Articles |
From the Department of Medicine, University of Kuopio (Finland).
Correspondence to Markku Laakso, MD, Department of Medicine, University of Kuopio, 70210 Kuopio, Finland. E-mail markku.laakso{at}uku.fi
| Abstract |
|---|
|
|
|---|
Thr) in codon 54, GTA to GTG in codon 118, and GCGCA to GCACA in the 3'-noncoding region. Frequencies of these variants did not differ between the patients and control subjects. The Ala to Thr substitution in codon 54 was associated with a high lipid oxidation rate (P=.011 after adjustment for sex and family relationship), high HDL triglycerides (P=.042), and high LDL triglycerides (P=.013) but not with insulin resistance in subjects from FCHL families. The FABP2 gene is unlikely to be a major gene for FCHL, but it might affect lipid metabolism in subjects with FCHL.
Key Words: fatty acid binding protein 2 familial combined hyperlipidemia insulin resistance
| Introduction |
|---|
|
|
|---|
The intestinal FABP2 is an intracellular protein expressed only in the columnar absorptive epithelial cells of the small intestinal villus. The protein contains a single ligand binding site that has a high affinity for saturated and unsaturated fatty acids and has a role in the absorption and intracellular transport of long-chain fatty acids.12 In nondiabetic Pima Indians the codon 54 (Ala
Thr) polymorphism was associated with a high fat oxidation rate and insulin resistance.13
Because the genetic basis of insulin resistance in FCHL is unknown, we screened the entire coding region of the FABP2 gene by SSCP analysis in 24 patients with FCHL and in 40 healthy men. Furthermore, we studied the association of the codon 54 polymorphism of this gene with insulin resistance and lipid and lipoprotein levels in 58 family members of patients with FCHL.
| Methods |
|---|
|
|
|---|
Initial Screening
Twenty-four probands from families with FCHL and 40 control subjects randomly drawn from a population of 82 healthy men15 were screened for the FABP2 gene variants by SSCP analysis. The frequency of amino acid polymorphism in codon 54 of the FABP2 gene was also verified in 24 probands and in all 82 control subjects by restriction fragment length polymorphism analysis.
A total of 24 families with FCHL were included in the study. The probands were either male survivors (n=17) of myocardial infarction at a young age (<55 years) who were first studied in 1978 to 1980 and restudied in 1992 to 1994 or were their first-degree relatives fulfilling the criteria for FCHL (n=7, all women) if the male survivor of myocardial infarction had died before 1992 and could therefore not be restudied in the second examination. The criteria for FCHL were as follows: total cholesterol
7.7 mmol/L and/or total triglycerides
2.2 mmol/L in women and
2.4 mmol/L in men in at least one of the visits. These lipid criteria were based on lipid levels of 250 control subjects from a random population sample who participated in the same study as control families. The cutoff points were 80th percentile for cholesterol and 90th percentile for triglycerides. The 80th percentile for cholesterol was used because of the high cholesterol level among Finns living in eastern Finland. To meet the criteria for FCHL, all probands who were included had to have at least two affected first-degree relatives.
Control subjects (age, 54.0±5.0 years; n=82) were healthy unrelated men from our previous population-based study.15 They had a normal glucose tolerance level according to the World Health Organization criteria,16 and they did not have hypertension or symptoms or signs of coronary heart disease. All probands and control subjects had normal liver, kidney, and thyroid function tests, and none had a history of excessive alcohol intake. Because allele frequency for an autosomal polymorphism should be independent of sex, these healthy male control subjects from a random population sample could be used in estimating the allele frequencies of the variants in the FABP2 gene in the Finnish population.
Additional Screening
To study the association of the previously reported Ala to Thr amino acid substitution in codon 54 of the FABP2 gene with insulin resistance, 14 probands and 44 first-degree relatives underwent the hyperinsulinemic euglycemic clamp study to determine their insulin sensitivity.
