This Article Abstract Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Leviev, I. Articles by James, R. W. Search for Related Content PubMed PubMed Citation Articles by Leviev, I. Articles by James, R. W.

(Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:2935-2939.)
© 1997 American Heart Association, Inc.

Articles

Two Alleles of the Human Paraoxonase Gene Produce Different Amounts of mRNA

An Explanation for Differences in Serum Concentrations of Paraoxonase Associated With the (Leu-Met54) Polymorphism

Ilia Leviev; Franco Negro; ; Richard W. James

From the Clinical Diabetes Unit, Division of Endocrinology and Diabetes (I.L., R.W.J.) and the Division of Gastroenterology (F.N.), University Hospital, Geneva, Switzerland.

Correspondence to Dr Richard W. James, Clinical Diabetes Unit, Division of Endocrinology and Diabetes, University Hospital, 24 rue Micheli-du-Crest, 1211 Geneva 14, Switzerland. E-mail Richard-James{at}hcuge.ch

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract In a recent study we demonstrated that a polymorphism of the human paraoxonase gene affecting position 54 was linked to variations in serum concentrations of the enzyme. L allele carriers (leucine at position 54) have significantly higher concentrations of paraoxonase than M allele carriers (methionine at position 54). In the present study we examined the hypothesis that differences in mRNA production could contribute to variations in serum concentrations. Relative concentrations of L and M type mRNA were analyzed in total RNA extracted from heterozygous liver samples. This was achieved by cDNA synthesis, polymerase chain reaction amplification of the cDNA fragment containing the 54 polymorphism and restriction analysis to identify radiolabeled end fragments of L and M alleles. An allele mixing experiment using total RNA from liver samples of LL and MM homozygotes demonstrated the sensitivity of the approach to changes in the relative concentrations of each type of RNA. In 8 of 10 heterozygous samples, an excess of L allele type mRNA was observed. Overall there was a significantly higher level of L type mRNA (L:M ratio of 2.51±1.41, n=10, P<.01). These results support our hypothesis that increased concentrations of serum paraoxonase arise from greater production of L allele mRNA. In two samples, the L:M ratio was close to or below 1.0. This is consistent with the known spectrum of paraoxonase serum concentrations associated with the L and M alleles and suggests that factor(s) that preferentially modulate allele expression are usually, but not uniformly, associated with the L allele.

Key Words: atherosclerosis • HDL • LDL • oxidative stress

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Oxidation is currently the strongest candidate for a naturally occurring modification of LDLs, which is considered obligatory to render them atherogenic.^1–3 In this context, it is the defining step in the atherosclerosis process; consequently, mechanisms that protect against oxidative stress assume particular importance. Paraoxonase (PON) is a serum enzyme that is entirely associated with HDLs in man.^4,5 Interest in the peptide arises precisely from its hypothesized role in the protection of LDLs against oxidation. As proposed by Mackness et al^6,7 PON would hydrolyze oxidized lipids and limit their accumulation in LDLs. Studies by Watson et al⁸ have provided further support for this proposal by demonstrating that the enzyme prevents transformation of LDLs into a particle with atherogenic properties. The study also identified a potential substrate for PON in the form of an oxidized phospholipid. Recently, we provided the first clinical data indicative of the relevance of PON to atherosclerosis by identifying it as an independent genetic risk factor for vascular disease in diabetic patients.⁹ This has been confirmed by an independent study of American nondiabetic patients¹⁰ but not in two European nondiabetic populations.^11,12

The preceding studies focused on a polymorphism affecting position 191 of the human PON gene. This mutation modulates the hydrolytic activity of PON toward some, but not all, exogenous substrates.^13,14 A second common polymorphism affects amino acid at position 54, giving rise either to leucine (L allele) or methionine (M allele). In a very recent study, we demonstrated that the polymorphism is associated with differences in serum levels of PON¹⁵: L allele carriers have significantly higher concentrations than M allele carriers. This translates into highly significant differences in enzyme activities with all substrate types. Given the purported, antiatherogenic role of PON, the 54 polymorphism would appear of particular clinical and physiologic relevance.

