© 1997 American Heart Association, Inc.
Articles |
A 192Arg Variant of the Human Paraoxonase (HUMPONA) Gene Polymorphism Is Associated With an Increased Risk for Coronary Artery Disease in the Japanese
From the Department of Medicine, School of Medicine, Keio University, the Second Department of Medicine, Kyorin University (K.K., N.A., H.Y., K.I.), and Hibiya Medical Center, Sakura Bank (G.W.), Tokyo, Japan.
Correspondence to Mitsuru Murata, MD, Department of Medicine, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160, Japan. E-mail murata{at}mc.med.keio.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract Recent reports have suggested that polymorphisms in the human paraoxonase (HUMPONA) gene may be a genetic risk factor for coronary artery disease (CAD) in white populations. However, this association has not yet been confirmed in other ethnic populations. We studied 75 Japanese patients with CAD, whose coronary lesions were confirmed by angiography, and 115 Japanese control subjects with no history of CAD and a normal resting electrocardiogram. The assays for genotyping the two polymorphisms in the HUMPONA gene (192Arg/Gln and 55Leu/Met) were based on changes in restriction enzyme digestion patterns. For codon 192, the frequencies of the Arg-coding allele (B allele) in both patients and control subjects were much higher than those from published results of whites (.26 to .31), and the difference between patients (.74) and control subjects (.59) was statistically significant (P=.002). The patient group had a higher proportion of Arg/Arg (B/B) homozygotes (52.0% vs 32.2%, P=.006). For codon 55, the frequencies of the Leu-coding allele in control subjects and patients were much higher (.91 and .93, respectively) than those published results for whites, but there was no difference between Japanese control subjects and Japanese patients. When subjects with the 55Leu/Leu genotype only were analyzed, 192Arg/Arg homozygotes were still significantly more frequent in the patients than in the control subjects (55.4% vs 37.2%, P=.024), and the frequency of the 192Arg allele was also higher in patients than control subjects (P=.013). Logistic regression analysis including conventional coronary risk factors revealed that 192Arg is an independent risk factor for CAD. Thus, in the Japanese, the association of CAD with the 192Arg variant of HUMPONA (B-type enzyme) is similar to that reported for whites, although the allele frequencies for 192Arg and 55Leu are much higher in the former than the latter population.
Key Words: paraoxonase • coronary artery disease • genetics • angiography • risk factors
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Human paraoxonase is an HDL-associated enzyme that hydrolyzes some products of lipid peroxidation.1 This enzyme has been shown to prevent LDL from oxidation in vitro,2 3 4 although no physiological substrate has been identified to date. The cDNA for HUMPONA has been cloned5 and the two polymorphic sites in the HUMPONA gene locus elucidated: one at codon 192 (G/A) and the other at codon 55 (T/A).6 7 8 (These sites are identical to positions 191 and 54, respectively, according to the numbering system of Adkins et al.8 ) There is a 10- to 40-fold difference in serum HUMPONA activity among individuals,6 9 as assessed by the enzyme's ability to hydrolyze exogenous, nonphysiological substrates. This difference is attributed to the presence of polymorphisms in the gene encoding HUMPONA.6 7 8
The first polymorphism is an amino acid dimorphism (Gln/Arg) at position 192 (identical to the A and B polymorphisms used by other authors10 11 12 13 ), which has been shown to be involved in the development of CAD. The frequency of the G allele (the Arg-coding, or B, allele) was significantly higher in patients than in control subjects.10 11 In the French white NIDDM population, the frequencies of the Arg-coding allele in CAD patients and control subjects were .35 and .26, respectively,10 and in the US population, .44 and .31, respectively.11 However, another study in the Finnish population failed to show any correlation between the 192Arg/Gln polymorphism and CAD.12