Table 1
shows the clinical characteristics of patients with FCHL and their first-degree relatives.
|
Metabolic Studies
On the first day all subjects underwent an oral glucose tolerance test (75 g of glucose) after a 12-hour fast. Subjects were admitted to the metabolic ward for 1 day on a separate occasion for the euglycemic clamp study.
The degree of insulin resistance was evaluated with the euglycemic clamp technique17 after a 12-hour fast, as previously described.15 After blood was drawn for baseline measurement, a priming dose of insulin (Actrapid 100 IU/mL, Novo Nordisk) was administered during the initial 10 minutes to raise insulin concentration quickly to the desired level, where it was maintained by a continuous insulin infusion of 480 pmol (80 mU)/m2 per minute. Hepatic glucose is completely suppressed. under these study conditions.18 19 Blood glucose was clamped at 5.0 mmol/L for the next 180 minutes by the infusion of 20% glucose at varying rates according to blood glucose measurements performed at 5-minute intervals. The mean value for the last hour was used to calculate the rates of whole body glucose uptake.
Indirect calorimetry was performed with a computerized flow-through canopy gas analyzer system (Deltatrac, Datex), as previously described.20 21 Gas exchange was measured for 30 minutes after a 12-hour fast and during the last 30 minutes of the euglycemic clamp procedure. The first 10 minutes of each measurement were discarded, and the mean value of the last 20 minutes was used in calculations. Protein, glucose, and lipid oxidation rates as well as energy expenditure were calculated according to Ferrannini.22 The rate of nonoxidative glucose disposal during the euglycemic clamp procedure was estimated by subtracting the carbohydrate oxidation rate (as determined by indirect calorimetry during the last 20 minutes of the euglycemic clamp procedure) from the glucose infusion rate.
Informed consent was obtained from all subjects after the purpose and potential risks of the study were explained to them. The protocol was approved by the Ethics Committee of the University of Kuopio and was in accordance with the Helsinki Declaration.
Analytical Methods
Plasma glucose levels in the fasting state as well as blood glucose and plasma lactate levels during the euglycemic clamp procedure were measured by the glucose oxidase method (2300 Stat Plus, Yellow Springs Instrument Co Inc). For the determination of plasma insulin, blood was collected in EDTA-containing tubes, and after centrifugation the plasma was stored at -20°C until the analysis. Plasma insulin concentration was determined by a commercial double-antibody solid-phase radioimmunoassay (Phadeseph Insulin RIA 100, Pharmacia Diagnostics AB). Lipoprotein fractionation was performed by the use of ultracentrifugation and selective precipitation,23 as previously described.8 Cholesterol and triglyceride levels from whole serum and from lipoprotein fractions were assayed by automated enzymatic methods (Boehringer-Mannheim). ApoB was determined by a commercial immunoturbidometric method (Kone Instruments) and serum FFAs by an enzymatic method (Wako Chemicals GmbH). Serum potassium was measured by flame photometry and nonprotein urinary nitrogen by an automated Kjeldahl method.24
SSCP Analysis
DNA was prepared from peripheral blood leukocytes by the proteinase Kphenol-choloroform extraction method. All four exons and the intron-exon junctions of the FABP2 gene were amplified with PCR with the use of primers, as previously reported.13 PCR amplification was conducted in a 10-µL volume containing 50 ng genomic DNA, 5 pmol of each primer, 10 mmol/L Tris-HCl (pH 8.8), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% Triton X-100, 200 µmol/L dNTP, 0.25 U DNA polymerase (Dynazyme DNA polymerase, Finnzymes), and 1.0 µCi
-[32P]dCTP. PCR conditions were denaturation at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 50°C to 55°C for 30 to 45 seconds, and extension at 72°C for 30 to 60 seconds with final extension at 72°C for 4 minutes. SSCP analysis was performed essentially according to the method of Orita et al.25 The method used in our laboratory has been shown to detect all known mutations in the lipoprotein lipase gene.26 For SSCP analysis, PCR products were first diluted 10- to 20-fold with 0.1% SDS and 10 mmol/L EDTA and then diluted (1:1) with loading mix (95% formamide, 20 mmol/L EDTA, 0.05% bromphenol blue, 0.05% xylene cyanole). After denaturation at 98°C for 3 minutes, samples were immediately cooled on ice, and 2 µL of each sample was loaded onto a 6% nondenaturating polyacrylamide gel (acrylamide/N,N-methylene-bis-acrylamide ratio 49:1) containing 10% glycerol. Each sample was run at two different gel temperatures: (1) at 38°C for approximately 4 hours and (2) at 29°C for approximately 5 hours. The gel was autoradiographed overnight at -70°C with intensifying screens.