It is not known whether the 54 polymorphism is causally implicated in modulated serum levels of PON or a marker for other factors that influence the enzyme. The latter may be of two basic origins. One could be differential stability of peptides coded by the L and M alleles, perhaps linked to their association with HDLs. The latter appears important in maintaining serum PON activity, as illustrated by decreased activity in patients with HDL deficiencies^16,17 and the significant, positive correlation between serum concentrations of PON and apolipoprotein A-I, the structural peptide of HDLs.¹⁸ A second factor could be differential expression (encompassing synthesis, processing, and/or degradation) of the L and M alleles. The present study investigated the latter hypothesis, namely that modulated expression of alleles associated with the 54 polymorphism contributes to variations in serum concentrations of PON.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Liver Samples and RNA Extraction
Human liver samples were obtained from the University Hospital in Geneva and genotyped.^15,19 Of 26 liver samples, 10 were found to be ML heterozygotes, 4 samples were healthy livers, 2 were cirrhotic livers, and 4 were from patients with hepatitis. Two normal, homozygotic LL and MM liver samples were also studied. Total RNA was isolated using TRIZOL reagent (Gibco BRL) according to the manufacturer's instructions. Extracted RNA was dissolved in water (0.1 to 1.0 µg/µl, depending on the initial amount of liver sample) and stored at -70°C.

cDNA Synthesis and Polymerase Chain Reaction (PCR) Amplification
To eliminate any possibility that the 54 polymorphism may be associated with conformational changes of mRNA that could affect primer annealing and subsequent amplification, three sets of primers distant from each other were used for cDNA synthesis. Oligonucleotide primer I, II, or III (30 pmol; see below) was mixed with total liver RNA (0.2 to 2 µg) in a final volume of 10 mL. The mixture was heated (10 minutes, 70°C) and immediately put on ice. Subsequently, 4 mL of first-strand buffer (5x concentrated; Gibco BRL), 2 mL of 100 mmol/L dithiothreitol, 2 mL of dNTPs solution (10 mmol/L each), and 20 U of Mu-MLV reverse transcriptase (Gibco BRL) were added and incubated 1 hour at 37°C. The reaction was terminated by heating at 94°C for 5 minutes.

For the allele mixing experiment, total RNA from the liver of an MM homozygote was added in increasing amounts (from 0.2 to 2 µg with 0.2-µg increments) to 1 µg of total RNA from the liver of an LL homozygote. These mixtures were used for cDNA synthesis as described above.

PCR amplification of the PON cDNA fragment encompassing the 54 polymorphism was performed with 2 mL of the cDNA synthesis reaction in a total volume of 30 mL containing 1pmol of each PCR primer (see below), Taq polymerase buffer (1x concentrated; Pharmacia), 0.25 mmol/L of each dNTP and 2 U of Taq polymerase (Pharmacia). The program for PCR was 25 cycles of denaturing (94°C, 30 seconds), annealing (55°C, 50 seconds), and extension (72°C, 30 seconds). The final extension was at 72°C for 5 minutes. The PCR products were purified by electrophoresis on 2% agarose gel and extracted from the gel using QIAquick gel extraction kit (Qiagen).

The primers for cDNA synthesis were (1) TCATCTGT GAATGTACTAATCCCATG, (2) CCAATTAGCAT GCTTTTCATACACATG, and (3) ATGGCATGGGTG CAAATCGG complementary to positions 342 to 368, 736 to 762, and 1073 to 1092, respectively, of PON mRNA. The PCR primers were (4) GATCCCTTTGTCTATCCCCG and (5) TTTAATCCAGAGCTAATGAAAGCC¹⁹ complementary to positions -23 to -4 and 186 to 209 of PON cDNA. The sequence of these primers is based on the published sequence of PON cDNA,²⁰ and the numbers start from the adenine of the initiation codon.

Restriction Analysis of PCR Products
Purified PCR products were end-labeled using T4 polynucleotide kinase (Pharmacia) and -[³²P]ATP according to Sambrook et al.²¹ The kinase was subsequently inactivated by heating to prevent further labeling of digestion products. Restriction analysis of labeled PCR products was performed with NlaIII (New England Biolabs) using an excess of enzyme to ensure complete digestion. Reaction products were separated on 8% polyacrylamide gels and visualized by autoradiography.²¹ The area and density of the signals on the autoradiogram were analyzed using a computing densitometer (Molecular Dynamics) and quantified using the ImageQuant software package. Signal intensities of the analyzed samples were compared with the paired Student's t test.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
The concept on which the study was based is illustrated in Fig 1A and 1B. Fig 1A shows the fragment that is amplified; it covers the 54 mutation (A to T interchange as shown in box), which introduces a second restriction site for Nla III. Amplification gives rise to a 232-bp fragment, which will yield two or three restriction fragments on digestion with Nla III. Genomic DNA contains two large introns indicated by the arrows. Should genomic DNA contaminate the RNA extract (no DNase step was used), their presence would effectively prevent amplification during reverse transcription. Fig 1B illustrates the procedure for comparison of relative concentrations of L and M type mRNA in total RNA extracts from heterozygotes. Only the end nucleotides of the PCR products are labeled with ³²P, giving rise to radioactive restriction fragments of 24 bp (common to the L and M types), 208 bp (arising from the L type), and 46 bp (arising from the M type). Thus, the quantity of radioactivity associated with fragments specifying allele products does not depend on fragment length. In consequence, simple comparison of radioactive signal intensities arising from the 208- and 46-bp fragments indicates the relative concentrations of their respective mRNA.

View larger version (18K): [in this window] [in a new window]   Figure 1. Schematic representation of the procedure used to study relative levels of hepatic PON L and M type mRNA. A, RNA fragment amplified by the procedure. PCR Pr refers to the primers used; intron indicates the presence of introns in genomic DNA; the box indicates the sequence containing the 54 polymorphism; Nla III indicates the positions of restriction sites for the enzyme; the dotted lines indicate the restriction fragments obtained from M type (top) and L type (bottom) alleles. B, Outline of the transcription, amplification, and digestion steps. Fragments that are radiolabeled are shown in solid lines; nonlabeled fragments are shown in dotted lines. X indicates the position of the mutation site.

Allele Mixing Experiment
The allele mixing experiment was designed to demonstrate the sensitivity of the procedure to changes in the relative concentrations of L and M type mRNA. Fig 2A shows autoradiograms of the restriction products where only radioactive, end-labeled fragments (46 bp for the M allele and 208 bp for the L allele and a common 24 bp fragment) are visible. These autoradiograms were scanned, and the ratios of the radioactive signals corresponding to the end-labeled fragments of the L and M alleles (208/46) were compared (Fig 2B). Quite clearly, as the proportion of M type total mRNA in the analyzed sample was raised, there was a corresponding decrease in the L:M signal ratio reflecting the increase in the amount of M allele digestion product.

View larger version (49K): [in this window] [in a new window]   Figure 2. Allele mixing experiment using total RNA extracted from LL and MM homozygous liver samples. A, Autoradiogram of end-labeled restriction fragments. Total RNAs from samples homozygous for the L and M allele were mixed and subjected to cDNA synthesis, PCR (where products were end-labeled with 32P), and restriction analysis. The latter yields a common end-labeled 24-bp fragment and allele-specific, end-labeled 46-bp (M) and 208-bp (L) fragments. Left-hand lane, total RNA from an M allele homozygote; lanes 1 to 10, 1 µg of total RNA from an L allele homozygote was mixed with increments (0.2 µg) of total RNA from an M allele homozygote (up to 2 µg); right-hand lane, total RNA from an L allele homozygote. Values below the lanes refer to the relative signal intensities (L:M). B, Graphic representation of the L:M signal ratios (208/46 bp signal intensities) obtained by scanning the autoradiogram shown in Fig 1A. Mixture refers to the mix of M and L type RNA, as described above.

Analyses of Heterozygotic LM Livers
In the second set of experiments, total mRNA obtained from liver biopsies of heterozygous LM subjects was analyzed. Results of a representative experiment are shown in Fig 3. The relative intensities of end-labeled fragments derived from restriction digests of L and M alleles are given in the Table. Each value is the mean of three analyses. A further control involved cDNA synthesis with three different primers, as indicated in the Table. For each liver sample, a reproducible L:M ratio was observed, as illustrated by the relatively low coefficients of variation (which expresses the SD as a percentage of the sample mean; Table). For the majority of samples (8 of 10), the L:M ratio was substantially higher than 1.0, averaging 2.89±1.31 with considerable variation between the 8 samples (range, 1.33 to 4.60). One sample gave a ratio close to 1.0, while the other sample indicated an excess of the M allele product (mean ratio, 0.82; Table). Overall, a significantly higher yield of the L allele product (ratio, 2.51±1.41, P<.01) was observed for the 10 liver samples.