The second polymorphism in HUMPONA involves a T/A transversion at codon 55, resulting in an Leu/Met amino acid substitution.6 7 In a recent study, Garin et al13 have suggested that the 55Leu/Met polymorphism is responsible for the variation in plasma paraoxonase concentrations and that homozygosity for the Leu-encoding allele is an independent risk factor for CAD in NIDDM patients. In those studies, however, all of the subjects studied were white. Because allele frequencies might differ significantly between races and CAD occur under different environmental conditions, we performed an allelic-association study to investigate the correlation of the two polymorphisms (192Arg/Gln and 55Leu/Met) with the incidence of CAD in the Japanese population.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Study Population, Evaluation of CAD, and Lipid Measurements
The subjects in this study were all genetically unrelated Japanese and consisted of 115 control subjects and 75 patients with CAD (22 with angina pectoris and 53 with myocardial infarction). Mean age was 48.3±6.3 years for control subjects and 62.6±9.7 years for patients with CAD. The control subjects were all healthy volunteers with no history of CAD and a normal resting electrocardiogram. The patients were identified from the discharge records of Kyorin University Hospital in Tokyo, Japan. The qualifying conditions for entry into the study as a CAD patient were (1) admission for treatment of myocardial infarction or unstable angina, percutaneous transluminal coronary angioplasty, or coronary artery bypass graft or (2) stable angina with angiographic evidence of CAD. All patients (with both angina and myocardial infarction) had coronary artery lesions, as confirmed by angiography. A transluminal narrowing of
50% was defined as significant. The severity of CAD was
determined by the number of coronary arteries 50% luminal
diameter stenosis. Information on a variety of characteristics
relevant to the assessment of conventional coronary risk
factors, including diabetes mellitus, hypertension, cigarette smoking,
body weight, height, hypercholesterolemia, and
family history of CAD, was obtained from all subjects or their medical
records. All subjects enrolled in the present study gave
informed consent. Serum lipid levels were measured by automated
enzymatic methods using an automatic analyzer (Hitachi 7450).
The reagents used were Determiner L TG (lipoprotein lipase method,
Kyowa Medex) for triglyceride, L Type Total
Cholesterol (cholesterol oxidase method, Wako
Chemicals) for total cholesterol, and Determiner L HDL-C
(direct measurement with polyethylene glycol–modified enzymes, Kyowa
Medex) for HDL cholesterol.
Genotyping
Blood was obtained from the peripheral veins of
control subjects and patients after their informed consent was
obtained. Genomic DNA was extracted from peripheral blood
leukocytes as described.14 The assays for genotyping the
two polymorphisms were based on changes in restriction enzyme
digestion patterns as described by Humbert et al,6 with
minor modifications. To examine the variants, two sets of primers were
designed to encompass the polymorphic regions in the
HUMPONA gene. All primers were used at a concentration of
0.5 µmol/L. For genotyping the 192Arg/Gln
polymorphism, an initial incubation of 5 minutes at 94°C preceded
amplification of genomic DNA in the PCR by using a DNA thermal cycler
(Perkin Elmer, Takara Biomedicals). Primers for amplification of a
99-bp DNA that contains the coding sequence for position 192 were
5'TATTGTTGCTGTGGGACCTGAG3' and 5'CACGCTAAACCCAAATACATCTC3'. PCR was
carried out for 40 cycles, with each cycle consisting of 60 seconds of
denaturation at 94°C, 45 seconds of annealing at 56°C, and 45
seconds of extension at 72°C. PCR products were digested with 8 U
of Alw I for 3 hours at 37°C. The digested products
were then subjected to 3.0% agarose gel electrophoresis and visualized
with ethidium bromide staining. Two fragments, of 63 and 36 bp, were
expected from the digested PCR products from an Arg-coding
allele (one cutting site), whereas one 99-bp fragment from a
Gln-coding allele (no cutting site) was anticipated. For genotyping
the 55Leu/Met polymorphism, PCR was carried out under
the same conditions used above. Primers for amplification of 170-bp DNA
containing a sequence encoding codon 55 were 5'GAAGAGTGATGTATAGCCCCA3'
and 5'TTTAATCCAGAGCTAATGAAAGCC3'. PCR products were then
digested with 3 U of Nla III for 3 hours at 37°C, and the
digestion products were subjected to 3.0% agarose gel
electrophoresis and visualized with ethidium bromide staining. The
allele containing 55Met was identified when the PCR
products were digested with Nla III into two fragments
of 126 and 42 bp, whereas the allele coding for 55Leu
was identified when the PCR products were not digested with
Nla III.