Direct Sequencing
Genomic DNA from individuals with variant single-strand conformers was used as a template in the amplification reaction as described above (total volume 50 µL, containing 25 pmol of each primer and 1.25 U of Dynazyme DNA polymerase). Amplified segments were purified by electrophoresis on a 1% low-melting-point agarose gel and directly sequenced with the use of Sequenase (US Biochemicals), as previously described.27
Determination of the Frequency of the GCT to ACT Nucleotide Substitution in Codon 54 of the FABP2 Gene
This substitution disrupts the sequence of the unique Hha I restriction site in exon 2. Exon 2 was amplified with PCR in a 20-µL volume containing reagents described above in SSCP analysis. We used the following primers (5' to 3'): FEX2F (forward)=CACTTCCTATGGGATTTGACT and FEX2R (reverse)=TTGGGTAGAAAAATCAAGAATG (product size, 274 bp).13 Amplified segments of exon 2 were digested with Hha I and separated through a 3% agarose gel (NuSieve, FMC BioProducts). PCR products lacking the Hha I restriction site migrated as 274-bp fragments, whereas PCR products containing an intact Hha I site are cleaved into 149-bp and 125-bp fragments.13
Statistical Analysis
All data are presented as mean±SD. Statistical analyses were performed with the SPSS/PC+ programs (SPSS Inc). The frequencies between the study groups were compared with the
2 test. Continuous variables were compared with Student's two-tailed t test. In comparison of two groups, the adjustment for confounding factors was done with ANCOVA. Because of skewed distributions, insulin, VLDL cholesterol, all triglyceride fractions, and FFAs were logarithmically transformed. After logarithmic transformation, each of these variables had a normal distribution.
| Results |
|---|
|
|
|---|
|
The subjects with genotypes of Thr54Thr or Ala54Thr were pooled in analyses concerning the effects of the codon 54 polymorphism of the FABP2 gene on insulin sensitivity and lipid metabolism because of a small number of subjects who were homozygous for the Thr54 allele (n=6). A total of 25 subjects had the genotype Ala54Ala, and 33 subjects had the Thr54 allele. Age (49.2±12.8 versus 53.9±12.2 years) and body mass index (25.8±3.1 versus 25.3±4.5 kg/m2) did not differ between these groups, but sex distribution was different (20 men and 5 women versus 18 men and 15 women; P=.043). Fasting FFA levels as well as fasting lipid oxidation rates were similar in subjects with the Ala54Ala genotype and with the Thr54 allele (Table 3
). However, when the subjects with the genotypes of Thr54Thr, Ala54Thr, and Ala54Ala were compared with respect to fasting lipid oxidation rate after adjustment for sex, the groups differed significantly (1.14±0.21 versus 0.86±0.25 versus 0.81±0.24 mg/kg per minute; P=.008). This difference remained statistically significant even after adjustment for family relationship (P=.011).
|
Insulin resistance determined as the rate of whole body glucose uptake during the last hour of the euglycemic clamp procedure was not different between the groups (53.2±13.4 versus 54.7±15.7 µmol/kg per minute). Similarly, the rates of glucose oxidation and nonoxidation during the last 30 minutes of the clamp study as well as the suppression of FFAs, the rate of lipid oxidation, and energy expenditure during the last 30 minutes of the clamp study did not differ between the groups.
