Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:1591-1598

This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cullen, P.
Right arrow Articles by Assmann, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cullen, P.
Right arrow Articles by Assmann, G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:1591-1598.)
© 1997 American Heart Association, Inc.


Articles

Downregulation of the Selectin Ligand-Producing Fucosyltransferases Fuc-TIV and Fuc-TVII During Foam Cell Formation in Monocyte-Derived Macrophages

Paul Cullen; Susanne Mohr; Beate Brennhausen; Andrea Cignarella; ; Gerd Assmann

From the Institut für Arterioskleroseforschung (P.C., S.M., B.B., A.C., G.A.), Institut für Allgemeine Zoologie und Genetik (S.M.), and Institut für Klinische Chemie und Laboratoriumsmedizin (G.A.), Westfälische Wilhelms-Universität Münster, Münster, Germany.

Correspondence to Dr Paul Cullen, Institut für Arterioskleroseforschung, Domagkstraße 3, 48149 Münster, Germany. E-mail cullen{at}uni-muenster.de.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Identification of genes expressed during foam cell formation is important for understanding the molecular basis of atherosclerosis. We used polymerase chain reaction (PCR)–based differential display to isolate differentially expressed cDNA species in foam cells induced by incubation of human monocyte-derived macrophages in the presence of acetylated or oxidized LDL. This led to identification of a 306-bp cDNA with 100% homology to type IV fucosyltransferase (Fuc-TIV), which was downregulated by factors of 20 and 3 in acetylated LDL– and oxidized LDL–loaded macrophages, respectively. This enzyme is sufficient for the expression of Lewis X and sialyl Lewis X, carbohydrate adhesion molecules that bind to receptors of the selectin family. Expression of a second fucosyltransferase (Fuc-TVII) that synthesizes sialyl Lewis X but not Lewis X was shown by quantitative reverse transcription–PCR to also be reduced, by 40% and 20% in acetylated LDL– and oxidized LDL–loaded macrophages, respectively. {alpha}-(1,3)-Fucosyltransferase enzyme activity was reduced in lysates from both acetylated LDL– and oxidized LDL–loaded cells. Analysis by flow cytometry showed reduced expression of the CD15 (corresponding to Lewis X) and CD15s (sialyl Lewis X) antigens on the surface of cells loaded with either acetylated or oxidized LDL. Transformation of macrophages into foam cells results in reduced expression of selectin-binding ligands on the surface of such cells.


Key Words: atherosclerosis • monocyte-derived macrophages • foam cells • differential display • fucosyltransferase IV


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
One of the most characteristic features of atherosclerotic lesions is the accumulation of foam cells.1 Previous work has shown that most of these foam cells are of macrophage origin and develop from circulating monocytes that enter the subendothelial space of the arterial wall.2 3 4 The foamy appearance of their cytoplasm is due to the intracellular accumulation of droplets of cholesteryl ester.5 6 A portion of the cholesterol in such macrophages is either synthesized de novo, internalized as lipoprotein (a),7 or taken up as VLDL or LDL via the LDL receptor. However, most of this cholesterol probably originates from cell detritus ingested during phagocytosis and from chemically modified lipoproteins taken up via the scavenger receptor and the putative receptor for OxLDL.8 9 10 11 Whereas the uptake of cholesterol via the LDL receptor is subject to tightly regulated negative feedback, no such control exists over the uptake of LDL via the scavenger or putative OxLDL receptors.12 13

To be recognized by the scavenger or OxLDL receptors, LDL must undergo chemical modification, a process that probably occurs in the microenvironment of the subendothelial space.14 Such chemically modified LDL acts as an irritant. For example, many of the compounds found in OxLDL are highly reactive and have cytotoxic effects.15 The formation of foam cells is also associated with the production of numerous immune mediators that further intensify the inflammatory process.15 On the other hand, subendothelial macrophages may serve a protective function by neutralizing reactive modified lipoproteins. It has also been reported that cholesterol-loaded macrophages may exit from the atherosclerotic plaque, a process that may slow progression of the lesion.16 Thus, it is unclear at present whether the process of macrophage-derived foam cell formation promotes or retards the development of atherosclerosis.

To investigate this question we examined the pattern of gene expression during AcLDL- and OxLDL-induced foam cell formation in vitro using PCR-based differential display of mRNA as described by Liang and Pardee.17 This technique uses a combination of arbitrary and anchored primers to generate a set of 3' fragments from cDNA derived from the total mRNA of a cell and represents a considerable advance in the method of differential cDNA hybridization. These experiments led to isolation of a cDNA with 100% homology to Fuc-TIV, which was downregulated on loading of the cells with AcLDL and, to a lesser extent, OxLDL. Some,18 19 though not all,20 21 previous studies have suggested that Fuc-TIV is sufficient for the expression of Lewis X, the carbohydrate ligand for the selectin family of adhesion. Investigation by quantitative RT-PCR showed that expression of Fuc-TVII, which synthesizes sialyl Lewis X but not Lewis X, was also reduced in loaded cells. Thus, the transformation of macrophages into foam cells may modulate the adhesive properties of such cells.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Monocyte Isolation and Culture
Monocytapheresis and phlebology procedures were approved by the University of Münster ethics committee. White blood cells from healthy volunteers were obtained by monocytapheresis using a CS3000 cell separator. The monocytes were separated by countercurrent centrifugation in an elutriation chamber as described by Schmitz et al.22 Aliquots of the fractions were examined for their purity using a forward-scatter versus a side-scatter plot in a FACScan. Fractions containing more than 95% monocytes were pooled. The cells were plated at a density of 106 cells/mL in 35-mm cell culture dishes in RPMI 1640 and incubated at 37°C in a humidified incubator (5% CO2). After 1 hour, when the monocytes had adhered to the surface of the dishes, the nonadherent cells were removed by washing. The monocytes were then cultured for 14 days in RPMI 1640 supplemented with 20% human serum obtained from healthy volunteers.