Statistical Analysis
The size of the sample was established on the basis of our pilot
studies which had indicated that the allele frequencies for
192Arg would be 
.60 for control subjects and .75 for CAD
patients. Thus, we set at 150 the number of alleles (number of
subjects=75) required to detect a difference between the two groups,
with a power (P)=.8 and a significance level 
(chance of
a two-sided error)=.05. Age, BMI, and serum lipid levels were
compared between the control subjects and patients by Student's
t test. Statistical analyses of frequency counts
were performed with use of the 
2 test or Fisher's exact
test for small samples. Age, BMI, and serum lipid levels in CAD
patients were compared between HUMPONA genotypes by
ANOVA. A value of P<.05 was considered statistically
significant. Logistic regression analysis was performed to
evaluate the interaction between the HUMPONA
192Arg/Gln genotypes and other variables in
relation to the prevalence of CAD. Independent variables included
in the analysis were age (quantitative); sex (male or female);
55Leu/Met genotypes; smoking (yes or no);
hypertension (yes or no); diabetes mellitus (yes or no); and serum
levels of cholesterol (quantitative),
triglyceride (quantitative), and HDL
cholesterol (quantitative). The analysis was
executed by the SAS statistical program version 6.10 for
Macintosh.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Study Populations, Lipid Measurements, and Conventional Risk Factors of Patients and Control Subjects
Table 1
shows age, BMI, lipid
measurements, and conventional risk factors of the patient and control
groups. Patients with CAD were older and had lower values of HDL
cholesterol than the control subjects. There were no
significant differences between the two groups with respect to BMI,
total cholesterol and triglyceride levels, and
smoking. The patient group had higher frequencies of hypertension and
diabetes mellitus.
|
Genotype Distribution and Allele Frequencies of the
HUMPONA Gene in Patients With CAD and Control
Subjects
The distributions of the two polymorphisms of the
HUMPONA gene (55Leu/Met and
192Arg/Gln) among patients and control subjects are shown
in Table 2. For codon 55, the frequency
of the Leu-coding allele in 115 Japanese control subjects was .91,
which is significantly higher than that reported in
whites.6 There were no subjects with the Met/Met
genotype in our study groups. The genotype distribution
(P=.369) and allele frequencies (P=.391) were
not significantly different between patients with CAD and control
subjects. For codon 192, the Arg/Arg genotype was the most
common in patients with CAD (39/75). In contrast, the Arg/Gln
genotype was the most frequent in the control group (61/115).
The Gln/Gln genotype was the rarest in both patients (3/75) and
control subjects (17/115). The difference in genotype
distribution between patients and control subjects was statistically
significant, with Arg/Arg homozygosity being more frequent in patients
(52.0%) than control subjects (32.2%, P=.006). The
frequency of the G allele (192Arg-coding
allele) in the healthy control group (.59) was about twice as high
as that reported in healthy white populations (.26 to
.31).11 12 The difference in frequency of the G
allele between patients (.74) and control subjects (.59) was
statistically significant (P=.002). Because it has recently
been shown that the 55Leu/Met polymorphism is
responsible for the variation in paraoxonase activity and its
concentration in plasma and that in NIDDM patients, homozygosity for
the Leu allele is an independent risk factor for the development of
CAD,13 we next analyzed the effect of the
192Arg/Gln polymorphism in subjects having the same
genotype for codon 55. As shown in Table 2, when
55Leu/Leu subjects only were compared, there was still a
significant difference in the proportion of 192Arg/Arg
homozygotes between patients (55.4%) and control subjects (37.2%,
P=.024). Also, the difference in allele frequency
between patients (.75) and control subjects (.62) was statistically
significant (P=.013).
|
Association of the HUMPONA codon 192 polymorphism with CAD, standardized for age; sex; codon 55 polymorphism; and other coronary risk factors including smoking, hypertension, diabetes mellitus, and serum levels of cholesterol, triglyceride, and HDL cholesterol was analyzed by a logistic regression model. This model provided an OR of 3.02 (95% CI, 1.02 to 8.98; P<.05) for the relation between CAD and codon 192 polymorphism adjusted for all other variables, suggesting that the HUMPONA codon 192 polymorphism is an independent risk factor for CAD (not shown in tables). On the other hand, the 55Leu/Met polymorphism was not statistically significant in relation to CAD in this model (OR=0.84; 95% CI, 0.17 to 5.75; P=.858). Other variables shown to be significant (P<.05) in this model were age (OR=1.23), smoking (OR=4.08), hypertension (OR=11.1), and diabetes (OR=6.49). Sex and serum levels of cholesterol, triglyceride, and HDL cholesterol were not significantly associated with CAD.