When the results presented in Table 3
with the exception of lipid oxidation rate were compared among the three genotypes (Thr54Thr, Ala54Thr, and Ala54Ala), no statistically significant differences were found.
The subjects with the Thr54 allele had higher sex-adjusted HDL triglycerides (P=.040) and LDL triglycerides (P=.013) than those who had the Ala54Ala genotype (Table 4
). When the results were adjusted, in addition to family relationship the differences in HDL triglycerides (P=.042) and LDL triglycerides (P=.013) still remained statistically significant. We also analyzed these results among affected and nonaffected family members. Family members who had FCHL according to our lipid criteria (n=26) and who had the Thr54 allele (n=17) had 20% higher LDL cholesterol (5.65±1.09 versus 4.71±0.98 mmol/L; P=.053), 27% higher HDL triglyceride (0.28±0.10 versus 0.22±0.04 mmol/L; P=.148), and 34% higher LDL triglyceride (0.58±0.24 versus 0.38±0.16 mmol/L; P=.068) levels than subjects with FCHL and the Ala54Ala genotype (n=9). These trends were not found in nonaffected family members (n=32; 16 subjects had the Thr54 allele and 16 had the Ala54Ala genotype). Compared with the subjects with the Ala54Ala genotype, subjects with the Thr54 allele had 2.7% lower LDL cholesterol (P=.719), 10% higher HDL triglyceride (P=.318), and 21% higher LDL triglyceride (P=.252) levels. No differences in fasting glucose and insulin levels were found between the groups.
|
When the levels of fasting glucose, insulin, and serum lipids and lipoproteins were compared between the three genotypes (Thr54Thr, Ala54Thr, and Ala54Ala), no statistically significant differences were found.
| Discussion |
|---|
|
|
|---|
Thr) may contribute to abnormalities in lipid metabolism in FCHL, although it does not have a significant effect on insulin resistance.
Complex segregation analysis has suggested a major gene effect on apoB28 and on triglycerides29 in FCHL. Although some uncommon variants in the lipoprotein lipase gene26 could cause FCHL, no gene that could explain a major part of this disease has yet been found. We found one novel nucleotide substitution in the 3' noncoding region (A
G) of the FABP2 gene in patients with FCHL. In addition, we found nucleotide substitutions in codon 54 (GCT
ACT) and in codon 118 (GTA
GTG) described previously in Pima Indians.13 Since the frequency of these substitutions and ATT repeat sequence lengths in intron 2 did not differ between the patients with FCHL and control subjects, the possibility that the FAPB2 gene could play a major role in the etiology of FCHL in the Finnish population is very unlikely.
In our study insulin sensitivity was not associated with the codon 54 polymorphism of the FABP2 gene, in contrast to results in nondiabetic Pima Indians.13 The reason for these opposite findings remains unexplained, but the effect of the codon 54 polymorphism on insulin resistance could be population-specific. It is interesting to note that the association of the Thr54 allele and high lipid oxidation rate described in Pima Indians was verified in the present study because fasting lipid oxidation rate differed between subjects with Thr54Thr, Ala54Thr, and Ala54Ala genotypes. The subjects who were homozygous for the Thr54 allele had the highest fasting lipid oxidation rate.
The novel finding in this study was that high HDL triglyceride and high LDL triglyceride levels were found in subjects with the Thr54 allele of the FABP2 gene. Although these associations were rather weak and could therefore also be chance findings, they are theoretically interesting because the Thr54-containing protein has been associated with increased binding of fatty acids13 and therefore might change lipid metabolism. This theory is supported by the association between the Thr54 allele with increased lipid oxidation rate in Pima Indians13 and in the present study. The mechanisms by which codon 54 polymorphism could lead to increased lipid oxidation rate and dyslipidemias is unknown. Because subjects who have FCHL are prone to postprandial lipemia30 31 and because the associations of the Thr54 allele and dyslipidemias tended to be stronger in family members with FCHL, changes in postprandial lipid metabolism could at least in part contribute to dyslipidemias. For example, high levels of postprandial serum FFAs could lead to increased hepatic synthesis of VLDL and apoB,32 dyslipidemias, and insulin resistance.33 However, we did not measure serum FFAs after a normal fat-containing meal.