View larger version (118K): [in this window] [in a new window]   Figure 3. Autoradiogram of end-labeled fragments of L and M allele products obtained by cDNA synthesis, PCR amplification, and restriction digestion of total RNA extracted from ML heterozygous liver samples. Left-hand lane, undigested PCR product from liver sample 1 (232 bp); lanes 1 to 10 refer to different liver samples (see legend to the Table).

View this table: [in this window] [in a new window]   Table 1. Ratios of L:M Allele Products in Liver Samples Heterozygous for the Alleles

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Accumulating data implicate PON as a protective factor against oxidative modifications of LDLs. Given the pivotal role attributed to oxidative stress in atherosclerosis, factors that modulate PON serum activity may influence this protective function. Our recent studies¹⁵ revealed that serum PON concentrations/activities are statistically linked to the PON genotype defined by the polymorphism affecting amino acid position 54; LL homozygotes have mean serum concentrations significantly higher than MM homozygotes with heterozygotes having intermediate values. There are several explanations for this phenomenon. In this study we examined the hypothesis that variable expression of the L and M alleles could contribute to this difference.

Direct comparisons of total amounts of PON mRNA in liver samples from LL and MM homozygotes by Northern hybridization or reverse transcriptase-PCR are not feasible because between-liver factors (quality of biopsy samples, extraction of mRNA, or PCR amplification) are too variable. Thus, we adopted an approach using liver samples from heterozygotes. It ensured that the L and M type genes were in identical conditions before extraction and that mRNAs, cDNAs, and PCR products were processed in an identical manner. This eliminates the influence of intersample variations on the L:M allele ratio. The second particularity of our approach is to label only the end nucleotides of the PCR products. Thus, differences in the size of the restriction fragments do not affect the amount of radioactivity per fragment. Other potential sources of variation are the cDNA synthesis and PCR amplification steps. As the annealing sites for primers during cDNA synthesis are distant from the 54 polymorphism (nucleotide 163), it is unlikely that the interchange influences the efficiency of cDNA synthesis. A similar consideration applies to the PCR amplification step: the annealing sites for primers are not close to the interchange point and the interchange (A to T) does not change the denaturing temperature of double-stranded PCR product during amplification. In consequence, we consider it unlikely that there is preferential conversion of one type of mRNA to cDNA or preferential amplification of one type of cDNA. Thus, differences in the amounts of L and M allele products can only be explained by differences in amounts of L and M type mRNA.

To test the sensitivity of the method, an allele mixing experiment was undertaken using total mRNA from MM and LL homozygotes. It was not possible to quantify the PON mRNA in total extracts from liver biopsies. In addition, only 1 MM homozygote biopsy was available and contained a small amount of tissue. Thus, it was not possible to prepare mixtures of predetermined L:M ratios and confirm that the PCR products gave the same ratios. However, we showed that across the spectrum of ratios used, each increment of total mRNA from the MM liver caused a decrease in the L:M PCR product ratio. Therefore, we concluded that the approach would give a valid indication of the relative amounts of the L and M PON mRNA in heterozygotic livers and be sensitive to relatively minor changes in the ratio.