Relationship Between the HUMPONA 192Arg/Gln
Polymorphism and Cholesterol Levels, Subtypes, and
Severity of CAD
Table 3 shows characteristics of the
patients with CAD according to HUMPONA
(192Arg/Gln) genotype. Patients with the
192Arg/Arg were younger (P=.035), but there was
no statistically significant difference in mean BMI, total
cholesterol levels, HDL cholesterol levels,
triglycerides, or types of CAD (angina or myocardial
infarction) between genotypes of CAD patients. When comparisons
were made on the basis of the number of affected vessels, there was no
statistically significant difference in genotype distribution
or allele frequency of the 192Arg/Gln polymorphism
(Table 4).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Genetic factors in combination with a number of environmental risk factors are involved in a predisposition to CAD. The susceptibility to CAD is a complex trait,15 16 and recently one 192Arg variant (B type) of the HUMPONA gene has been reported to be associated with the incidence of CAD in the French10 and US11 populations of whites. However, another study in the Finnish population failed to show any correlation between this variant and CAD.12 Moreover, a recent study has demonstrated a race-specific association between CAD and the 192Arg variant of paraoxonase in Asian Indians but not in Chinese living in Singapore.17 Because allele frequencies might differ significantly between races, we performed an allelic-association study to confirm these findings in Japan, where the population is ethnically homogeneous and mostly of Mongolian origin.
In the present study, the two HUMPONA genotypes were determined in 115 control subjects and 75 patients with CAD confirmed by angiography. The evidence available indicated that for codon 192, the frequency of the Arg-coding allele was much higher in the Japanese population than that in whites,10 11 12 and that the 192Arg variant was independently associated with an increased risk for CAD. In the Finnish study,12 although the control individuals had no symptoms of CAD or any other disease, the mean ages of the men and women in the group were 37 and 36 years, respectively. Therefore, if one assumes that Finland has one of the highest mortality rates for CAD in the world among middle-aged populations,18 then it is possible that the control group contained some individuals who may have had CAD. This might account for a negative association. Also, differences in the criteria used to select the patients may explain the discrepancy among the three studies, two of which show a positive association10 11 and one, a negative association.12 In the study by Ruiz et al,10 the subjects with CAD were all NIDDM patients, whereas in the Finnish study by Antikainen et al,12 subjects with a history of diabetes, current regular smoking, and dyslipidemia were excluded. Furthermore, whereas in the studies by Ruiz et al10 and Serrato and Marian,11 males accounted for 79% and 71%, respectively, of the patient group, in the Finnish study all of the patients with CAD were male.12 19 In our study, 57 patients with CAD (76%) and 104 subjects in the control group (90%) were male. Twenty-six of 75 (35%) total patients with CAD had a history of diabetes. It should also be borne in mind that all of these studies were case-control in design and therefore that survival bias cannot be ruled out.
The mechanism underlying the association between HUMPONA genotype and CAD has so far remained elusive. Humbert et al6 and Adkins et al8 originally elucidated the two polymorphic sites in the HUMPONA gene locus. Only the 192Arg/Gln polymorphism determined the activity of paraoxonase with paraoxon as an exogenous substrate, but there was no difference in enzyme activity toward other substrates such as phenylacetate or chlorpyrifos oxon.20 21 22 Paraoxonase activity toward the substrate paraoxon is higher with the enzyme containing 192Arg (B type enzyme),23 although current epidemiological evidence, including the present study, has suggested that paraoxonase with 192Arg is a genetic risk factor for CAD. The paradox may be explained by the recent finding that the 192Arg isozyme is less active against certain substrates, and when directly tested in vitro, HDL isolated from plasma from subjects with the 192Arg polymorphism protected LDL from lipid peroxidation less effectively than did HDL from those with the 192Gln polymorphism.24
The present study showed a significant association between one variant of the HUMPONA gene (192Arg) and the prevalence of CAD. On the contrary, we failed to detect any association between CAD and the 55Leu/Met polymorphism, which was recently shown to be associated with the plasma concentration of paraoxonase and the development of CAD in NIDDM patients.13 One explanation for the discrepancy is the different allele frequencies between whites and Japanese. The Japanese have a much higher frequency of the 55Leu allele than whites (91% for control subjects and 93% for CAD patients compared with 63% for the total study group in the published results on whites13 ). It is likely that in the Japanese, the 55Leu-containing allele is too frequent to become a genetic risk factor. On the other hand, we have found an association between the 192Arg/Gln polymorphism and CAD, even when only individuals homozygous for 55Leu/Leu were analyzed. Thus, although the 55Leu/Met polymorphism would be of central importance to paraoxonase activity and linkage disequilibrium has been shown to exist between the 55Leu/Met and 192Arg/Gln polymorphisms,13 these mechanisms do not explain the association between 192Arg and CAD observed in the present study.