LDL particles were richer in triglycerides in subjects with the Thr54 allele than in subjects with the Ala54Ala genotype of the FABP2 gene. This compositional change in LDL particles often indicates that LDL is small and dense.34 35 Because small dense LDL particles are associated with FCHL8 ,36 37 and coronary artery disease,38 an atherogenic composition of LDL particles seems to be associated with the Thr54 allele in FCHL. Direct measurement of LDL particle size is needed to confirm this finding.
We conclude that the FABP2 gene is not likely to be a major gene in FCHL. However, the polymorphism in codon 54 of this gene may influence lipid oxidation rate or lipid and lipoprotein levels in subjects with FCHL.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received May 2, 1996; accepted October 14, 1996.
| References |
|---|
|
|
|---|
2. Nikkilä EA, Aro A. A family study of lipids and lipoproteins in coronary heart disease. Lancet. 1973;1:954-958.[Medline] [Order article via Infotrieve]
3. Chait A, Albers JJ, Brunzell JD. Very low density lipoprotein overproduction in genetic forms of hypertriglyceridemia. Eur J Clin Invest. 1980;10:17-22.[Medline] [Order article via Infotrieve]
4. Janus ED, Nicoll AM, Turner PR, Magill P, Lewis B. Kinetic bases of the primary hyperlipidaemias: studies of apolipoprotein turnover in genetically defined subjects. Eur J Clin Invest. 1980;10:161-172.[Medline] [Order article via Infotrieve]
5. Cortner JA, Coates PM, Bennett MJ, Cryer DR, Le NA. Familial combined hyperlipidaemia: use of stable isotopes to demonstrate overproduction of very-low-density lipoprotein apolipoprotein B by the liver. J Inherit Metab Dis. 1991;14:915-922.[Medline] [Order article via Infotrieve]
6.
Venkatesan S, Cullen P, Pacy P, Halliday D, Scott J. Stable isotopes show a direct relation between VLDL apoB overproduction and serum triglyceride levels and indicate a metabolically and biochemically coherent basis for familial combined hyperlipidemia. Arterioscler Thromb. 1993;13:1110-1118.
7. Krauss RM, Albers JJ, Brunzell JD. An apolipoprotein B-enriched low density lipoprotein subspecies in familial combined hyperlipidemia. Clin Res. 1983;31:503a.
8.
Laakso M, Sarlund H, Mykkänen L. Insulin resistance is associated with lipid and lipoprotein abnormalities in subjects with varying degrees of glucose tolerance. Arteriosclerosis. 1990;10:223-231.
9.
Karhapää P, Voutilainen E, Malkki M, Laakso M. Obese men with type IIB hyperlipidemia are insulin resistant. Arterioscler Thromb. 1993;13:1469-1475.
10.
Hunt SC, Wu LL, Hopkins PN, Stults BM, Kuida H, Ramirez ME, Lalouel JM, Williams RR. Apolipoprotein, low density lipoprotein subfraction, and insulin associations with familial combined hyperlipidemia: study of Utah patients with familial dyslipidemic hypertension. Arteriosclerosis. 1989;9:335-344.
11. Reaven GM. The role of insulin resistance and hyperinsulinemia in coronary heart disease. Metab Clin Exp. 1992;41(suppl 1):16-19.
12.
Lowe JB, Sacchettini JC, Laposata M, McQuillan JJ, Gordon JI. Expression of rat intestinal fatty acid-binding protein in Escherichia coli: purification and comparison of ligand binding characteristics with that of Escherichia coli-derived rat liver fatty acid-binding protein. J Biol Chem. 1987;262:5931-5937.