Preparation of AcLDL and OxLDL
LDL (d=1.019 to 1.063 g/mL) was acetylated by repeated additions of acetic anhydride as previously described.5 AcLDL showed enhanced mobility on agarose gel electrophoresis at pH 8.6. OxLDL was prepared by incubation of LDL with 10 µmol/L CuSO4 for 6 hours at 37°C. The reaction was then stopped by placing the preparation on ice and addition of 2 mmol/L EDTA. The OxLDL was copiously dialyzed for 16 hours against 0.9% NaCl alternated with 0.9% NaCl supplemented with 5 mmol/L EDTA. All preparations of OxLDL showed a concentration of thiobarbituric acid–reacting substances of between 50 and 100 nmol/mg LDL protein. Monocyte-derived macrophages were incubated for 48 hours with 80 µg of OxLDL/mL culture medium. Cellular cholesterol and cholesteryl ester content was determined by reverse-phase high-performance liquid chromatography using a method developed in our laboratory.22A

PCR-Based Differential Display
Differential display was performed using a commercially available kit and a standard protocol. Total cellular RNA was isolated as follows: The cell monolayer (approximately 1.5x107 cells) was washed with PBS and then flooded with 2 mL of an acid guanidinium thiocyanate solution. The RNA was extracted with phenol/chloroform as described by Chomczynski and Sacchi.23 DNA-free RNA was obtained using a MessageClean(TM) kit and checked for integrity by agarose gel electrophoresis.

Nine single-stranded cDNA synthesis reactions were then performed using the following oligonucleotide primers: T12AA, -AC, -AG, -CA, -CC, -CG, -GA, -GC, or -GG according to a standard protocol (cDNA synthesis kit). PCR was then performed in reaction mixtures containing 0.1 vol of reverse transcription reaction mixture; 1xPCR buffer; 2 µmol/L each of dGTP, dATP, dTTP, and dCTP; 10 µCi 35S-dATP; 1 µmol/L of the respective T12NN oligonucleotide primer; 0.2 µmol/L of the specific arbitrary 10-mer oligonucleotide; and 2.5 units of AmpliTaq DNA polymerase using 40 cycles of 94°C for 30 seconds, 40°C for 60 seconds, and 72°C for 60 seconds, followed by 72°C for 5 minutes. Loading buffer was added to the samples, which were heated at 80°C for 2 minutes before they were loaded onto 6% denaturing polyacrylamide sequencing gels. After electrophoresis, the gels were exposed to Kodak XAR-5 film for 48 hours. To avoid identification of spurious changes in the band pattern (false positives), all experiments were performed in duplicate, and corresponding PCR products from each reaction were loaded in adjacent lanes.

Band Recovery, Reamplification, and Cloning of cDNAs
Bands showing differential expression were cut out, and DNA was eluted by boiling in 100 µL of H2O for 10 minutes. The DNA was reamplified by PCR using appropriate primers and the conditions described above, except for dNTP concentrations, which were changed to 20 µmol/L, and the absence of radioisotope. The PCR product was visualized on a 2% agarose gel, eluted, and used as a probe for Northern blot analysis or cloned into the pUC 18 Sma I/BAP vector for sequencing using the Sure Clone(TM) ligation kit. DNA sequencing was performed on an automatic laser fluorescent analyzer using the AutoRead(TM) sequencing kit. Sequence database searching was carried out using the BLAST program.24

Northern Blot Analysis
Poly(A)+ RNA (2 µg) was isolated from total RNA using magnetic beads, size fractionated on formaldehyde-denaturing 1% agarose gels, and transferred to a positively charged nylon membrane with 20xSSC by capillary transfer according to standard methods. After UV cross-linking, blots were prehybridized for 1 hour at 50°C in DIG Easy Hyb and then hybridized in DIG Easy Hyb for 16 to 24 hours at 50°C with digoxigenin-labeled probes prepared by random priming using a commercially available kit. After hybridization, blots were washed twice with 2xSSC supplemented with 0.1% SDS for 15 minutes at room temperature, followed by two washes with 0.5xSSC supplemented with 0.1% SDS for 5 minutes at 68°C. For chemiluminescent detection the membranes were incubated with a dilution of anti-digoxigenin Fab fragments conjugated to alkaline phosphatase. The blots were then incubated with the chemiluminescent substrate CDP-Star(TM) and exposed to Kodak XAR-5 film for 3 minutes. Lane-loading differences were normalized with a probe directed against the mRNA of the housekeeping gene GAPDH.

Measurement of {alpha}-(1,3)-Fucosyltransferase Activity
The fucosyltransferase assay with low-molecular-weight acceptor substances was performed as described previously.18 Briefly, cells were washed and harvested in PBS before pelleting by centrifugation. Cell extracts were prepared by resuspending the cell pellets in 1% Triton X-100 such that the final protein concentration in the extracts was approximately 5 mg/mL (Lowry assay). The fucosyltransferase assay was performed in 50 mmol/L MOPS (pH 6.5), 25 mmol/L MnCl2, 10 mmol/L L-fucose, 5 mmol/L ATP, 3 µmol/L GDP-[14C]fucose (specific activity, 600 000 cpm/nmol), 20 mmol/L acceptor (N-acetyllactosamine), and up to 10 µL of cell extract in a final volume of 20 µL. Reactions were incubated at 37°C for 2 hours and terminated by the addition of 20 µL of ethanol, followed by dilution with 500 µL of H2O. The reaction was then centrifuged at 15 000xg for 5 minutes. Fifty microliters of the reaction supernatant was counted to determine total radioactivity, and 200 µL was fractionated by Dowex-L chromatography as described by Rajan et al.25 The neutral radiolabeled material eluting from the column was counted directly as a measure of product formation. Parallel reactions were done in the absence of added acceptor to allow correction for transfer to endogenous acceptor molecules and for substrate and product hydrolysis. These control experiments indicated that less than 5% of the radioactivity of GDP-[14C]fucose was found as a neutral product in the absence of an acceptor.