In conclusion, we have examined the association of the HUMPONA genotypes with CAD in the Japanese population and have found a significant association between the 192Arg variant and CAD. Although HUMPONA is known to have the capacity to prevent LDL from oxidation in studies in vitro,2 3 4 25 the physiological relevance and natural substrate of this enzyme have not been identified to date. Further studies are needed to identify the molecular mechanisms relevant to the association between the HUMPONA gene and susceptibility to CAD.
|
Acknowledgments |
|---|
The authors wish to thank Kanako Yagi for her excellent technical assistance.
Received May 2, 1997; accepted September 2, 1997.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Mackness MI, Durrington PN. High density lipoprotein, its enzymes and their potential to influence lipid peroxidation. Atherosclerosis.. 1995;115:243-253.[Medline] [Order article via Infotrieve]
2. Mackness MI, Arrol S, Durrington PN. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett.. 1991;286:152-154.[Medline] [Order article via Infotrieve]
3. Mackness MI, Arrol S, Abbott A, Durrington PN. Is paraoxonase related to atherosclerosis? Chem Biol Interact.. 1993;87:161-171.[Medline] [Order article via Infotrieve]
4. Mackness MI, Arrol S, Abbott A, Durrington PN. Protection of low-density lipoprotein against oxidative modification by high-density lipoprotein associated paraoxonase. Atherosclerosis.. 1993;104:129-135.[Medline] [Order article via Infotrieve]
5. Hassett C, Richter RJ, Humbert R, Chapline C, Crabb JW, Omiecinski CJ, Furlong CE. Characterization of cDNA clones encoding rabbit and human serum paraoxonase: the mature protein retains its signal sequence. Biochemistry.. 1991;30:10141-10149.[Medline] [Order article via Infotrieve]
6. Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Furlong CE. The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet.. 1993;3:73-76.[Medline] [Order article via Infotrieve]
7. Furlong CE, Costa LG, Hassett C, Richter RJ, Sundstrom JA, Adler DA, Disteche CM, Omiecinski CJ, Chapline C, Crabb JW, Humbert R. Human and rabbit paraoxonases: cloning, sequencing, mapping and role of polymorphism in organophosphate detoxification. Chem Biol Interacts.. 1993;87:35-48.
8. Adkins S, Gan KN, Mody M, LaDu BN. Molecular basis for the polymorphic forms of human serum paraoxonase/arylesterase: glutamine or arginine at position 191, for the respective A or B allozymes. Am J Hum Genet.. 1993;52:598-608.[Medline] [Order article via Infotrieve]
9. Furlong CE, Richter RJ, Seidel SL, Motulsky AG. Role of genetic polymorphism of human plasma paraoxonase/arylesterase in hydrolysis of the insecticide metabolites chlorpyrifos oxon and paraoxon. Am J Hum Genet.. 1988;43:230-238.[Medline] [Order article via Infotrieve]
10. Ruiz J, Blanche H, James RW, Blatter-Garin MC, Vaisse C, Charpentier G, Cohen N, Morabia A, Passa P, Froguel P. Gln-Arg192 polymorphism of paraoxonase and coronary heart disease in type 2 diabetes. Lancet.. 1995;346:869-872.[Medline] [Order article via Infotrieve]
11. Serrato M, Marian AJ. A variant of human paraoxonase/arylesterase (HUMPONA) gene is a risk factor for coronary artery disease. J Clin Invest.. 1995;96:3005-3008.
12. Antikainen M, Murtomaki S, Syvanne M, Pahlman R, Tahvanainen E, Jauhiainen M, Frick MH, Ehnholm C. The Gln-Arg 191 polymorphism of the paraoxonase gene (HUMPONA) is not associated with the risk of coronary artery disease in Finns. J Clin Invest.. 1996;98:883-885.[Medline] [Order article via Infotrieve]
13. Garin M-CB, James RW, Dussoix P, Blanche H, Passa P, Froguel P, Ruiz J. Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentration of the enzyme. J Clin Invest.. 1997;99:62-66.[Medline] [Order article via Infotrieve]
14. Blin N, Stafford DW. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res.. 1976;3:2303-2308.
15.