Our results quite clearly demonstrate significantly higher levels of L allele mRNA compared with M allele mRNA in 8 of 10 samples, including all 4 normal livers. This is consistent with our previous data showing significantly higher concentrations of PON protein in serum from carriers of the L allele and supports our hypothesis that modulated expression of the alleles explains differences in serum PON levels. The observation merits two comments. First, pathologic changes affected 6 of the livers, and this could conceivably affect PON synthesis. Little is presently known concerning regulation of PON transcription, but it appears unlikely that different liver disorders would have the same modulatory impact on PON synthesis. Moreover, 4 of the pathologic samples gave results similar to those of the healthy liver samples. Secondly, 2 liver samples gave an L:M product ratio close to or below 1.0, indicating no excess of the L allele. In our previous studies¹⁵ we noted a spectrum of PON concentrations for L and M homozygotes, (LL, 38.6 to 178.6 µg/mL; MM, 25.7 to 111.01 µg/mL). A small percentage of MM carriers have PON levels significantly higher than LL homozygotes. This is compatible with an L:M ratio 1.0. We also noted a large variation (from 1.33 to 4.60) in the ratios of L to M type mRNA. This is also compatible with our study on serum levels of PON protein in which relative concentrations of L and M isoforms could vary up to 7:1 (based on comparisons of concentration ranges in homozygotes, 178.6/25.7). Thus, a minimal interpretation of our data is that there is differential expression of L and M alleles and that whatever factor(s) are implicated, they are usually, but not uniformly, associated with the L allele. It remains to be determined what mechanisms (synthesis, stability, processing, and/or degradation) contribute to differences in allele product levels.

In conclusion, our observations suggest that modulated expression of alleles defined by the 54 polymorphism contributes to observed differences in serum PON concentrations. Further studies are necessary to identify factors responsible for preferential expression of the L allele as these could influence the susceptibility of LDL to oxidation, a pivotal step in the atherogenic process. In this context, Hassett et al²⁰ observed differences in the 3' uncoded region of cDNAs with a longer sequence of the L allele, which could stabilize it and favor its translation. However, as this observation is based only on two independent cDNA sequences, much further work is required. It is also probable that other factors influence serum levels of PON protein. Association of the peptide with HDLs is a strong candidate in this respect,^16,17 while recent studies²² have indicated that dietary factors could modulate PON mRNA levels.

	Acknowledgments

 
The study was supported by grants from the Swiss National Science Foundation (No. 32-40292.94), the Elsie and Carlos de Reuter Medical Research Foundation, and the Helmut Horten Foundation (to R.W.J.).

Received May 7, 1997; accepted July 14, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Goldstein JL, Ho YK, Basu SK, Brown MS. Binding site on macrophages that mediates uptake and degradation of acetylated low density lipoprotein, producing massive cholesterol deposition. Proc Natl Acad Sci U S A. 1979;76:333–337.[Abstract/Free Full Text]

2. Steinberg D, Parthasarathy S, Carew TE, Khoo JC, Witztum JL. Beyond cholesterol: modifications of low-density lipoprotein cholesterol that increase its atherogenicity. N Engl J Med. 1989;320:915–924.[Medline] [Order article via Infotrieve]

3. Tribble DL. Lipoprotein oxidation in dyslipidemia: insights into general mechanisms affecting lipoprotein oxidative behaviour. Curr Opin Lipidol. 1995;6:196–208.[Medline] [Order article via Infotrieve]

4. Mackness MI, Hallam SD, Peard T, Warner S, Walker CH. The separation of sheep and human serum "A"-esterase activity into the lipoprotein fraction by ultracentrifugation. Comp Biochem Physiol. 1985;82:675–677.

5. Blatter M-C, James RW, Messmer S, Barja F, Pometta D. Identification of a distinct human high-density lipoprotein subspecies defined by a lipoprotein-associated protein, K-45: identity of K-45 with paraoxonase. Eur J Biochem. 1993;211:871–879.[Medline] [Order article via Infotrieve]

6. Mackness MI, Arrol S, Durrington PN. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett. 1991;286:152–154.[Medline] [Order article via Infotrieve]

7. Mackness MI, Arrol S, Abbot C, Durrington PN. Protection of low-density lipoprotein against oxidative modification by high-density lipoprotein associated paraoxonase. Atherosclerosis. 1993;104:129–135.[Medline] [Order article via Infotrieve]

8. Watson AD, Berliner JA, Hama SY, et al. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidised low density lipoprotein. J Clin Invest. 1995;96:2882–2891.

9. Ruiz J, Blanché H, James RW, et al. The polymorphism (Gln-Arg192) of the high-density lipoprotein-bound enzyme paraoxonase is an independent cardiovascular risk factor in non-insulin dependent diabetic patients. Lancet. 1995;346:869–872.[Medline] [Order article via Infotrieve]

10. Serrato M, Marian AJ. A variant of human paraoxonase/arylesterase (HUMPONA) gene is a risk factor for coronary heart disease. J Clin Invest. 1995;96:3005–3008.

11. Antikainen M, Murtomaki S, Syvänne M, et al. The Gln-Arg191 polymorphism of the human paraoxonase gene (HUMPONA) is not associated with risk of coronary artery disease in Finns. J Clin Invest. 1996;98:883–885.[Medline] [Order article via Infotrieve]

12. Herrmann S-M, Blanc H, Poirier O, et al. The Gln/Arg polymorphism of human paraoxonase (PON 192) is not related to myocardial infarction in the ECTIM study. Atherosclerosis. 1996;126:299–304.[Medline] [Order article via Infotrieve]

13. La Du BN. Human serum paraoxonase/arylesterase. In: Kalow W, ed. Pharmacogenetics of Drug Metabolism. New York: Pergamon Press; 1992:51–91.

14. Davis HG, Richter RJ, Keifer M, Broomfield CA, Sowalla J, Furlong CE. The effect of the human serum paraoxonase polymorphism is reversed with diazoxon, soman and sarin. Nat Genet. 1996;14:334–336.[Medline] [Order article via Infotrieve]

15. Blatter Garin M-C, James RW, Dussoix P, et al. Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentrations of the enzyme: a possible link between the paraoxonase gene and increased risk of cardiovascular disease in diabetes. J Clin Invest. 1997;99:62–66.[Medline] [Order article via Infotrieve]

16. Mackness MI, Walker CH, Carlson LA. Low A-esterase activity in serum of patients with fish-eye disease. Clin Chem. 1987;33:587–588.[Abstract/Free Full Text]

17. James RW, Blatter Garin M-C, von Eckardstein A, Calabresi L, Assman G, Franceschini G. Modulated activity and concentration of paraoxonase in AIMilano patients compared to other HDL deficiencies. Circulation. 1996;94:I-222. Abstract.

18. Blatter Garin M-C, Abbot C, Messmer S, et al. Quantification of human serum paraoxonase by enzyme-linked immunoassay: population differences in protein concentrations. Biochem J. 1994;304:549–554.

19. Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Furlong CE. The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet. 1993;3:73–76.[Medline] [Order article via Infotrieve]

20. Hassett C, Richter RJ, RH, et al. Characterisation of cDNA clones encoding rabbit and human serum paraoxonase: the mature protein retains its signal sequence. Biochemistry. 1991;30:10141–10149.[Medline] [Order article via Infotrieve]

21. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.

22. Shih DM, Gu L, Hama S, et al. Genetic-dietary regulation of serum paraoxonase expression and its role in atherogenesis in a mouse model. J Clin Invest. 1996;97:1630–1639.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				R. J. Richter, G. P. Jarvik, and C. E. Furlong Determination of Paraoxonase 1 Status Without the Use of Toxic Organophosphate Substrates Circ Cardiovasc Genet, December 1, 2008; 1(2): 147 - 152. [Full Text] [PDF]

				L. Parker-Katiraee, E. Bousiaki, D. Monk, G. E. Moore, K. Nakabayashi, and S. W. Scherer Dynamic variation in allele-specific gene expression of Paraoxonase-1 in murine and human tissues Hum. Mol. Genet., November 1, 2008; 17(21): 3263 - 3270. [Abstract] [Full Text] [PDF]

				G. Lurie, L. R. Wilkens, P. J. Thompson, K. E. McDuffie, M. E. Carney, K. Y. Terada, and M. T. Goodman Genetic Polymorphisms in the Paraoxonase 1 Gene and Risk of Ovarian Epithelial Carcinoma Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 2070 - 2077. [Abstract] [Full Text] [PDF]

				L. Gaidukov and D. S. Tawfik The development of human sera tests for HDL-bound serum PON1 and its lipolactonase activity J. Lipid Res., July 1, 2007; 48(7): 1637 - 1646. [Abstract] [Full Text] [PDF]

				R. Elisei, B. Cosci, C. Romei, V. Bottici, M. Sculli, R. Lari, R. Barale, F. Pacini, and A. Pinchera RET Exon 11 (G691S) Polymorphism Is Significantly More Frequent in Sporadic Medullary Thyroid Carcinoma Than in the General Population J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3579 - 3584. [Abstract] [Full Text] [PDF]