Flow Cytometry
Cells were harvested from a confluent T75 culture flask using 5 mmol/L EDTA in PBS, centrifuged, and resuspended in FACS buffer (PBS, 3% fetal calf serum, and 0.1% NaN3). Cells (5x105) were then incubated on ice with 20 µL of the appropriate monoclonal antibody. The antibodies used were a gift from Dr Marion Schneider, Immunologisches Labor, Heinrich-Heine-Universität, Düsseldorf, Germany. After 30 minutes the cells were washed and resuspended in 20 µL of FACS buffer containing 0.5 µg of FITC-labeled goat anti-mouse IgG and incubated for 30 minutes on ice in the dark. One milliliter of FACS buffer was added, and the cells were centrifuged, washed with 1 mL of FACS buffer, and resuspended in 250 µL of FACS buffer. To assess nonspecific binding of the FITC-IgG, one aliquot of the cells was incubated in the absence of the monoclonal antibodies. The cells were then analyzed on a FACScan equipped with an argon ion laser and linked to a Hewlett-Packard computer. The 488-nm line of the laser, run at an output power of 0.2 W, was used for excitation. FITC fluorescence was measured at 520 to 540 nm (FL1). The acquisition number of the cells was set to 1x104. Forward-scatter versus side-scatter gates were set to exclude dead cells. Fluorescence signals were recorded to produce a histogram of the gated monocytes versus relative fluorescence intensity after logarithmic amplification. The results were expressed in mean fluorescence of the gated monocytes in the FL1 channel. Mean fluorescence values were transformed into a linear scale by the software of the flow cytometer.

Quantitative RT-PCR Analysis of Fuc-TVII
Quantitative RT-PCR was carried out essentially as previously described.26 Briefly, competitor RNA for Fuc-TVII was obtained by in vitro transcription from a DNA fragment template having the same sequence as the Fuc-TVII product, except for the addition of a 20-bp sequence in the middle and of a 5' extension of the coding strand corresponding to the promoter sequence of T7 RNA polymerase. Increasing amounts (0.1 to 5.0 pg) of this competitor were added to 300 ng of macrophage RNA. The mixture was reverse transcribed and amplified using previously published forward (CACCTCCGAGGCATCTTCAACTG) and reverse (CGTTGGTATCGGCTCTCATTCATG) primers.27 PCR was performed at 94°C for 2 minutes, followed by five cycles of 94°C for 30 seconds, 60°C for 1 minute, and 72°C for 2 minutes, followed by 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, and 72°C for 2 minutes, followed by one cycle of 72°C for 5 minutes. The amplification products were resolved on a 2.5% agarose gel, detected by ethidium bromide staining, and quantified by densitometric scanning.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Cell Culture and Loading With Modified Lipoproteins
After 14 days in culture the phenotype of the cells changed from that of circulating monocytes to that of mature macrophages with a decrease in the expression of the monocyte markers CD14, CD64, and CD4 and an increase in the macrophage markers HLA-DR and CD16 (not shown). In addition, the cells gained the ability to phagocytose latex particles (not shown) and grew in size to a variable extent. The 14-day-old monocyte-derived macrophages internalized both AcLDL and OxLDL. Incubation of the cells with 80 µg/mL AcLDL for 48 hours increased the intracellular cholesteryl ester from a virtually unmeasurable baseline value to 460±30 µg/mg cell protein (mean±SD). An increase of 60% in the free cholesterol concentration from 220±10 to 350±10 µg/mg cell protein also occurred (Fig 1Down). Incubation of the cells for 48 hours with 80 µg/mL OxLDL did not produce intracellular cholesteryl ester accumulation but increased the free cholesterol content by 80% to 400±10 µg/mg cell protein (Fig 1Down). This concentration of OxLDL did not produce appreciable cell toxicity as assessed by standardized counts of the number of adherent cells (data not shown). The cholesterol and cholesteryl ester concentrations of the control and loaded cells were compared using an unpaired Student's t test. Because of the increased sensitivity of the high-performance liquid chromatography method used, the concentrations of intracellular free cholesterol and cholesteryl ester reported here are markedly higher than those generally reported in the literature.28 29



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Intracellular cholesterol and cholesteryl ester accumulation in human monocyte-derived macrophages. Cholesterol and cholesteryl ester content of 14-day-old monocyte-derived macrophages incubated for 48 hours in RPMI 1640 cell culture medium alone (unloaded) or RPMI 1640 containing 80 µg/mL AcLDL or 80 µg/mL OxLDL (mean±SD; *P<.01 compared with unloaded cells; **P<.001 compared with unloaded cells; n=5).