Lander ES, Schork NJ. Genetic dissection of
complex traits. Science.. 1994;265:2037-2048.
16.
Chamberlain JC, Galton OJ. Genetic
susceptibility to atherosclerosis. Br Med
Bull.. 1990;46:917-940.
17.
Sanghera DK, Saha N, Aston CE, Kamboh I. Genetic
polymorphism of paraoxonase and the risk of coronary heart
disease. Arterioscler Thromb Vasc Biol.. 1997;17:1067-1073.
18. Pisa Z, Uemura K. International differences in developing improvements in cardiovascular health. Ann Med.. 1989;21:193-197.[Medline] [Order article via Infotrieve]
19. Syvanne M, Nieminen MS, Taskinen M-R, Frick MH. An angiographic secondary prevention trial with gemfibrozil in post-bypass men with low plasma HDL-C concentrations: study design and baseline characteristics. Atherosclerosis.. 1994;100:153-154 Abstract.
20.
Lorentz K, Flatter B, Augustin E. Arylesterase
in serum: elaboration and clinical application of a fixed-incubation
method. Clin Chem.. 1979;25:1714-1720.
21. Mueller RF, Hornung S, Furlong CE, Anderson J, Giblett ER, Motulsky AG. Plasma paraoxonase polymorphism: a new enzyme assay, population, family, biochemical, and linkage studies. Am J Hum Genet.. 1983;35:393-408.[Medline] [Order article via Infotrieve]
22.
Nevin DN, Zambon A, Furlong CE, Richter RJ, Humbert R,
Hokanson JE, Brunzell JD. Paraoxonase genotypes,
lipoprotein lipase activity, and HDL. Arterioscler Thromb
Vasc Biol.. 1996;16:1243-1249.
23. Mackness MI, Mackness B, Durrington PN, Connely PW, Hegele RA. Paraoxonase: biochemistry, genetics and relationship to plasma lipoproteins. Curr Opin Lipidol.. 1996;7:69-76.[Medline] [Order article via Infotrieve]
24. Mackness MI, Arrol S, Mackness B, Durrington PN. Alloenzymes of paraoxonase and effectiveness of high-density lipoproteins in protecting low-density lipoproteins against lipid peroxidation. Lancet.. 1997;349:851-852.[Medline] [Order article via Infotrieve]
25. Shih DM, Gu L, Hama S, Xia Y-R, Navab M, Fogelman AM, Lusis AJ. Genetic-dietary regulation of serum paraoxonase expression and its role in atherogenesis in a mouse model. J Clin Invest.. 1996;97:1630-1639.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  S. Lavi, J. P. McConnell, R. Lavi, G. W. Barsness, C. S. Rihal, G. D. Novak, L. O. Lerman, and A. Lerman Association Between the Paraoxonase-1 192Q>R Allelic Variant and Coronary Endothelial Dysfunction in Patients With Early Coronary Artery Disease Mayo Clin. Proc., February 1, 2008; 83(2): 158 - 164. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Browne, S. T. Koury, S. Marion, G. Wilding, P. Muti, and M. Trevisan Accuracy and Biological Variation of Human Serum Paraoxonase 1 Activity and Polymorphism (Q192R) by Kinetic Enzyme Assay Clin. Chem., February 1, 2007; 53(2): 310 - 317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. I. Kakafika, S. Xenofontos, V. Tsimihodimos, A. P. Tambaki, E. S. Lourida, R. Kalaitzidis, M. A. Cariolou, M. Elisaf, and A. D. Tselepis The PON1 M55L gene polymorphism is associated with reduced HDL-associated PAF-AH activity J. Lipid Res., October 1, 2003; 44(10): 1919 - 1926. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. P. Jarvik, T. S. Hatsukami, C. Carlson, R. J. Richter, R. Jampsa, V. H. Brophy, S. Margolin, M. Rieder, D. Nickerson, G. D. Schellenberg, et al. Paraoxonase Activity, But Not Haplotype Utilizing the Linkage Disequilibrium Structure, Predicts Vascular Disease Arterioscler Thromb Vasc Biol, August 1, 2003; 23(8): 1465 - 1471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, Z. Fan, J. Huang, S. Su, Q. Yu, J. Zhao, R. Hui, Z. Yao, Y. Shen, B. Qiang, et al. Extensive Association Analysis Between Polymorphisms of PON Gene Cluster With Coronary Heart Disease in Chinese Han Population Arterioscler Thromb Vasc Biol, February 1, 2003; 23(2): 328 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Jarvik, N. T. Tsai, L. A. McKinstry, R. Wani, V. H. Brophy, R. J. Richter, G. D. Schellenberg, P. J. Heagerty, T. S. Hatsukami, and C. E. Furlong Vitamin C and E Intake Is Associated With Increased Paraoxonase Activity Arterioscler Thromb Vasc Biol, August 1, 2002; 22(8): 1329 - 1333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Deakin, I. Leviev, V. Nicaud, M.