13. Baier LJ, Sacchettini JC, Knowler WC, Eads J, Paolisso G, Tataranni PA, Mochizuki H, Bennett PH, Bogardus C, Prochazka M. An amino acid substitution in the human intestinal fatty acid binding protein is associated with increased fatty acid binding, increased fat oxidation, and insulin resistance. J Clin Invest. 1995;95:1281-1287.
14.
De la Chapelle A. Disease gene mapping in isolated human populations: the example of Finland. J Med Genet. 1993;30:857-865.
15. Haffner SM, Karhapää P, Mykkänen L, Laakso M. Insulin resistance, body fat distribution, and sex hormones in men. Diabetes. 1994;43: 212-219.
16. World Health Organization. Diabetes Mellitus: Report of a WHO Study Group. Geneva, Switzerland: World Health Organization; 1985. Technical Report Series, No. 727.
17.
DeFronzo RA, Tobin JD, Andres R. Glucose clamp technique: a method for quantifying insulin secretion and insulin resistance. Am J Physiol. 1979;237:E214-E223.
18. Karhapää P, Uusitupa M, Voutilainen E, Laakso M. Effects of bezafibrate on insulin sensitivity and glucose tolerance in subjects with familial combined hyperlipidemia. Clin Pharmacol Ther. 1992;52:620-626.[Medline] [Order article via Infotrieve]
19.
Bergman RN, Finegood DT, Ader M. Assessment of insulin sensitivity in vivo. Endocrinol Rev. 1985;5:45-86.
20. Takala J, Keinänen O, Väisänen P, Kari A. Measurement of gas exchange in intensive care: laboratory and clinical validation of a new device. Crit Care Med. 1989;17:1041-1047.[Medline] [Order article via Infotrieve]
21. Laakso M, Uusitupa M, Takala J, Majander H, Reijonen T, Penttilä I. Effects of hypocaloric diet and insulin therapy on metabolic control and mechanisms of hyperglycemia in obese non-insulin-dependent diabetic subjects. Metabolism. 1988;37:1092-1100.[Medline] [Order article via Infotrieve]
22. Ferrannini E. The theoretical bases of indirect calorimetry. Metabolism. 1988;37:287-301.[Medline] [Order article via Infotrieve]
23. Penttilä IM, Voutilainen E, Laitinen P, Juutilainen P. Comparison of different analytical and precipitation methods for the direct estimation of serum high density lipoprotein cholesterol. Scand J Clin Lab Invest. 1984;41:353-360.
24. Hawk PB, Oser BL, Summerson WH. Practical Physiological Chemistry. 12th ed. Toronto, Canada: Blakiston; 1947:814-822.
25.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A. 1989;86:2766-2770.
26.
Nevin DN, Brunzell JD, Deeb SS. The LPL gene in individuals with familial combined hyperlipidemia and decreased LPL activity. Arterioscler Thromb. 1994;14:869-873.
27.
Kretz KA, Carson GS, O'Brien JS. Direct sequencing from low-melt agarose with Sequenase. Nucleic Acids Res. 1989;17:5864.
28.
Jarvik GP, Brunzell JD, Austin MA, Krauss RM, Motulsky AG, Wijsman E. Genetic predictors of FCHL in four large pedigrees: influence of apoB level major locus predicted genotype and LDL subclass phenotype. Arterioscler Thromb. 1994;14:1687-1694.
29.
Cullen P, Farren B, Scott J, Farrall M. Complex segregation analysis provides evidence for a major gene acting on serum triglyceride levels in 55 British families with familial combined hyperlipidemia. Arterioscler Thromb. 1994;14:1233-1249.
30. Castro-Cabezas M, de-Bruin TW, de-Valk HW, Shoulders CC, Jansen H, Erkelens DW. Impaired fatty acid metabolism in familial combined hyperlipidemia: a mechanism associating hepatic apolipoprotein B overproduction and insulin resistance. J Clin Invest. 1993;92:160-168.
31. Cabezas MC, de Bruin TW, Kock LA, Kortlandt W, van Linde-Sibenius-Trip M, Jansen H, Erkelens DW. Simvastatin improves chylomicron remnant removal in familial combined hyperlipidemia without changing chylomicron conversion. Metabolism. 1993;42:497-503.[Medline] [Order article via Infotrieve]
32. Cianflone KM, Yasruel Z, Rodriguez MA, Vas D, Sniderman AD. Regulation of apoB secretion from HepG2 cells: evidence for a critical role for cholesteryl ester synthesis in the response to a fatty acid challenge. J Lipid Res. 1990;31:2045-2055.[Abstract]
33. Randle PJ, Hales CN, Garland PB, Newsholme EA. The glucose fatty acid cycle: its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet. 1963;1:785-789.[Medline] [Order article via Infotrieve]
34. McNamara JR, Jenner JL, Li Z, Wilson PWF, Schaefer EJ. Change in LDL particle size associated with change in plasma triglyceride concentration. Arterioscler Thromb. 1992;12: 1284-1290.
35.
Lagrost L, Gambert P, Lallemant C. Combined effects of lipid transfers and lipolysis on gradient gel patterns of human plasma LDL. Arterioscler Thromb. 1994;14:1327-1336.
36.
Austin MA, Brunzell JD, Fitch WL, Krauss RM. Inheritance of low density lipoprotein subclass patterns in familial combined hyperlipidemia. Arteriosclerosis. 1990;10:520-530.
37.
Hokanson JE, Austin MA, Zambon A, Brunzell JD. Plasma triglyceride and LDL heterogeneity in familial combined hyperlipidemia. Arterioscler Thromb. 1993;13:427-434.
38. Austin MA, Breslow JL, Hennekens CH, Buring JE, Willett WC, Krauss RM. Low-density lipoprotein subclass patterns and risk of myocardial infarction. JAMA. 1988;13:1917-1921.
This article has been cited by other articles:
![]() |
M. Gastaldi, S. Diziere, C. Defoort, H. Portugal, D. Lairon, M. Darmon, and R. Planells Sex-specific association of fatty acid binding protein 2 and microsomal triacylglycerol transfer protein variants with response to dietary lipid changes in the 3-mo Medi-RIVAGE primary intervention study Am. J. Clinical Nutrition, December 1, 2007; 86(6): 1633 - 1641. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Morcillo, G. Rojo-Martinez, F. Cardona, M. de la Cruz Almaraz, M. de la Soledad Ruiz de Adana, I. Esteva, I. Cardona, and F. Soriguer Effect of the interaction between the fatty acid binding protein 2 gene Ala54Thr polymorphism and dietary fatty acids on peripheral insulin sensitivity: a cross-sectional study Am. J. Clinical Nutrition, October 1, 2007; 86(4): 1232 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Martinez-Lopez, B. Ruiz-Madrigal, I. Hernandez-Canaveral, and A. Panduro Association of the T54 allele of the FABP2 gene with cardiovascular risk factors in obese Mexican subjects Diabetes and Vascular Disease Research, September 1, 2007; 4(3): 235 - 236. [Abstract] [PDF] |
||||
![]() |
S. Stan, M. Lambert, E. Delvin, G. Paradis, J. O'Loughlin, J. A. Hanley, and E. Levy Intestinal fatty acid binding protein and microsomal triglyceride transfer protein polymorphisms in French-Canadian youth J. Lipid Res., February 1, 2005; 46(2): 320 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ueno, J. Tremblay, J. Kunes, J. Zicha, Z. Dobesova, Z. Pausova, A. Y. Deng, Y.-L. Sun, H. J. Jacob, and P. Hamet Rat model of familial combined hyperlipidemia as a result of comparative mapping Physiol Genomics, March 12, 2004; 17(1): 38 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Verseyden, S. Meijssen, H. van Dijk, H. Jansen, and M. C. Cabezas Effects of atorvastatin on fasting and postprandial complement component 3 response in familial combined hyperlipidemia J. Lipid Res., November 1, 2003; 44(11): 2100 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Weiss, M. D. Brown, A. R. Shuldiner, and J. M. Hagberg Fatty acid binding protein-2 gene variants and insulin resistance: gene and gene-environment interaction effects Physiol Genomics, September 3, 2002; 10(3): 145 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Meijssen, H. van Dijk, C. Verseyden, D.W. Erkelens, and M. C. Cabezas Delayed and Exaggerated Postprandial Complement Component 3 Response in Familial Combined Hyperlipidemia Arterioscler Thromb Vasc Biol, May 1, 2002; 22(5): 811 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Levy, D. Menard, E. Delvin, S. Stan, G. Mitchell, M. Lambert, E. Ziv, J. C. Feoli-Fonseca, and E. Seidman The Polymorphism at Codon 54 of the FABP2 Gene Increases Fat Absorption in Human Intestinal Explants J. Biol. Chem., October 19, 2001; 276(43): 39679 - 39684. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pihlajamaki, M. Austin, K. Edwards, and M. Laakso A Major Gene Effect on Fasting Insulin and Insulin Sensitivity in Familial Combined Hyperlipidemia Diabetes, October 1, 2001; 50(10): 2396 - 2401. [Abstract] [Full Text] |
||||
![]() |
J. R. Galluzzi, L. A. Cupples, J. B. Meigs, P. W.F. Wilson, E. J. Schaefer, and J. M. Ordovas Association of the Ala54-thr Polymorphism in the Intestinal Fatty Acid-Binding Protein With 2-h Postchallenge Insulin Levels in the Framingham Offspring Study Diabetes Care, July 1, 2001; 24(7): 1161 - 1166. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J Agren, H. M Vidgren, R. S Valve, M. Laakso, and M. I Uusitupa Postprandial responses of individual fatty acids in subjects homozygous for the threonine- or alanine-encoding allele in codon 54 of the intestinal fatty acid binding protein 2 gene Am. J. Clinical Nutrition, January 1, 2001; 73(1): 31 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Pratley, L. Baier, D. A. Pan, A. D. Salbe, L. Storlien, E. Ravussin, and C. Bogardus Effects of an Ala54Thr polymorphism in the intestinal fatty acid-binding protein on responses to dietary fat in humans J. Lipid Res., December 1, 2000; 41(12): 2002 - 2008. [Abstract] [Full Text] |
||||
![]() |
G. VASSILEVA, L. HUWYLER, K. POIRIER, L. B. AGELLON, and M. J. TOTH The intestinal fatty acid binding protein is not essential for dietary fat absorption in mice FASEB J, October 1, 2000; 14(13): 2040 - 2046. [Abstract] [Full Text] |
||||
![]() |
A. Georgopoulos, O. Aras, and M. Y. Tsai Codon-54 Polymorphism of the Fatty Acid-Binding Protein 2 Gene Is Associated with Elevation of Fasting and Postprandial Triglyceride in Type 2 Diabetes J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3155 - 3160. [Abstract] [Full Text] |
||||
![]() |
J. Pihlajamaki, L. Karjalainen, P. Karhapaa, I. Vauhkonen, and M. Laakso Impaired Free Fatty Acid Suppression During Hyperinsulinemia Is a Characteristic Finding in Familial Combined Hyperlipidemia, but Insulin Resistance Is Observed Only in Hypertriglyceridemic Patients Arterioscler Thromb Vasc Biol, January 1, 2000; 20(1): 164 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Agren, R. Valve, H. Vidgren, M. Laakso, and M. Uusitupa Postprandial Lipemic Response Is Modified by the Polymorphism at Codon 54 of the Fatty Acid–Binding Protein 2 Gene Arterioscler Thromb Vasc Biol, October 1, 1998; 18(10): 1606 - 1610. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |