgore KS, Musser JH, Lucchesi BR. Reduction of myocardial infarct size in the rabbit by a carbohydrate analog of sialyl Lewis(x). FASEB J. 1995;9:A9.
This article has been cited by other articles:
 |
|
 |
|
  E. Lutgens, E. D. de Muinck, S. Heeneman, and M. J.A.P. Daemen Compensatory Enlargement and Stenosis Develop in ApoE-/- and ApoE*3-Leiden Transgenic Mice Arterioscler Thromb Vasc Biol, August 1, 2001; 21(8): 1359 - 1365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Withers and S.-i. Hakomori Human alpha (1,3)-Fucosyltransferase IV (FUTIV) Gene Expression Is Regulated by Elk-1 in the U937 Cell Line J. Biol. Chem., December 15, 2000; 275(51): 40588 - 40593. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||