-C. B. Meynet, L. Tiret, and R. W. James Paraoxonase-1 L55M Polymorphism Is Associated with an Abnormal Oral Glucose Tolerance Test and Differentiates High Risk Coronary Disease Families J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1268 - 1273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Markus, Z. Kapozsta, R. Ditrich, C. Wolfe, N. Ali, J. Powell, M. Mendell, and M. Cullinane Increased Common Carotid Intima-Media Thickness in UK African Caribbeans and Its Relation to Chronic Inflammation and Vascular Candidate Gene Polymorphisms Stroke, November 1, 2001; 32(11): 2465 - 2471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Mackness, G. K. Davies, W. Turkie, E. Lee, D. H. Roberts, E. Hill, C. Roberts, P. N. Durrington, and M. I. Mackness Paraoxonase Status in Coronary Heart Disease: Are Activity and Concentration More Important Than Genotype? Arterioscler Thromb Vasc Biol, September 1, 2001; 21(9): 1451 - 1457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. N. Durrington, B. Mackness, and M. I. Mackness Paraoxonase and Atherosclerosis Arterioscler Thromb Vasc Biol, April 1, 2001; 21(4): 473 - 480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Senti, M. Tomas, J. Marrugat, R. Elosua, and f. t. REGICOR Investigators Paraoxonase1-192 Polymorphism Modulates the Nonfatal Myocardial Infarction Risk Associated With Decreased HDLs Arterioscler Thromb Vasc Biol, March 1, 2001; 21(3): 415 - 420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Jarvik, L. S. Rozek, V. H. Brophy, T. S. Hatsukami, R. J. Richter, G. D. Schellenberg, and C. E. Furlong Paraoxonase (PON1) Phenotype Is a Better Predictor of Vascular Disease Than Is PON1192 or PON155 Genotype Arterioscler Thromb Vasc Biol, November 1, 2000; 20(11): 2441 - 2447. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sen-Banerjee, X. Siles, and H. Campos Tobacco Smoking Modifies Association Between Gln-Arg192 Polymorphism of Human Paraoxonase Gene and Risk of Myocardial Infarction Arterioscler Thromb Vasc Biol, September 1, 2000; 20(9): 2120 - 2126. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. James, I. Leviev, and A. Righetti Smoking Is Associated With Reduced Serum Paraoxonase Activity and Concentration in Patients With Coronary Artery Disease Circulation, May 16, 2000; 101(19): 2252 - 2257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Leviev and R. W. James Promoter Polymorphisms of Human Paraoxonase PON1 Gene and Serum Paraoxonase Activities and Concentrations Arterioscler Thromb Vasc Biol, February 1, 2000; 20(2): 516 - 521. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C Aubo, M Senti, J Marrugat, M Tomas, J Vila, J Sala, and R Masia Risk of myocardial infarction associated with Gln/Arg 192 polymorphism in the human paraoxonase gene and diabetes mellitus Eur. Heart J., January 1, 2000; 21(1): 33 - 38. [Abstract] [PDF]
|
|
|
|
|
|
R. C. Sorenson, C. L. Bisgaier, M. Aviram, C. Hsu, S. Billecke, and B. N. La Du Human Serum Paraoxonase/Arylesterase's Retained Hydrophobic N-Terminal Leader Sequence Associates With HDLs by Binding Phospholipids : Apolipoprotein A-I Stabilizes Activity Arterioscler Thromb Vasc Biol, September 1, 1999; 19(9): 2214 - 2225. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||