Differential Display
Differential display revealed the presence of a band 306 bp in size in the control (unloaded) cells (Fig 2Down, lane 1) that disappeared completely after the cells were loaded with AcLDL (Fig 2Down, lane 2) and that was noticeably fainter after the cells were loaded with OxLDL (Fig 2Down, lane 3). On excision, secondary amplification, cloning, and sequencing, this band was revealed to be a cDNA fragment 306 bp in length with 100% homology to human ELAM-1 ligand fucosyltransferase, also known as Fuc-TIV (Fig 3Down).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. Differential display PCR. Amplification by differential display PCR of cDNA isolated from 14-day-old human monocyte-derived macrophages incubated for 48 hours in the presence of RPMI 1640 cell culture medium alone (lane 1), RPMI 1640 containing 80 µg/mL AcLDL (lane 2), or 80 µg/mL OxLDL (lane 3). The arrow indicates a band that is present in the control cells, absent from the cells loaded with AcLDL, and weakly present in the cells loaded with OxLDL. This band was cut out and amplified as described in "Methods."



View larger version (58K):
[in this window]
[in a new window]
 
Figure 3. Identification of Fuc-TIV cDNA. Output of BLAST program24 showing 100% homology (P=8.5x10-120) between the cDNA fragment of 306 bp isolated by differential display (cDNA) and the published sequence of Fuc-TIV18 (P=8.5x10-120).

Northern Blot Analysis
Northern blotting in the control (unloaded) cells with a probe generated by PCR amplification of the differentially expressed band revealed a major band of 2.3 kb and a minor band of 6.0 kb, corresponding to published data on Fuc-TIV18 (Fig 4Down, lane 1). In the Northern blot of poly(A)+ RNA isolated from cells that had been loaded with 80 µg/mL OxLDL for 48 hours, the major 2.3-kb band was reduced in relative intensity by a factor of 3, and the 6.0-kb band was no longer visible (Fig 4Down, lane 2). In the blot of poly(A)+ RNA isolated from the cells that had been loaded with 80 µg/mL AcLDL, the 2.3-kb band corresponding to Fuc-TIV was reduced in relative intensity by a factor of 20, and the 6.0-kb band was no longer visible (Fig 4Down, lane 3). Thus, Northern blot analysis confirmed the results of the differential display experiment, showing a moderate downregulation of Fuc-TIV in the OxLDL-loaded cells and a marked downregulation in the AcLDL-loaded cells. Northern blot analysis of RNA from cells loaded for 48 hours with 20, 40, and 80 µg AcLDL/mL cell culture medium showed a dose-dependent downregulation of the Fuc-TIV mRNA (Fig 5Down).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. Analysis of expression of Fuc-TIV mRNA in control and loaded cells by Northern blotting. Poly(A)+ RNA was isolated from 14-day-old human monocyte-derived macrophages incubated for 48 hours in the presence of RPMI 1640 cell culture medium alone (lane 1) or RPMI 1640 containing 80 µg/mL OxLDL (lane 2) or 80 µg/mL AcLDL (lane 3). Two micrograms of RNA was separated by denaturing gel electrophoresis and analyzed by Northern blotting using the Fuc-TIV differential display PCR fragment as a probe. The upper arrow indicates a faint band of 6.0 kb, and the lower arrow, a band of 2.3 kb. Lane-loading differences were normalized using a probe directed against the mRNA of the housekeeping gene GAPDH.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 5. Dose-dependent suppression of Fuc-TIV mRNA expression. Total RNA was isolated from 14-day-old human monocyte-derived macrophages that had been incubated for 48 hours in the presence of RPMI 1640 cell culture medium alone (control, lane 1) or RPMI 1640 supplemented with 20 µg/mL (lane 2), 40 µg/mL (lane 3), or 80 µg/mL AcLDL (lane 4). Twenty micrograms of total RNA was separated by denaturing gel electrophoresis and analyzed by Northern blotting using the Fuc-TIV differential display PCR fragment as a probe. The band shown is the major band of 2.3 kb corresponding to Fuc-TIV (see Fig 4Up). Lane-loading differences were normalized using a probe directed against the mRNA of the housekeeping gene GAPDH.

Assessment of {alpha}-(1,3)-Fucosyltransferase Activity in Cell Extracts
Analysis of the {alpha}-(1,3)-fucosyltransferase in cell extracts using N-acetyllactosamine as an acceptor showed a reduction in transfer activity of approximately 50% in both the AcLDL- and OxLDL-loaded cells (unloaded cells, 40.4±5.3 pmol fucose transferred/mg cell protein · h-1 [mean±SD]; AcLDL-loaded cells, 22.7±1.3 pmol/mg cell protein · h-1; and OxLDL-loaded cells, 23.4±1.5 pmol/mg cell protein · h-1) (Fig 6Down).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 6. Analysis of {alpha}-(1,3)-fucosyltransferase activity in macrophage extracts. Extracts were examined from control (unloaded) macrophages and from macrophages that had been incubated with 80 µg/mL AcLDL or 80 µg OxLDL for 48 hours. N-Acetyllactosamine was used as an acceptor in each case. The assay is described in "Methods" (n=6; mean±SD; *P<.01).

Quantitative RT-PCR Analysis of Fuc-TVII
Analysis of the concentration of Fuc-TVII mRNA by quantitative RT-PCR showed that the expression of this gene is also downregulated by loading of the cells by both AcLDL and OxLDL (unloaded cells, 4.6x106 molecules Fuc-TVII mRNA/µg total RNA; AcLDL-loaded cells, 2.8x106 molecules Fuc-TVII mRNA/µg total RNA; and OxLDL-loaded cells, 3.8x106 molecules Fuc-TVII/µg total RNA). The results of this experiment are shown in Fig 7Down.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Results of quantitative RT-PCR of Fuc-TVII in monocyte-derived macrophages. The assay was performed as described in "Methods." The photograph shows the amplification products of control cells (left), cells after 48 hours of incubation in the presence of 80 µg/mL AcLDL (center), or cells after 48 hours of incubation in the presence of 80 µg/mL OxLDL (right). The numbers refer to decreasing concentrations of competitor added as follows: 1 indicates 6.3x107 molecules; 2, 1.3x107 molecules; 3, 6.3x106 molecules; 4, 2.6x106 molecules; and 5, 1.3x106 molecules. The bands corresponding to the competitor (516 bp) and native Fuc-TVII (496 bp) are as indicated. For each amplification the ratio between the intensities of the bands evaluated by densitometric scanning was plotted against the amount of competitor added. The points are fitted to a straight line, and the concentration of competitor corresponding to a competitor/transcript ratio of 1 (equivalence point) is read off the graph. At this point, the concentrations of competitor and Fuc-TVII mRNA are equal.