				M. D Tobin, P. S Braund, P. R Burton, J. R Thompson, R. Steeds, K. Channer, S. Cheng, K. Lindpaintner, and N. J Samani Genotypes and haplotypes predisposing to myocardial infarction: a multilocus case-control study Eur. Heart J., March 2, 2004; 25(6): 459 - 467. [Abstract] [Full Text] [PDF]

				N. Ferre, J. Camps, J. Fernandez-Ballart, V. Arija, M. M. Murphy, S. Ceruelo, E. Biarnes, E. Vilella, M. Tous, and J. Joven Regulation of Serum Paraoxonase Activity by Genetic, Nutritional, and Lifestyle Factors in the General Population Clin. Chem., September 1, 2003; 49(9): 1491 - 1497. [Abstract] [Full Text] [PDF]

				M. Robledo, L. Gil, M. Pollan, A. Cebrian, S. Ruiz, M. Azanedo, J. Benitez, J. Menarguez, and J. M. Rojas Polymorphisms G691S/S904S of RET as Genetic Modifiers of MEN 2A Cancer Res., April 15, 2003; 63(8): 1814 - 1817. [Abstract] [Full Text] [PDF]

				X. Wang, Z. Fan, J. Huang, S. Su, Q. Yu, J. Zhao, R. Hui, Z. Yao, Y. Shen, B. Qiang, et al. Extensive Association Analysis Between Polymorphisms of PON Gene Cluster With Coronary Heart Disease in Chinese Han Population Arterioscler Thromb Vasc Biol, February 1, 2003; 23(2): 328 - 334. [Abstract] [Full Text] [PDF]

				L. Iacoviello, E. Ciccarone, and M. B. Donati Review: The genetics of macrovascular disease in diabetes The British Journal of Diabetes & Vascular Disease, September 1, 2002; 2(5): 364 - 368. [Abstract] [PDF]

				M. Tomas, R. Elosua, M. Senti, L. Molina, J. Vila, R. Anglada, M. Fito, M. I. Covas, and J. Marrugat Paraoxonase1-192 polymorphism modulates the effects of regular and acute exercise on paraoxonase1 activity J. Lipid Res., May 1, 2002; 43(5): 713 - 720. [Abstract] [Full Text] [PDF]

				N. Ferre, J. Camps, E. Prats, E. Vilella, A. Paul, L. Figuera, and J. Joven Serum Paraoxonase Activity: A New Additional Test for the Improved Evaluation of Chronic Liver Damage Clin. Chem., February 1, 2002; 48(2): 261 - 268. [Abstract] [Full Text] [PDF]

				M. Barbieri, M. Bonafe, R. Marfella, E. Ragno, D. Giugliano, C. Franceschi, and G. Paolisso LL-Paraoxonase Genotype Is Associated with a More Severe Degree of Homeostasis Model Assessment IR in Healthy Subjects J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 222 - 225. [Abstract] [Full Text] [PDF]

				B. J. Kudchodkar, A. G. Lacko, L. Dory, and T. V. Fungwe Dietary Fat Modulates Serum Paraoxonase 1 Activity in Rats J. Nutr., October 1, 2000; 130(10): 2427 - 2433. [Abstract] [Full Text]

				R. Schmidt, H. Schmidt, F. Fazekas, P. Kapeller, G. Roob, A. Lechner, G. M. Kostner, and H.-P. Hartung MRI Cerebral White Matter Lesions and Paraoxonase PON1 Polymorphisms : Three-Year Follow-Up of the Austrian Stroke Prevention Study Arterioscler Thromb Vasc Biol, July 1, 2000; 20(7): 1811 - 1816. [Abstract] [Full Text] [PDF]

				H. Schmidt, R. Schmidt, K. Niederkorn, A. Gradert, M. Schumacher, N. Watzinger, H.-P. Hartung, and G. M. Kostner Paraoxonase PON1 Polymorphism Leu-Met54 Is Associated With Carotid Atherosclerosis : Results of the Austrian Stroke Prevention Study Stroke, October 1, 1998; 29(10): 2043 - 2048. [Abstract] [Full Text] [PDF]

This Article Abstract Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Leviev, I. Articles by James, R. W. Search for Related Content PubMed PubMed Citation Articles by Leviev, I. Articles by James, R. W.