Surface Expression of Lewis X and Sialyl Lewis X
Freshly isolated peripheral blood monocytes, unloaded monocyte-derived CD14+ macrophages (after 14 days in culture), and CD14+ macrophages that had been exposed for 48 hours to 80 µg/mL OxLDL or 80 µg/mL AcLDL were analyzed for surface expression of CD15 (thought to correspond to the Lewis X antigen) and CD15s (thought to correspond to the sialyl Lewis X antigen). Loading of the cells with either AcLDL or OxLDL was associated with a reduction in CD15 expression of 84% or 16%, respectively, and a reduction in CD15s expression of 34% or 19%, respectively (Fig 8Down).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 8. Flow cytometry of surface antigens of freshly isolated human monocytes and monocyte-derived macrophages. A, Representative FL1 frequency distributions of freshly isolated monocytes analyzed for the surface expression of CD15 and CD15s. The "GAM" histogram represents the fluorescence of the nonspecifically bound FITC-labeled goat–anti-mouse IgG; the x axis indicates fluorescence in arbitrary units on a logarithmic scale, and the y axis, the number of cells. B, 14-day-old monocyte-derived macrophages were incubated for 48 hours in the presence of RPMI 1640 cell culture medium alone or RPMI 1640 containing 80 µg/mL AcLDL or 80 µg/mL OxLDL. After this period the cells were harvested, and the CD14+ cells were analyzed for their surface expression of CD15 and CD15s. *P<.05; **P<.01; n=5.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We used PCR-based differential display to isolate differentially expressed cDNA species in human monocyte-derived macrophages loaded with AcLDL or OxLDL. This led to the isolation of a cDNA with 100% homology to Fuc-TIV, also known as ELAM-1 ligand-specific fucosyltransferase. Fuc-TIV is one of a family of {alpha}-(1,3)-fucosyltransferases that synthesize oligosaccharides called Lewis antigens, in which fucose is {alpha}-(1,3) or {alpha}-(1,4) linked to the subterminal and/or internal N-acetyllactosamine residues on glycolipids or glycoproteins. Fuc-TIV is expressed in cells of the myeloid lineage18 30 31 32 33 and has also been detected in all tissues of 5 to 10-week-old human embryos, suggesting that it may play a role in cell adhesion during development.33

Differential display and Northern blot analysis revealed a threefold downregulation of Fuc-TIV mRNA on loading of the cells with OxLDL and a dose-dependent (maximum, 20-fold) downregulation on loading of the cells with AcLDL. Measurement of the activity of {alpha}-(1,3)-fucosyltransferase in cell lysates also showed downregulation by approximately 50% in both AcLDL- and OxLDL-loaded macrophages (Fig 6Up).

On analysis by flow cytometry, the expression of CD15 (Lewis X) was reduced by 84% in the AcLDL-loaded cells and by 16% in the OxLDL-loaded cells. This finding agrees with those of both differential display and Northern blot analysis showing a more marked downregulation of Fuc-TIV on loading with AcLDL compared with loading with OxLDL.

In the biosynthesis of the sialyl Lewis X structure, sialylation must precede fucosylation because the {alpha}-3-sialyltransferase is known not to act on fucosylated substrates.34 Cells of the myeloid lineage, which includes peripheral blood monocytes, have recently been shown to contain a second {alpha}-(1,3)-fucosyltransferase, Fuc-TVII, in addition to Fuc-TIV.27 35 Fuc-TVII shares 40% homology with Fuc-TIV.27 35 Fuc-TIV transfers fucose readily onto H type 2 (Fuc{alpha}1->2Galß1-> 4GlcNac->R) trisaccharide acceptors and, to a lesser extent, onto sialyl-N-acetyllactosamine. Thus, Fuc-TIV is capable of synthesizing both the Lewis X and sialyl Lewis X antigens on the monocyte and macrophage surfaces. Fuc-TVII also synthesizes sialyl Lewis X but appears to be incapable of synthesizing Lewis X (Fig 9Down).35 It is not known at present which of these two enzymes is primarily responsible for synthesizing sialyl Lewis X on macrophages in vivo. Data from in vitro transfection experiments are confusing because the nature of fucosylated antigens expressed depends critically on the glycosylation phenotype of the host cell.36 Expression of CD15s (sialyl Lewis X) was reduced by 19% and 34% in AcLDL- and OxLDL-loaded foam cells, respectively. This may have been due to the observed downregulation in Fuc-TIV, but because expression of Fuc-TVII mRNA was also reduced in our cells (Fig 7Up), our data cannot provide information on the contributions of Fuc-TIV and Fuc-TVII to sialyl Lewis X synthesis and expression in macrophages. The nearly identical drop in total fucosyltransferase activity (Fig 6Up) and sialyl Lewis X expression between AcLDL- and OxLDL-loaded cells may suggest that multiple fucosyltransferases exist that are collectively downregulated to a similar extent after treatment with AcLDL and OxLDL.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 9. Scheme showing postulated contributions of Fuc-TIV and Fuc-TVII to the synthesis of Lewis X and sialyl Lewis X.

Loading of monocyte-derived macrophages with AcLDL produced a much greater degree of cholesteryl ester storage than loading with OxLDL (Fig 1Up), and Fuc-TIV was downregulated to a much greater extent in AcLDL-loaded than in OxLDL-loaded cells. In addition, Fuc-TIV downregulation in AcLDL-loaded cells showed dose dependency in relation to loading with AcLDL (Fig 5Up). Thus, it is possible that the level of expression of Fuc-TIV within the cells is related to the degree of intracellular cholesteryl ester storage, although our experiments do not exclude the possibility that other factors in AcLDL unrelated to its capacity to produce cholesteryl ester storage may affect Fuc-TIV transcription and expression in a dose-dependent manner.

Sialyl Lewis X (CD15s) is the ligand for E-selectin (also known as ELAM-1) and P-selectin21 37 38 39 and also binds L-selectin.40 Lewis X has been shown to bind to itself.41 42 It has also been proposed that Lewis X also binds to P-selectin in a weak manner.43 The process by which circulating monocytes leave the bloodstream and enter the vessel wall proceeds in two stages, the first of which, capture and rolling, is mediated by selectins expressed by activated endothelial cells.44 It is not known to what extent selectin-mediated binding contributes to cell adhesion within the arterial wall.

To our knowledge, this is the first report showing alteration in the expression of Fuc-TIV, Fuc-TVII, and cell surface adhesion molecules during foam cell development. As noted in the introduction, it has been reported that foam cells may leave the subendothelial space and enter the circulation,16 thus removing chemically modified lipoproteins from the arterial wall and slowing lesion progression. It is possible that the downregulation of Fuc-TIV and Fuc-TVII and the modulation of adhesion molecules shown in our experiments may play a role in this process. A second possibility is that reduced expression of selectin ligands on the cell surface may hinder reuptake by the arterial wall of circulating foam cells that have left the subendothelial space. Such mechanisms, should they be shown to be operative in vivo, would be of particular interest because of their potential for pharmacological manipulation by means of externally administered compounds that interfere with selectin-mediated binding.45 46 47 48 49 50 51


*    Selected Abbreviations and Acronyms
 
AcLDL = acetylated LDL
ELAM = endothelial leukocyte adhesion molecule
FACS = fluorescence-activated cell scanning
Fuc-TIV = type IV {alpha}-(1,3)-fucosyltransferase
Fuc-TVII = type VII {alpha}-(1,3)-fucosyltransferase
GAPDH = reduced glyceraldehyde-phosphate dehydrogenase
IgG = immunoglobulin G
OxLDL = oxidized LDL
PCR = polymerase chain reaction
RT-PCR = reverse transcription polymerase chain reaction


*    Acknowledgments
 
This work was supported by grant Cu 31/2-1 to Dr Cullen from the Deutsche Forschungsgemeinschaft. We are indebted to Karin Tegelkamp for her expert technical assistance. We are also grateful to Professor Karl Müller, Institut für Allgemeine Zoologie, University of Münster, and to Andrea Hötte and Dr Frans van Valen, Institut für Experimentelle Orthopädie, University of Münster, for helpful advice and criticism and in particular for help with the FACS analysis. We thank Heiko Wiebusch and Dr Harald Funke, Institut für Arterioskleroseforschung, University of Münster, for assistance with the automated DNA sequencing.

Received September 9, 1996; accepted November 11, 1996.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791-804.[Medline] [Order article via Infotrieve]

2. Schaffner T, Taylor K, Bartucci EJ, et al. Arterial foam cells with distinctive immunomorphologic and histochemical features of macrophages. Am J Pathol. 1980;100:57-80.[Abstract]

3. Klurfeld DM. Identification of foam cells in human atherosclerotic lesions as macrophages using monoclonal antibodies. Arch Pathol Lab Med. 1985;109:445-449.[Medline] [Order article via Infotrieve]

4. Brown MS, Goldstein JL. Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Annu Rev Biochem. 1983;52:223-261.[Medline] [Order article via Infotrieve]

5. Brown MS, Goldstein JL, Krieger M, Ho, Anderson RG. Reversible accumulation of cholesteryl esters in macrophages incubated with acetylated lipoproteins. J Cell Biol. 1979;82:597-613.[Abstract/Free Full Text]

6. Brown MS, Ho YK, Goldstein JL. The cholesteryl ester cycle in macrophage foam cells: continual hydrolysis and re-esterification of cytoplasmic cholesteryl esters. J Biol Chem. 1980;255:9344-9352.[Free Full Text]

7. Bottalico LA, Keesler GA, Fless GM, Tabas I. Cholesterol loading of macrophages leads to marked enhancement of native lipoprotein(a) and apoprotein(a) internalization and degradation. J Biol Chem. 1993;268:8569-8573.[Abstract/Free Full Text]

8. Mazzone T, Lopez C, Bergstraesser L. Modification of very low density lipoproteins leads to macrophage scavenger receptor uptake and cholesteryl ester deposition. Arteriosclerosis. 1987;7:191-196.[Abstract/Free Full Text]

9. Quinn MT, Parthasarathy S, Fong LG, Steinberg D. Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during atherogenesis. Proc Natl Acad Sci U S A. 1987;84:2995-2298.[Abstract/Free Full Text]

10. Goldstein JL, Ho YK, Basu SK, Brown MS. Binding site on macrophages that mediates uptake and degradation of acetylated low density lipoprotein, producing massive cholesterol deposition. Proc Natl Acad Sci U S A. 1979;76:333-337.[Abstract/Free Full Text]

11. Ottnad E, Parthasarathy S, Sambrano GR, et al. A macrophage receptor for oxidized low density lipoprotein distinct from the receptor for acetyl low density-lipoprotein—partial purification and role in recognition of oxidatively damaged cells. Proc Natl Acad Sci U S A. 1995;92:1391-1395.[Abstract/Free Full Text]

12. Krieger M, Acton S, Ashkenas J, Pearson A, Penman M, Resnick D. Molecular flypaper, host defense, and atherosclerosis: structure, binding properties, and functions of macrophage scavenger receptors. J Biol Chem. 1993;268:4569-4572.[Free Full Text]

13. Krieger M, Herz J. Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Annu Rev Biochem. 1994;63:601-637.[Medline] [Order article via Infotrieve]

14. Witztum JL, Steinberg D. Role of oxidized low density lipoprotein in atherogenesis. J Clin Invest. 1991;88:1785-1792.

15. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801-809.[Medline] [Order article via Infotrieve]

16. Faggiotto A, Ross R, Harker L. Studies of hypercholesterolemia in the nonhuman primate, I: Changes that lead to fatty streak formation. Arteriosclerosis. 1984;4:323-340.[Abstract/Free Full Text]

17. Liang P, Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science. 1992;257:967-971.[Abstract/Free Full Text]

18. Goelz SE, Hession C, Goff D, et al. ELFT: a gene that directs the expression of an ELAM-1 ligand. Cell. 1990;63:1349-1356.[Medline] [Order article via Infotrieve]

19. Goelz S, Kumar R, Potvin B, Sundaram S, Brickelmaier M, Stanley P. Differential expression of an E-selectin ligand [SLe(X)] by two Chinese hamster ovary cell lines transfected with the same {alpha}(1,3)fucosyltransferase gene (ELFT). J Biol Chem. 1994;269:1033-1040.[Abstract/Free Full Text]

20. Sueyoshi S, Tsuboi S, Sawadahirai R, Dang UN, Lowe JB, Fukuda M. Expression of distinct fucosylated oligosaccharides and carbohydrate-mediated adhesion efficiency directed by 2 different {alpha}-1,3- fucosyltransferases—comparison of E-selectin-mediated and L-selectin-mediated adhesion. J Biol Chem. 1994;269:32342-32350.[Abstract/Free Full Text]

21. Lowe JB, Stoolman LM, Nair RP, Larsen RD, Behrend TL, Marks RM. ELAM 1-dependent cell adhesion to vascular endothelium determined by a transfected human fucosyl transferase cDNA. Cell. 1990;63:475-484.[Medline] [Order article via Infotrieve]

22. Schmitz G, Beuck M, Fischer H, Nowicka G, Robenek H. Regulation of phospholipid biosynthesis during cholesterol influx and high density lipoprotein-mediated cholesterol efflux in macrophages. J Lipid Res. 1990;31:1741-1752.[Abstract]

22A. Cullen P, Fobker M, Tegelkamp K, Meyer K, Kannenberg F, Cignarella A, Benninghoven A, Assmann G. An improved method for the quantification of cholesterol and cholesteryl esters in human monocyte-derived macrophages by high performance liquid chromatography with identification of unassigned cholesteryl ester species by means of secondary ion mass spectrometry. J Lipid Res. 1997;38:401-409.[Abstract]

23. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline] [Order article via Infotrieve]

24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410.[Medline] [Order article via Infotrieve]

25. Rajan VP, Larsen RD, Ajmera S, Ernst LK, Lowe JB. A cloned human DNA restriction fragment determines expression of a GDP-L-fucose:ß-D-galactoside 2-{alpha}-L-fucosyltransferase in transfected cells: evidence for isolation and transfer of the human H blood group locus. J Biol Chem. 1989;264:11158-11167.[Abstract/Free Full Text]

26. Grassi G, Zentilin L, Tafuro S, et al. A rapid procedure for the quantitation of low abundance RNAs by competitive reverse transcription-polymerase chain reaction. Nucleic Acids Res. 1994;22:4547-4549.[Free Full Text]

27. Sasaki K, Kurata K, Funayama K, et al. Expression cloning of a novel {alpha}-1,3-fucosyl-transferase that is involved in biosynthesis of the sialyl-Lewis-X carbohydrate determinants in leukocytes. J Biol Chem. 1994;269:14730-14737.[Abstract/Free Full Text]

28. Maor I, Aviram M. Oxidized low density lipoprotein leads to macrophage accumulation of unesterified cholesterol as a result of lysosomal trapping of the lipoprotein hydrolyzed cholesteryl ester. J Lipid Res. 1994;35:803-819.[Abstract]

29. Keidar S, Aviram M, Maor I, Oiknine J, Brook JG. Pravastatin inhibits cellular cholesterol synthesis and increases low density lipoprotein receptor activity in macrophages—in vitro and in vivo studies. Br J Clin Pharmacol. 1994;38:513-519.[Medline] [Order article via Infotrieve]

30. Mollicone R, Cailleau A, Oriol R. Molecular genetics of H, Se, Lewis and other fucosyltransferase genes. Transfus Clin Biol. 1995;2:235-242.[Medline] [Order article via Infotrieve]

31. Reguigne I, James MR, Richard CW, et al. The gene encoding myeloid {alpha}-3-fucosyltransferase(FUT4) is located between d11s388 and d11s919 on 11q21. Cytogenet Cell Genet. 1994;66:104-106.[Medline] [Order article via Infotrieve]

32. Mollicone R, Gibaud A, François A, Ratcliffe M, Oriol R. Acceptor specificity and tissue distribution of three human {alpha}-3-fucosyltransferases. Eur J Biochem. 1990;191:169-176.[Medline] [Order article via Infotrieve]

33. Mollicone R, Candelier JJ, Mennesson B, Couillin P, Venot AP, Oriol R. Five specificity patterns of (1,3)-{alpha}-L-fucosyl-transferase activity defined by use of synthetic oligosaccharide acceptors—differential expression of the enzymes during human embryonic development and in adult tissues. Carbohydr Res. 1992;228:265-276.[Medline] [Order article via Infotrieve]

34. Holmes EH, Ostrander GK, Hakomori S-I. Biosynthesis of the sialyl-Lex determinant by type 2 chain glycosphingolipids (IV3NeuAcIII3FucnLc4, VI3NeuAcV3FucnLc6, and VI3NeuAcIII3-V3Fuc2 nLc6) in human lung carcinoma PC9 cells. J Biol Chem. 1986;261:3737-3743.[Abstract/Free Full Text]

35. Natsuka S, Gersten KM, Zenita K, Kannagi R, Lowe JB. Molecular cloning of a cDNA encoding a novel human leukocyte {alpha}-1,3-fucosyltransferase capable of synthesizing the sialyl Lewis-X determinant. J Biol Chem. 1994;269:16789-16794.[Abstract/Free Full Text]

36. Natsuka S, Lowe JB. Enzymes involved in mammalian oligosaccharide biosynthesis. Curr Opin Struct Biol. 1994;4:683-691.

37. Phillips ML, Nudelman E, Graeta FCA, et al. ELAM-1 mediated cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science. 1991;250:1130-1132.

38. Walz G, Aruffo A, Kolanus W, Bevilacqua M, Seed B. Recognition by ELAM-1 of the sialyl-Lex determinant on myeloid and tumor cells. Science. 1990;250:1132-1135.[Abstract/Free Full Text]

39. Polley MJ, Phillips ML, Wayner E, et al. CD62 and endothelial cell-leukocyte adhesion molecule 1 (ELAM-1) recognize the same carbohydrate ligand, sialyl-Lewis X. Proc Natl Acad Sci U S A. 1991;88:6224-6228.[Abstract/Free Full Text]

40. Imai Y, Lasky LA, Rosen SD. Further characterization of the interaction between L-selectin and its endothelial ligands. Glycobiology. 1992;2:373-381.[Abstract/Free Full Text]

41. Eggens I, Fenderson B, Joyokuni T, Dean B, Stroud M, Hakomori S. Specific interaction between Lex and Lex determinants. J Biol Chem. 1989;264:9476-9484.[Abstract/Free Full Text]

42. Siuzdak G, Ichikawa Y, Caufield TJ, Munoz B, Wong C-H, Nicoloau KC. Evidence of a Ca2+-dependent carbohydrate association through ion spray mass spectrometry. J Am Chem Soc. 1993;115:2877-2881.

43. Hakomori S. Lex and related structures as adhesion molecules. Histochem J. 1992;24:771-776.[Medline] [Order article via Infotrieve]

44. Luscinskas FW, Kansas GS, Ding H, et al. Monocyte rolling, arrest and spreading on Il-4-activated vascular endothelium under flow is mediated via sequential action of L- selectin, beta(1)-integrins, and beta(2)-integrins. J Cell Biol. 1994;125:1417-1427.[Abstract/Free Full Text]

45. Nematalla A, Abbas S, Nashed MA, Peng CT. Synthesis of a sulfo-Lewis-X analog. Abstr Pap Am Chem Soc. 1994;208:29-CARB. Abstract.

46. Buerke M, Weyrich AS, Zheng ZL, Gaeta FCA, Forrest MJ, Lefer AM. Sialyl Lewis(x)-containing oligosaccharide attenuates myocardial reperfusion injury in cats. J Clin Invest. 1994;93:1140-1148.

47. Lefer DJ, Flynn DM, Jeffords PR, Vo KD, Buda AJ. A sialyl Lewis(x) containing carbohydrate reduces infarct size following myocardial ischemia and prolonged reperfusion. Circulation. 1995;92:3420.

48. Kogan TP, Dupre B, Keller KM, et al. Rational design and synthesis of small-molecule, non-oligosaccharide selectin inhibitors—({alpha}-D-mannopyranosyloxy)biphenyl-substituted carboxylic acids. J Med Chem. 1995;38:4976-4984.[Medline] [Order article via Infotrieve]

49. Prodger JC, Bamford MJ, Gore PM, Holmes DS, Saez V, Ward P. Synthesis of a novel analog of sialyl Lewis X. Tetrahedron Lett. 1995;36:2339-2342.

50. Toepfer A, Kretzschmar G, Bartnik E. Synthesis of novel mimetics of the sialyl Lewis X determinant. Tetrahedron Lett. 1995;36:9161-9164.

51. Park JL, Kilgore KS, Musser JH, Lucchesi BR. Reduction of myocardial infarct size in the rabbit by a carbohydrate analog of sialyl Lewis(x). FASEB J. 1995;9:A9.




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E. Lutgens, E. D. de Muinck, S. Heeneman, and M. J.A.P. Daemen
Compensatory Enlargement and Stenosis Develop in ApoE-/- and ApoE*3-Leiden Transgenic Mice
Arterioscler Thromb Vasc Biol, August 1, 2001; 21(8): 1359 - 1365.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Withers and S.-i. Hakomori
Human alpha (1,3)-Fucosyltransferase IV (FUTIV) Gene Expression Is Regulated by Elk-1 in the U937 Cell Line
J. Biol. Chem., December 15, 2000; 275(51): 40588 - 40593.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cullen, P.
Right arrow Articles by Assmann, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cullen, P.
Right arrow Articles by Assmann, G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH