Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:2489-2499

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plenz, G.
Right arrow Articles by Robenek, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plenz, G.
Right arrow Articles by Robenek, H.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Coronary Artery Disease
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:2489-2499.)
© 1997 American Heart Association, Inc.

Articles

Smooth Muscle Cells Express Granulocyte-Macrophage Colony-Stimulating Factor in the Undiseased and Atherosclerotic Human Coronary Artery

Gabriele Plenz; Carsten Koenig; Nicholas J. Severs; ; Horst Robenek

From the Department of Cell Biology and Ultrastructure Research, Institute for Arteriosclerosis Research, Münster, Germany (G.P., C.K., H.R.), and Imperial College School of Medicine, National Heart and Lung Institute, Royal Brompton Hospital, London, UK.

Correspondence to Dr Gabriele Plenz, Institute for Arteriosclerosis Research, Department of Cell Biology and Ultrastructure Research, Domagkstr 3, D-48149 Münster, Germany.


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Abstract Granulocyte-macrophage colony-stimulating factor (GM-CSF), one of a family of cytokines that regulate proliferation in macrophages and other types of cells, has been implicated in the inflammatory-fibroproliferative response of atherosclerosis. However, previous studies have been restricted to cultured cells and animal models. In the present study, we investigated GM-CSF expression in undiseased and atherosclerotic human coronary arteries at both the mRNA and protein levels. Dual in situ hybridization/cell-marking experiments demonstrated that subpopulations of intimal smooth muscle cells (SMCs) and endothelial cells express the cytokine in the histologically normal human coronary artery and that augmented expression occurs at these sites, and in macrophage accumulations and medial SMCs, in the atherosclerotic vessel. Corresponding data were obtained by in situ hybridization and reverse transcription–polymerase chain reaction and Northern analyses of cultured cells. Cultured human coronary arterial SMCs showed constitutive expression of GM-CSF in cells that had adopted an activated synthetic phenotype. Electron microscope immunocytochemistry revealed that GM-CSF is a protein localized in the cytoplasmic matrix of SMCs of both the undiseased and atherosclerotic vessel wall; extracellular matrix was largely unlabeled, with only occasional small patches of amorphous immunopositive material. The expression of GM-CSF by subpopulations of intimal SMCs in the undiseased artery and the marked upregulation of GM-CSF apparent in atherosclerotic lesions suggest roles for the cytokine in the cellular events underlying initiation and progression of the human atherosclerotic lesion.


Key Words: granulocyte-macrophage colony-stimulating factor • smooth muscle cells • human coronary artery atheroma


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Granulocyte-macrophage colony-stimulating factor, or GM-CSF, is a glycoprotein cytokine that was first characterized for its ability to stimulate progenitor hemopoietic cells to proliferate and differentiate into mature granulocytes and macrophages.1,2 GM-CSF was subsequently shown to have multiple effects on mature macrophages and lymphocytes, notably in immune activation and in stimulating proliferation,3–5 acting in concert with other members of the CSF family (M-CSF, granulocyte CSF, and IL-3) as a key mediator in inflammation and host defense.6–8 CSFs, including GM-CSF, are rapidly synthesized by a variety of cell types in response to injury, the ensuing accumulation of monocytes and macrophages and T lymphocytes in the tissue being the hallmarks of the inflammatory response.4,9–12

Atherosclerosis is essentially an inflammatory–fibroproliferative response of the arterial wall involving a complex set of interconnected events, including endothelial injury, phenotypic alteration of SMCs, accumulation of monocytes, macrophages, and T lymphocytes, and formation of lipid-laden foam cells.13–18 The cellular interactions underlying these events are regulated by cytokines and growth factors that are synthesized and released by the constituent cells of the arterial wall (endothelial cells, SMCs, macrophages, and T lymphocytes). Monocytes and macrophages are a major source of foam cells in the atherosclerotic plaque19; the accumulation and death of these cells lead to development of the lipid core, the classic feature of the lesion, which makes it prone to rupture and consequent life-threatening thrombosis.20,21 Key determining events in the pathogenesis of atherosclerosis are thus macrophage activation, proliferation, and survival, processes that are known to be regulated by CSFs.22–24

Studies on CSFs in atherosclerosis to date have centered principally on M-CSF and the macrophage,22,23 but indirect evidence implicating GM-CSF as a critical player has steadily mounted. M-CSF and GM-CSF are reported to lower plasma cholesterol levels in humans and animals,25–27 and M-CSF enhances uptake and degradation of acetylated LDL and increases cholesterol esterification in human monocyte-derived macrophages in vitro.28 A number of cultured human cell types, including monocytes, endothelial cells, and fibroblasts, have the capacity to express GM-CSF in vitro,29–31 and GM-CSF expression in human arterial SMCs in vitro is reportedly inducible by inflammatory mediators such as IL-1 or TNF-{alpha}.32 In atherosclerotic lesions of cholesterol-fed rabbits, GM-CSF has been immunolocalized to macrophages, with low levels reported in endothelial cells and SMCs.24 Taken together, these findings point to potentially important roles for GM-CSF in atherogenesis, but in the absence of any data on GM-CSF expression in the human artery in situ, it has not previously been possible to assess their significance in human coronary heart disease.

We investigated GM-CSF expression, at both the mRNA and protein levels, in intact tissue from undiseased and atherosclerotic human coronary arteries. Our findings reveal that GM-CSF is expressed in defined subpopulations of cells in the undiseased artery and that marked upregulation occurs in atherosclerotic lesions. Importantly, subpopulations of SMCs are a potentially significant source of GM-CSF in the human coronary arterial wall.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Patients, Samples, and Tissue Preparation
Human coronary artery specimens were obtained from the explanted hearts of male patients undergoing cardiac transplantation and from tissue discarded during surgical operations, as detailed in Table 1Down. The protocol used for this study fulfilled local ethical requirements. Undiseased arterial samples were obtained from 7 patients (n=7), and atherosclerotic samples were obtained from 18 patients (adaptive thickening, n=4; preatheroma, type II and III lesions, n = 5; atheroma and fibroatheroma, type IV and V lesions, n=14; complicated lesion, n=4; and type VIII lesion, n=3).33 Immediately on removal of the heart or excision of surgical tissue, coronary artery samples from proximal areas of the arteria coronaria dextra and arteria coronaria sinistra were either placed in DMEM or prepared for structural studies. The latter specimens were either fixed in 4% paraformaldehyde fixative in PBS or placed in cryoprotective medium (Cambridge Instruments) on small cork disks for snap-freezing in liquid nitrogen and subsequent cryosectioning. The frozen samples were stored at -80°C until required. The paraformaldehyde-fixed samples were trimmed, and selected areas containing plaques were taken for electron microscopy. The remaining tissue was processed for paraffin embedding following standard histological procedure. Two low-denaturation preparation procedures were used for electron microscopy and immunocytochemistry, cryoultramicrotomy according to the method of Tokuyasu34 and embedding at low temperature in the acrylic resin Lowicryl K4M following the protocol described by Völker et al.35


View this table:
[in this window]
[in a new window]
  		Table 1. Human Coronary Artery Samples: Details of Patients

Isolation, Characterization, and Culture of Human Arterial Smooth Muscle Cells
Endothelium was removed enzymatically from aortic tissue or coronary arteries, and SMCs were subsequently released by enzymatic digestion using 3 mg/mL collagenase and 0.5 mg/mL elastase.36–38 The cells were cultured in DMEM with 20% fetal bovine serum, 100 U/mL penicillin, 100 mg/mL streptomycin, and 4 mmol/L L-glutamine. Cells were routinely used between passages 3 and 6; for longer-term cultivation experiments, cells up to passage 8 were used. All components used in cell culture media were tested for endotoxin contamination using the chromogenic Limulus amebocyte lysate assay (endotoxin < 60 pg/mL, Endotect). The purity of the SMC cultures was verified by immunohistochemistry using specific SMC markers (see below). The decrease of the expression of SMC-specific myosin during long-term cultivation experiments was used as a marker for SMC "dedifferentiation," ie, change to the synthetic phenotype.

Probes and Labeling Procedure
For hybridization, the recombinant cDNA clones hGM-CSF, containing an insert complementary to the human GM-CSF mRNA (RD Systems, Bad Nauheim, Germany), and G3PDH (Clontech, Heidelberg, Germany), complementary to human glyceraldehyde-3-phosphate dehydrogenase mRNA, were used. For in vitro transcription, the GM-CSF cDNA was subcloned into a pGEM vector (pGEM3Z, Promega Biotech, Madison, WI). The in vitro transcription was performed according to the manufacturer's protocol with modifications39 using digoxigenin-labeled UTP.

Northern Blot Analysis
Total RNA was isolated from the cells according to the method of Chirgwin et al.40 Northern blot analysis was performed as previously described.41 Detection was performed with a modified detection protocol (Boehringer Mannheim) and the chemoluminogenic substrate CSP.

RT-PCR and Southern Blot Analysis
RNA from SMCs (undiseased coronary artery) was used. RNA from human macrophages and human umbilical vein endothelial cells was kindly provided by K. Peters (Münster, Germany). One microgram of total RNA was reverse transcribed after an initial denaturation step at 65°C for 5 minutes in a total volume of 20 µL using 10 U/µL of Superscript II RNase H- reverse transcriptase, 0.4 U/µL ribonuclease inhibitor (MBI Fermentas GmbH), 25 ng/µL oligo[(dT)12–18], 0.5 mmol/L each of dNTP, 5 mmol/L DTT, 1x first-strand buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, and 3 mmol/L MgCl2) freshly diluted from 5x stock at 37°C for 60 minutes. Samples were heated at 95°C for 5 minutes to terminate reverse transcriptase activity. Total RT products were subsequently used for PCR amplification.

The RT products (20 µL) were brought to a volume of 50 µL containing 3 mmol of MgCl2, 0.2 mmol/L each of dNTP, 1x buffer (20 mmol/L Tris-HCl, pH 8.4, and 50 mmol/L KCl), 2.5 U of Taq polymerase, and 0.8 µmol/L of both the following upstream and downstream PCR primers for GM-CSF (DNA accession no. X03021, GenBank): CAAGCTTCTGTACAAGCAGGGCCTG (sequence location 1673 to 1690) and GCTCTAGATCCCAGCAGTCAAAGGGG (sequence location 2652 to 2669) (product size, 204 bp). Amplification was carried out in a Biometra UNO thermocycler after an initial denaturation at 94.5°C for 2 minutes for 35 cycles using the following temperature and time profile: denaturation at 94°C for 30 seconds, primer annealing at 58°C for 30 seconds, primer extension at 72°C for 20 seconds, and a final extension of 72°C for 15 minutes. Aliquots of the PCR reaction products (8 µL) were analyzed on a 1% ethidium bromide–stained agarose gel in 1 x Tris-borate electrophoresis buffer (90 mmol/L Tris-HCl, 90 mmol/L boric acid, and 2 mmol/L EDTA, pH 8.3) blotted on nylon filters and hybridized as described for Northern hybridization.

In Situ Hybridization
In situ hybridization was performed following methods modified from those previously described.39 Enzymatically released SMCs38 from coronary arteries cultured on coverslips were fixed in 1% paraformaldehyde; for tissues, paraffin-embedded sections of material fixed in 4% paraformaldehyde and cryosections were used. After rehydration, the slides were washed in PBS and 5x Tris-EDTA buffer and treated with proteinase K (0 to 5.0 µg/mL 5x Tris-EDTA [50 mmol/L Tris-HCl, pH 8.0, and 5 mmol/L EDTA]) for 10 minutes at room temperature. The enzymatic digest was stopped with a Tris/glycine solution (50 mmol/L Tris-HCl and 0.2% glycine, pH 7.4). Cells and sections were postfixed for 10 minutes in 1% or 4% paraformaldehyde in PBS, washed in PBS, dehydrated in an ascending series of ethanol, and air dried. Prehybridization was performed in hybridization solution (50% formamide, 2x sodium chloride/sodium phosphate/EDTA buffer [SSPE; 180 mmol/L NaCl, 10 mmol/L NaH2PO4, 1 mmol/L EDTA, pH 7.7], 10 mmol/L DTT, 2 mg/mL herring sperm DNA, 200 µg/mL yeast tRNA, and 1 mg/mL BSA) for 2 hours at 50°C. Before use, probes were heat denatured (10 minutes, 100°C) in hybridization solution. In situ hybridization was performed either with 0.3 µg of digoxigenin-labeled cRNA-probe per milliliter (antisense or sense strand of GM-CSF) or with hybridization solution only at 50°C in a humidified chamber. For the lowest stringency, buffers containing 2x SSC, and for the highest stringency, 0.1 x SSC, both at 50°C, were used.

Immunological Detection for In Situ Hybridization
Detection was performed with the aid of anti-digoxigenin–alkaline phosphatase according to the manufacturer's instructions (Boehringer Mannheim). The alkaline phosphatase staining procedure was performed in the dark for 4 hours or overnight using NBT (67.5 µg/mL) and X-PO4 (35 µg/mL) as substrates. After a final incubation in Tris-EDTA buffer (10 mmol/L Tris-HCl, pH 8.0, and 1 mmol/L EDTA) for 5 minutes, coverslips or sections were mounted with Kaiser's glycerine gelatin.

Immunohistochemical Identification of Cell Types Combined With In Situ Hybridization
The alkaline phosphatase detection procedure for in situ hybridization was followed by immunohistochemical detection of macrophages (mouse anti-human CD 68, clone PG-M1; DAKO, Hamburg, Germany), endothelial cells (rabbit anti-human von Willebrand factor; Sigma Chemical Co, Heidelberg, Germany), or SMC-specific myosin (SM-1 and SM-2 ABC isoforms,37 mouse anti-human myosin, clone hSM-V, Sigma) using the peroxidase Vectastain Elite ABC kit according to the manufacturer's instructions. In addition, because of the possibility that hSM-V antibody may cross-react with the nonmuscle myosin variant,37 a second SMC marker, HHF35 (mouse IgG1, Enzo Diagnostic Inc), which recognizes smooth muscle {alpha}/{gamma} actin, was used. As secondary antibodies, biotin-conjugated goat anti-rabbit IgG or horse anti-mouse IgG (Vector Laboratories, Burlingane, CA) was used. The peroxidase staining procedure was performed for 20 to 45 minutes at room temperature using AEC (0.2 mg/mL 0.5 mol/L sodium acetate buffer, pH 5.2) as substrate. The sections were counterstained according to standard procedures with methylene green and mounted with Kaiser's glycerine gelatin.

Postembedding Immunogold Electron Microscopy
Immunocytochemical labeling of the ultrathin frozen sections and the sections of Lowicryl-embedded tissue was performed by floating grids serially on 10- to 20-µL droplets placed on parafilm sheets. Pretreatment to block nonspecific binding sites and to quench aldehydes present on the section surface was carried out with 10% FCS in PBS (pH 7.4) for 15 minutes (for cryosections) or with 1% BSA in PBS (pH 7.4) for 15 minutes (for Lowicryl sections). The sections were incubated with mouse monoclonal anti-human GM-CSF primary antibody (dilution, 1:150 to 1:250; Genzyme Corp, Cambridge, MA) in 5% FCS/PBS (cryosections) or 1% BSA/PBS (Lowicryl sections) for 1 hour, followed by four 5-minute washes in PBS to remove the unbound primary antibodies. Controls, in which the primary antibody was omitted, were processed in parallel. Incubation with gold-labeled secondary antibodies (12-nm colloidal gold AffiniPure goat anti-mouse IgG, Dianova, Hamburg, Germany) was then carried out for 1 hour, followed by four 5-minute washes in PBS and five 2-minute rinses in distilled water. In some experiments, double immunogold labeling, using the GM-CSF primary antibody and hSM-V (to mark SMCs) was done. In this case, cryosections incubated with GM-CSF primary antibodies followed by anti-mouse 12-nm gold-labeled secondary antibodies, as described above, were then treated with goat anti-mouse antibodies (as a blocking step) before serial incubation with hSM-V (dilution, 1:100; 1 hour) and 6-nm gold-labeled anti-mouse secondary antibodies (dilution, 1:20; 30 minutes), with intervening washing steps similar to those used in single labeling. Omission of hSM-V incubation served as a control. Before examination, sections were stained with 2% methylcellulose and 0.2% uranyl acetate (cryosections) or in saturated aqueous uranyl acetate and lead citrate (Lowicryl sections). The grids were examined with a Philips 201 or 410 electron microscope operated at 60 kV.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowReferences
 
Distribution of GM-CSF mRNA in the Undiseased Arterial Wall and in Atherosclerotic Lesions
We first compared the overall patterns of GM-CSF mRNA expression in undiseased and atherosclerotic arterial samples by in situ hybridization. Sections of undiseased vessel consistently revealed distinct GM-CSF mRNA-positive cells (Fig 1Down, a and b). The hybridization signal was most conspicuous in the superficial intimal region. Expression of GM-CSF mRNA was apparent in the endothelium and in cells that were irregularly scattered in a zone extending 25 to 50 µm beneath the endothelium. The endothelial signal was not uniform, however; some endothelial cells showed weak expression, and others showed none at all. Occasional positive cells were also apparent in the medial region adjacent to the intima, although here the overall levels of signal were lower, and the major part of the media revealed no expression (Fig 1Down, a and b). Negative controls using labeled sense RNA were completely devoid of signal (Fig 1Down, c). The pattern of expression that was illustrated, although showing minor variation between samples, was consistently observed in sections from all patients examined.



View larger version (169K):
[in this window]
[in a new window]
  		Figure 1. In situ hybridization illustrating the pattern of GM-CSF mRNA expression in undiseased human coronary artery and during early lesion development. The in situ hybridization was done on paraffin sections and cryosections from nonatherosclerotic arteries (Table 1Up, samples 1 to 5, 17, and 23) and early lesions (Table 1Up, samples 7, 12, 14, 16, 18, 20, and 22) using an antisense GM-CSF cRNA-probe. a, Survey view. b, Detail at higher magnification. Note the conspicuous expression of GM-CSF mRNA in some but not all endothelial cells and in superficial intimal cells beneath the endothelium. c, Negative control using digoxigenin-labeled sense cRNA coding for GM-CSF. d, Survey view of an artery showing minimal intimal thickening. e, Expression in typical type III and IV lesions. GM-CSF mRNA signal is apparent in endothelial cells and the subendothelial region. Prominent signal is also observed in medial SMCs. Bright-field images of paraffin sections, original magnification x150 (a), x300 (b and c), x40 (d), and x100 (e). A indicates adventitia; E, endothelium; I, intima; L, lumen; and M, media. Arrowheads indicate the internal and external elastic laminae.

The extent and pattern of GM-CSF mRNA expression in intimal thickenings and early and advanced atherosclerotic lesions differed from those of the undiseased vessel. Identical stages of lesion development in different specimens displayed the same behavior in terms of GM-CSF mRNA expression and distribution. GM-CSF mRNA-positive cells were observed in the intima, media, and adventitia, although the distribution of signal was not uniform and varied during lesion progression. The endothelium of early lesions showed signal that resembled that of undiseased vessels, with a small but distinct increase apparent in advanced lesions (Figs 1Up and 2Down). In arteries showing minimally thickened intimas, GM-CSF mRNA signal was unaltered in the intima but increased in the media, showing uniform distribution extending throughout the entire medial layer (Fig 1Up, d). This GM-CSF mRNA signal increased with further intimal thickening (Fig 1Up, e) and was even more prominent in overt atherosclerotic lesions (type V) (Fig 2Down, a and b). In overt lesions, GM-CSF mRNA-positive cells were observed scattered throughout the entire intima. Conspicuous features were the presence of small groups of particularly strongly positive cells concentrated immediately beneath the endothelium and large foci of positive cells deep in the intima, in the region of the plaque core (Fig 2Down, a and b). In contrast to the undiseased artery, signal was apparent over major regions of the media (Fig 2Down, b) and in the adventitia, where conspicuous expression was apparent in the vasa vasorum (Fig 2Down, c). Further changes in the expression pattern were observed in the most advanced lesion categories (types VI and VIII). At this stage, a decline in GM-CSF mRNA signal was observed in both the medial and intimal SMCs (Fig 2Down, e and f). Distinct patches of high signal intensity remained associated with the lipid-rich core (Fig 2Down, e) and thrombi (Fig 2Down, f).



View larger version (116K):
[in this window]
[in a new window]
  		Figure 2. In situ hybridization illustrating the typical pattern of GM-CSF mRNA expression in advanced (type V), complicated (type VI), and fibrocollagenous (type VIII) lesions. The in situ hybridization was carried out on paraffin sections and cryosections from tissue samples 6, 8 to 13, 15, 18, 19, and 21 to 23 (Table 1Up) using an antisense GM-CSF cRNA probe. a and b, Detail from selected areas of an eccentric lesion. Prominent GM-CSF mRNA signal is apparent in endothelial cells, the subendothelial region, and focal areas of the plaque core and plaque base. Signal is also observed in medial SMCs (b) and in the vasa vasorum of the adventitia (c), where endothelial cells and a surrounding ring of medial SMCs were positive. d, Negative control using digoxigenin-labeled sense cRNA coding for GM-CSF. In type VI and VIII lesions (e and f), GM-CSF expression is decreased. Accumulations of GM-CSF–expressing cells were observed in the core region of the plaque (e) and of thrombus formation (f). The media is devoid of signal (e) in these advanced lesions. Bright-field images of cryosections, original magnification x100 (a, b, and d through f) and x200 (c). A indicates adventitia; E, endothelium; I, intima; L, lumen; and M, media. Arrowheads indicate the internal and external elastic laminae.

Immunohistochemical Identification of Cells Expressing GM-CSF mRNA
Results from in situ hybridization, as described above, permit localization of GM-CSF mRNA-positive signal within the tissue as a whole, but the ability to correlate the signal with the specific cell types of the lesion is limited. To enable unambiguous identification of the cell types that express GM-CSF mRNA, we combined in situ hybridization with immunohistochemistry using cell-type–specific antibodies to permit simultaneous identification of endothelial cells, SMCs, and macrophages (Figs 3Down and 4Down).



View larger version (124K):
[in this window]
[in a new window]
  		Figure 3. Immunohistochemical identification of GM-CSF mRNA-expressing cells in undiseased arteries. Immunohistochemistry was performed with cell-type–specific antibodies after in situ hybridization with antisense GM-CSF cRNA. For in situ hybridization, detection was with the alkaline phosphatase/NBT–X-PO4 system (dark blue stain); for immunohistochemistry, detection was with the peroxidase/AEC system (red stain). Nuclei were counterstained with methylene green (green stain). Optimal viewing of the in situ hybridization signal in combination with the cell markers requires adaptation of the procedure to give lower levels of label intensity than are routinely used in single labeling experiments. a and b, SMC identification (a, HHF35, mouse monoclonal anti-human {alpha}/{gamma} actin; and b, hSM-V, mouse monoclonal anti-human SMC myosin). GM-CSF mRNA-expressing SMCs are identified in the intima (large arrows) and in the area of the media (small arrows) adjacent to the internal elastic lamina. Identical results were obtained when HHF35 was used as the SMC marker. c, Endothelial cell identification (rabbit anti-human von Willebrand factor). d, Macrophages (identified with mouse monoclonal anti-human CD 68) localized exclusively in the adventitia. These macrophages did not express GM-CSF mRNA. Bright-field images of cryosections, original magnification x100 (a) and x250 (b through d). A indicates adventitia; E, endothelium; I, intima; L, lumen; and M, media. Arrowheads indicate the internal and external elastic laminae.



View larger version (146K):
[in this window]
[in a new window]
  		Figure 4. Immunohistochemical identification of cell types, combined with GM-CSF mRNA localization by in situ hybridization, in atherosclerotic lesions. The in situ hybridization used antisense GM-CSF cRNA probe and was followed by immunohistochemical marking with SMC-specific antibody hSM-V (a, b, c, and e), macrophage-specific antibody (d and f), or endothelial marker (not shown). For in situ hybridization, detection was with the alkaline phosphatase/NBT–X-PO4 system (dark blue stain); for immunohistochemistry, detection was with the peroxidase/AEC system (red stain). a, Survey view of part of a lesion showing SMC marking. The GM-CSF mRNA signal is seen both colocalized and separately from the SMC marker, demonstrating that some but not all the GM-CSF–positive cells of the intima are SMCs. b, Medial SMCs labeled with the SMC marker. A subpopulation of these cells is seen to express GM-CSF mRNA. c, Detail of the area shown in a, illustrating SMCs that express GM-CSF (open arrows). Note that not all SMCs express GM-CSF (arrows) and that other cells, not labeled with the marker, are GM-CSF mRNA–positive (stars). d, Accumulation of GM-CSF mRNA–positive cells at the base of the plaque, identified as macrophages. e and f, Serial sections showing a lower-power survey view of the area from which d is taken, stained with SMC marker (e) and macrophage marker (f). In this macrophage-rich zone, although most of the GM-CSF mRNA is colocalized with the macrophage marker, some GM-CSF mRNA–positive SMCs are also present (open arrows). Bright-field images of cryosections, original magnification x150 (a, b, e, and f) and x300 (c and d). A indicates adventitia; E, endothelium; I, intima; L, lumen; and M, media. Arrowheads indicate the internal and external elastic laminae.

Fig 3Up shows the results obtained with undiseased arteries. The subendothelial GM-CSF mRNA expression was clearly localized to a subpopulation of SMCs in the intima (Fig 3Up, a and b). This localization was observable with both the HHF 35 and hSM-V SMC markers. The signal in the media, adjacent to the intima, was also confirmed to be of SMC origin. The GM-CSF mRNA expression attributed to endothelial cells was confirmed with the endothelial marker (Fig 3Up, c). Macrophages were not observed in the intima of undiseased arteries but were observed in the adventitia, where they were found to be GM-CSF mRNA negative (Fig 3Up, d).

Fig 4Up presents results obtained on atherosclerotic lesions using the combined in situ hybridization/cell-marking approach. Both SMCs and macrophages were identified as GM-CSF mRNA-positive cells within the intima. Examples of GM-CSF mRNA-positive SMCs beneath the endothelium and scattered throughout the intima are shown in Fig 4Up, a and c. GM-CSF mRNA-positive SMCs were localized to these sites with both cell markers, indicating expression of both the SMC-specific myosin and actin by these cells. The two SMC markers also confirmed the expression of GM-CSF mRNA by medial SMCs (Fig 4Up, b). In both the intima and the media, SMCs that did not express GM-CSF mRNA were also common. A proportion of intimal GM-CSF mRNA-positive cells that were not labeled by the SMC marker were demonstrated to be macrophages (Fig 4Up, d through f). In the conspicuous accumulations of GM-CSF mRNA-positive cells at the plaque base, macrophages were the most abundant cell type (Fig 4Up, d and f), although some expressing SMCs were also present, as demonstrated in serial sections stained with each of the cell-type markers (Fig 4Up, e and f). For both macrophages and SMCs, GM-CSF mRNA signal was observed in both lipid-laden cells and cells that had not accumulated lipid (not shown). Results with the endothelial marker confirmed the presence of GM-CSF mRNA in endothelial cells (not shown). Some GM-CSF mRNA-containing cells did not react with any of the cell markers; such cells were observed in the vessel lumen, directly attached to the endothelium, in the intima, and in the adventitia and were presumed to represent invading monocytes, granulocytes, T cells, and fibroblasts. High levels of GM-CSF mRNA were observed in the endothelium and media of the vasa vasorum.

A summary of the pattern of GM-CSF expression observed during the different stages of lesion development is given in Table 2Down.


View this table:
[in this window]
[in a new window]
  		Table 2. Pattern of GM-CSF mRNA Expression Observed During Different Stages of Lesion Development

GM-CSF Expression in the SMC: Cell Culture and Electron Microscope Immunocytochemistry
To confirm the in situ hybridization/cell-marking results and to investigate further the SMC as a GM-CSF-producing cell, we conducted experiments to determine whether cultures of pure SMCs expressed GM-CSF mRNA and whether GM-CSF protein was detectable at the electron microscopic level in SMCs of arterial tissue.

In situ hybridization of cultured human SMCs, enzymatically released from media explants after three passages, demonstrated that GM-CSF mRNA was constitutively expressed in vitro, in both cells derived from the undiseased artery and those from atherosclerotic arteries (Fig 5Down, a). RT-PCR analysis of the constituent cell types of the normal vessel wall (Fig 5Down, b) revealed that only SMCs and endothelial cells express GM-CSF mRNA, both at comparable levels. GM-CSF mRNA was not detected in human macrophages cultivated under normal cell culture conditions. When cultured aortic SMCs were maintained for long periods (7 weeks, seven passages), during which dedifferentiation to a more synthetic phenotype occurs, a marked elevation in GM-CSF expression was apparent (Fig 6Down).



View larger version (101K):
[in this window]
[in a new window]
  		Figure 5. Demonstration of expression of GM-CSF mRNA by SMCs and other vascular cell types. a, In situ hybridization demonstrates GM-CSF mRNA signal in cultured human SMCs isolated from undiseased coronary artery. SMCs isolated from atherosclerotic arteries showed a comparable expression pattern (not shown). The area at right, top, shows detail from the left; the area at right, bottom, shows negative control using sense cRNA probes. b, RT-PCR analysis showing the presence of GM-CSF mRNA in normal SMCs (1 and 1'), human umbilical vein endothelial cells (2 and 2'), and human macrophages (3 and 3'). The macrophages were derived from peripheral blood monocytes, differentiated to macrophages by cultivation in Petri dishes for 7 days in RPMI 1640 supplemented with 20% human serum. Left, Ethidium bromide–stained gel showing RT-PCR products. Right, Luminograph of a Southern blot analysis (using digoxigenin-labeled antisense probes for GM-CSF) demonstrating the specificity of the amplification products.



View larger version (9K):
[in this window]
[in a new window]
  		Figure 6. Expression of GM-CSF mRNA during long-term cultivation of SMCs derived from normal human coronary artery. For each stage, 5 µg of RNA was analyzed by Northern blotting. For hybridization, a digoxigenin-labeled riboprobe of human GM-CSF (50 ng/mL) was used. Hybridization was at 70°C overnight. Northern blots were measured by densitometric scanning. Densitometric values of GM-CSF mRNA expression were corrected for G3PDH mRNA values. Corrected values were normalized against the level of expression determined at the second passage. A marked elevation in GM-CSF expression is apparent between 6 and 7 weeks, as the cells dedifferentiate to an activated synthetic phenotype. Data were confirmed by RT-PCR analysis (not shown).

In immunogold-labeling studies at the electron microscopic level, SMCs were readily identifiable by their ultrastructural features. Gold labeling demonstrated that GM-CSF is a protein localized in the cytoplasmic matrix of intimal SMCs of the human coronary artery. In cells from undiseased arteries showing a contractile phenotype (Fig 7Down, a), the labeling density was uniform over a given cell but varied from one cell to the next (12 to 40 gold particles/µm2). Nuclei and mitochondria were devoid of label. The greater part of the extracellular matrix contained no gold label (Fig 7Down, a and b), but occasional patches of amorphous immunopositive material were detected. Label in the extracellular matrix was never observed in association with collagen fibrils (Fig 7Down, b and c). Double labeling with GM-CSF and SMC (hSM-V) primary antibodies and gold markers of different diameters confirmed the ultrastructural identification of SMCs (Fig 7Down, d). Similar results were observed with ultrathin cryosections and Lowicryl sections.



View larger version (158K):
[in this window]
[in a new window]
  		Figure 7. Electron micrographs of ultrathin frozen sections showing immunogold labeling of GM-CSF in normal human coronary artery. a, SMCs of the contractile phenotype are positively labeled; portions of two contractile-type cells are shown in this field, characterized by a cytoplasm (Cyt) filled with contractile filaments and relatively few membrane-bound organelles. Gold label is distributed uniformly over the cytoplasmic matrix, at a density that varies from one cell to the next. Nuclei (N), mitochondria, and other intracellular organelles are devoid of label. No labeling of the extracellular matrix (MX) is observed; however, occasional labeling is apparent elsewhere in the extracellular matrix. b, Abundant collagen (C) in the extracellular matrix, with no labeling of GM-CSF. c, Groups of gold particles scattered over electron-dense amorphous material, again with no label associated with the collagen. d, Double immunogold labeling using SMC marker (hSM-V) and anti–GM-CSF primary antibody is shown to confirm the identity of the GM-CSF–producing cells. Note the presence of both sizes of gold particles (arrowhead, 6 nm gold/hSM-V; and arrow, 12 nm gold/GM-CSF) within the cell. PL indicates plasma membrane. Bars = 0.5 µm.

SMCS of the synthetic phenotype (Fig 8Down, a and b) and foam cells of SMC origin from diseased tissue (Fig 8Down, c) revealed a pattern of GM-CSF localization similar to that of contractile-type cells, with the protein localized uniformly throughout the cytoplasmic matrix (labeling densities from 16 to 43 gold particles/µm2). Label was entirely absent from the Golgi apparatus, endoplasmic reticulum, vesicles, and other membrane-bound organelles that are prominent features of the synthetic-state cell (Fig 8Down, a and b); correspondingly, no label was present over lipid droplets, lysosomes, and cholesterol crystals in SMC foam cells (Fig 8Down, c). The extracellular matrix was largely devoid of label, although, as in the undiseased tissue, isolated patches of labeling were observed in association with amorphous noncollagenous material. In no samples was there evidence of release of GM-CSF by exocytosis or of endocytic uptake and degradation.



View larger version (205K):
[in this window]
[in a new window]
  		Figure 8. a and b, Immunogold labeling of GM-CSF in synthetic-state SMCs. The label is seen uniformly throughout the cytoplasm (Cyt); the abundant membrane-bound organelles, including the Golgi apparatus (G), noncoated (UC) vesicles, and coated vesicles (CV), are free of label. In the extracellular matrix (MX), occasional gold label is seen over amorphous material but never in association with collagen (C), as in the undiseased artery. c, Immunogold labeling of GM-CSF in a foam cell of SMC origin from an atherosclerotic lesion. As in contractile- and synthetic-state cells, GM-CSF is localized to the cytoplasmic matrix (Cyt), which contains uniformly distributed label. The lipid droplets (Li), cholesterol crystals (CC), and lysosomes (Ly), which are the hallmark of these cells, as well as mitochondria (M), are devoid of label. Ultrathin frozen sections. Bars = 0.5 µm.

The specificity of the labeling patterns was confirmed in sections of control undiseased and diseased tissue (not exposed to primary antibody) run in parallel, which were consistently devoid of gold label.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowReferences
 
The principal novel findings of the present study are that GM-CSF is expressed in histologically normal and atherosclerotic human coronary arteries and that subpopulations of SMCs form an important source of this cytokine. These conclusions, which are based on comprehensive experimental data from in situ hybridization backed by PCR and Northern analyses, together with dual in situ hybridization/immuno–cell marking and electron microscopic immunocytochemistry, significantly extend findings of previous studies. Although GM-CSF expression has previously been reported in a range of cultured human cell types relevant to atherogenesis29–31 and in atheromatous aortic lesions of cholesterol-fed rabbits,24 cultured SMCs were reported to express GM-CSF only after stimulation with other cytokines,32 and in the rabbit model, no SMC GM-CSF production was detectable in control arteries.24 Our results, in contrast, indicate that GM-CSF is constitutively expressed in nonstimulated cultures of human coronary arterial SMCs and that intimal SMCs in the histologically normal as well as the diseased human coronary artery are significant producers of the cytokine. Although the prevalence of atherosclerosis makes it impossible to rule out the absence of incipient disease in the arterial samples classified as normal in our study, histological assessment provides a more rigorous test of absence from disease than do clinical, physiological, or symptomatic criteria, and the samples may therefore be regarded as typical of the disease-free state in the adult human population.

Comparison of our GM-CSF data from human atherosclerosis with that previously reported from the rabbit model24 must be interpreted with reference to arterial architecture. The human coronary artery, in contrast to the arteries of rabbits and other small mammals, characteristically has a thickened intima containing SMCs that differ in morphology and gene expression from SMCs of the media; these intimal cells characteristically show epithelioid or synthetic characteristics, particularly toward the luminal side of the vessel.42–44 It is in this specific subpopulation of cells, of which there is no counterpart in the normal rabbit artery, that particularly pronounced GM-CSF expression was detected in the present study. A GM-CSF–secreting subpopulation of SMCs in this location is strategically placed to exert a marked proatherogenic stimulus, augmenting that of the scattered GM-CSF–positive endothelial cells.

The presence of such a potential inbuilt proatherogenic stimulus in histologically normal coronary artery might seem at odds with the absence of overt disease in these normal control samples. However, our demonstration by electron microscopic immunocytochemistry of the undiseased arteries that GM-CSF is predominantly confined within the SMCs is consistent with a large potential reservoir of the cytokine, which may progressively be released as the lesion progresses. The localization of GM-CSF to the cytoplasmic matrix rather than to membrane-bound secretory organelles as in some cell types45 indicates that release of GM-CSF from the SMC is mediated not by classic exocytosis but by other mechanisms, such as structural damage to or blebbing of the plasma membrane or death and disintegration of the cell following apoptosis.46 The low quantity of GM-CSF labeled in the extracellular matrix in all samples is consistent with the known biological activity of the cytokine, whose effects are known to be mediated at extremely low doses, at the limits of detectability by immunocytochemistry.

In keeping with our in situ hybridization and immunocytochemical findings on histologically normal and atherosclerotic arterial tissue, in situ hybridization, RT-PCR, and Northern blot analyses of cultured SMCs (isolated from both sources) revealed comparable levels of expression of GM-CSF mRNA over three subcultivations, with markedly increased expression on dedifferentiation to an activated synthetic phenotype (ie, conditions corresponding to those prevailing in the atherosclerotic plaque). Apart from SMCs, our in situ hybridization studies of tissue sections demonstrate that the GM-CSF gene is expressed in some endothelial cells of the undiseased human coronary artery and that endothelial expression is increased in atherosclerotic lesions. Furthermore, foci of accumulating macrophages in the atherosclerotic lesion show especially abundant GM-CSF expression. Again, the observations on cultured cells accord closely with these data, with RT-PCR analysis of cultured endothelial cells revealing GM-CSF mRNA levels similar to those of SMCs.

The hypothesis that such multiple sources of GM-CSF could act as one of the key regulators of macrophage survival, proliferation, and accumulation in the atherosclerotic lesion has previously been suggested from animal model and cultured cell studies,24,32 and our present findings provide the first evidence of the applicability of this hypothesis to the human lesion. In contrast to M-CSF, which has a selective action on macrophage differentiation and is known to be expressed in rabbit and human atherosclerotic lesions,22–24 GM-CSF additionally affects the differentiation of T lymphocytes, neutrophils, and eosinophils47–50 and stimulates proliferation in a number of nonhemopoietic cell types.51 GM-CSF may therefore act as a polyfunctional regulator in atherogenesis, as part of a "CSF network" involving cytokine-stimulated mesenchymal cells and inflammatory leukocytes, analogous to that postulated for other inflammatory lesions.24,32,51

Within such a framework, GM-CSF production by the endothelium and subendothelial SMCs of the normal arterial vessel wall could play a role in initiation of the inflammatory-type response, with further stimulation of expression as oxidized LDL accumulates,31,52 the resultant activation of inflammatory cells subsequently providing a major source of the cytokine during the progression stage of the disease. This hypothesis is in agreement with our observation that normal cultivated macrophages do not express GM-CSF but that abundant expression occurs in the activated macrophages of the atherosclerotic vessel wall. Finally, intimal SMC-derived GM-CSF could also play an important role as an early stimulus to phenotypic transformation and migration of medial SMCs, and in highly fibrotic atherosclerotic lesions containing few macrophages, subsequent augmentation of these effects could occur by an autocrine mechanism alone.


*    Selected Abbreviations and Acronyms
 
AEC = 3-amino-9-ethylcarbazole
CSF = colony-stimulating factor
DTT = dithiothreitol
FCS = fetal calf serum
GM-CSF = granulocyte-macrophage colony-stimulating factor
Ig = immunoglobulin
IL = interleukin
M-CSF = macrophage colony-stimulating factor
NBT = nitroblue tetrazolium
RT-PCR = reverse transcription–polymerase chain reaction
SMC = smooth muscle cell
TNF = tumor necrosis factor
X-PO4 = 5-bromo-4-chloro-3-indolyl phosphate


*    Acknowledgments
 
This study was supported by the Deutsche Forschungsgemeinschaft (grants SFB 310 and SFB 223) and the British-German Academic Research Collaboration program (project 815). We thank K. Schlattmann, M. Opalka, and B. Milskemper for their technical expertise. Part of this work will be included in the doctoral thesis of C. Koenig.

Received April 25, 1997; accepted July 11, 1997.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Burgess AW, Metcalf D. The nature and action of granulocyte-macrophage colony stimulating factors. Blood. 1980;56:947–958.[Abstract/Free Full Text]
  2. Metcalf D. The granulocyte-macrophage colony-stimulating factors. Science. 1985;229:16–22.[Abstract/Free Full Text]
  3. Metcalf D. The molecular control of cell division, differentiation commitment and maturation into haemopoietic cells. Nature. 1989;339:27–30.[Medline] [Order article via Infotrieve]
  4. Metcalf D. Control of granulocytes and macrophages: molecular, cellular, and clinic aspects. Science. 1992;254:529–533.
  5. Nakata K, Akagawa KS, Fukayama M, Hayashi Y, Kadokura M, Tokunaga T. Granulocyte-macrophage colony-stimulating factor promotes the proliferation of human alveolar macrophages in vitro. J Immunol. 1991;147:1266–1272.[Abstract]
  6. Clark SC, Kamen R. The human hematopoietic colony-stimulating factors. Science. 1987;236:1229–1237.[Abstract/Free Full Text]
  7. Nathan CF. Secretory products of macrophages. J Clin Invest. 1987;79:319–326.
  8. Ölberg F, Botling J, Nilsson K. Macrophages and cytokine network. Transplant Proc. 1993;25:2044–2047.[Medline] [Order article via Infotrieve]
  9. Bussolino F, Colotta F, Bocchietto E, Guglielmetti A, Mantovani A. Recent developments in the cell biology of granulocyte-macrophage colony-stimulating factor and granulocyte colony-stimulating factor: activities on endothelial cells. Int J Clin Res. 1993;23:8–12.
  10. Raivich G, Gerhmann J, Kreutzberg GW. Increase of macrophage colony-stimulating factor and granulocyte-macrophage colony-stimulating factor receptors in the regenerating rat facial nucleus. J Neurosci Res. 1991;30:682–686.[Medline] [Order article via Infotrieve]
  11. Hart MN, Fabry Z, Love-Homan L, Keiner J, Sadewasser KL, Moore SA. Brain microvascular smooth muscle and endothelial cells produce granulocyte macrophage colony-stimulating factor and support colony formation of granulocyte-macrophage-like cells. Am J Pathol. 1992;141:421–427.[Abstract]
  12. Cousins DJ, Staynov DZ, Lee TH. Regulation of interleukin-5 and granulocyte-macrophage colony-stimulating factor expression. Am J Respir Crit Care Med.. 1994;150:S50–S53.
  13. Wissler RW. Theories and new horizons in the pathogenesis of atherosclerosis and the mechanisms of clinical effects. Arch Pathol Lab Med. 1992;116:1281–1291.[Medline] [Order article via Infotrieve]
  14. Nilsson J. Cytokines and smooth muscle cells in atherosclerosis. Cardiovasc Res. 1993;27:1184–1190.[Free Full Text]
  15. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801–809.[Medline] [Order article via Infotrieve]
  16. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791–804.[Medline] [Order article via Infotrieve]
  17. Stemme S, Hansson GK. Immune mechanisms in atherogenesis. Ann Med. 1994;26:141–146.[Medline] [Order article via Infotrieve]
  18. Yokota T, Hansson GK. Immunological mechanisms in atherosclerosis. J Intern Med.. 1995;238:479–489.[Medline] [Order article via Infotrieve]
  19. Aqel NM, Ball RY, Waldmann H, Mitchinson MJ. Identification of macrophages and smooth muscle cells in human atherosclerosis using monoclonal antibodies. J Pathol. 1985;146:197–204.[Medline] [Order article via Infotrieve]
  20. Davies MJ, Thomas AC. Plaque fissuring: the cause of acute myocardial infarction, sudden ischaemic death, and crescendo angina. Br Heart J. 1985;53:363–373.[Free Full Text]
  21. Fuster V, Stein B, Ambrose JA, Badimon L, Badimon JJ, Chesebro JH. Atherosclerotic plaque rupture and thrombosis: evolving concepts. Circulation. 1990;82(suppl II):II-47–II-59.
  22. Clinton SK, Underwood R, Hayes L, Sherman ML, Kufe DW, Libby P. Macrophage colony-stimulating factor gene expression in vascular cells and in experimental and human atherosclerosis. Am J Pathol. 1992;140:301–316.[Abstract]
  23. Rosenfeld ME, Ylä-Herttuala S, Lipton BA, Ord VA, Witztum JL, Steinberg D. Macrophage colony-stimulating factor mRNA and protein in atherosclerotic lesions of rabbits and humans. Am J Pathol.. 1992;140:291–300.[Abstract]
  24. Wang J, Wang S, Lu Y, Weng Y, Gown AM. GM-CSF and M-CSF expression is associated with macrophage proliferation in progressing and regressing rabbit atheromatous lesions. Exp Mol Pathol.. 1994;61:109–118.[Medline] [Order article via Infotrieve]
  25. Nimer SD, Champlin R, Golde DW. Serum cholesterol-lowering activity of granulocyte-macrophage colony-stimulating factor. JAMA. 1988;260:3297–3300.[Abstract]
  26. Motoyoshi K, Yoshida K, Hatake K, et al. Recombinant and native human urinary colony-stimulating factor directly augments granulocytic and granulocyte-macrophage colony-stimulating factor production of human peripheral blood monocytes. Exp Hematol.. 1989;17:68–71.[Medline] [Order article via Infotrieve]
  27. Ishibashi T, Yokoyama K, Shindo J, et al. Human granulocyte-macrophage colony-stimulating factor lowers the levels of plasma cholesterol with an increase in mRNA for very low density lipoprotein receptor in rabbits. Ann N Y Acad Sci. 1995;748:630–633.[Medline] [Order article via Infotrieve]
  28. Ishibashi S, Inaba T, Shimano H, et al. Monocyte colony-stimulating factor enhances uptake and degradation of acetylated low density lipoproteins and cholesterol esterification in human monocyte-derived macrophages. J Biol Chem. 1990;265:14109–14117.[Abstract/Free Full Text]
  29. Sieff CA, Niemayer CM, Mentuzer SJ, Faller DV. Interleukin-1, tumor necrosis factor and production of colony stimulating factors by cultured mesenchymal cells. Blood. 1988;72:1316–1323.[Abstract/Free Full Text]
  30. Seelentag W, Mermod JJ, Vassalli P. Interleukin-1 and tumor necrosis factor-{alpha} additively increase the levels of granulocyte-macrophage and granulocyte colony stimulating factor (CSF) mRNA in human fibroblasts. Eur J Immunol. 1989;19:209–212.[Medline] [Order article via Infotrieve]
  31. Rajavashisth TB, Andalibi A, Territo MC, et al. Induction of endothelial cell expression of granulocyte and macrophage colony-stimulating factors by modified low-density lipoproteins. Nature. 1990;344:254–257.[Medline] [Order article via Infotrieve]
  32. Filonzi EL, Zoellner H, Stanton H, Hamilton JA. Cytokine regulation of granulocyte-macrophage colony-stimulating factor and macrophage colony-stimulating factor production in human arterial smooth muscle cells. Atherosclerosis. 1993;99:241–252.[Medline] [Order article via Infotrieve]
  33. Stary HC, Chandler AB, Dinsmore RE, et al. A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis: a report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation. 1995;92:1355–1374.[Abstract/Free Full Text]
  34. Tokuyasu KT. Immunocytochemistry on ultrathin frozen sections. Histochem J. 1980;12:381–403.[Medline] [Order article via Infotrieve]
  35. Völker W, Frick B, Robenek H. A simple device for low temperature polymerization of Lowicryl K4M resin. J Microsc.. 1985;138:91–93.
  36. Campbell GR, Campbell JH. The phenotypes of smooth muscle cells expressed in human atheroma. Ann N Y Acad Sci. 1990;598:143–158.[Medline] [Order article via Infotrieve]
  37. Owens KG. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev. 1995;75:487–509.[Abstract/Free Full Text]
  38. Thie M, Schlumberger W, Semich R, Rauterberg J, Robenek H. Aortic smooth muscle cells in collagen lattice culture: effects on ultrastructure, proliferation and collagen synthesis. Eur J Cell Biol. 1991;55:295–304.[Medline] [Order article via Infotrieve]
  39. Plenz G, Gan Y, Raabe HM, Müller PK. Expression of vigilin in chicken cartilage and bone. Cell Tissue Res. 1993;273:381–389.[Medline] [Order article via Infotrieve]
  40. Chirgwin JM, Przbyla AE, MacDonald E, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry. 1979;18:5294–5299.[Medline] [Order article via Infotrieve]
  41. Loffler JA, Plenz G, Siegert R, Weerda H, Muller PK. Experimental tissue expansion induces changes in expression of procollagen I and III messenger RNA. Eur Arch Otorhinolaryngol. 1995;252:475–477.[Medline] [Order article via Infotrieve]
  42. Severs NJ, Robenek H. Constituents of the arterial wall and atherosclerotic plaque: an introduction to atherosclerosis. In: Robenek H, Severs NJ, eds. Cell Interactions in Atherosclerosis. Boca Raton, Fla: CRC Press; 1992:1–49.
  43. Stary HC, Blankenhorn DH, Chandler AB, et al. Special report: a definition of the intima of human arteries and of its atherosclerosis-prone regions. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation. 1992;85:391–405.[Free Full Text]
  44. Schwartz SM, DeBlois D, O'Brien ERM. The intima: soil for atherosclerosis and restenosis. Circ Res. 1995;77:445–465.[Free Full Text]
  45. Levi-Schaffer F, Lacy P, Severs NJ, et al. Association of granulocyte-macrophage colony-stimulating factor with the crystalloid granules of human eosinophils. Blood.. 1995;85:2579–2586.[Abstract/Free Full Text]
  46. Bennett MR, Evan GI, Schwartz SM. Apoptosis of human vascular smooth muscle cells derived from normal vessels and coronary atherosclerotic plaques. J Clin Invest. 1995;95:2266–2274.
  47. Weisbart RH, Golde DW, Clark SC, Wong GG, Gassib JC. Human granulocyte macrophage colony-stimulating factor is a neutrophil activator. Nature. 1985;314:361–364.[Medline] [Order article via Infotrieve]
  48. Donahue RE, Wang EA, Stone DK, et al. Stimulation of haematopoiesis in primates by continuous infusion of recombinant human GM-CSF. Nature. 1986;321:872–875.[Medline] [Order article via Infotrieve]
  49. Welte K, Bonilla MA, Gillio AP, et al. Recombinant human granulocyte colony-stimulating factor: effects on hematopoiesis in normal and cyclophosphamide-treated primates. J Exp Med. 1987;165:941–948.[Abstract/Free Full Text]
  50. Gasson JC. Molecular physiology of granulocyte-macrophage colony-stimulating factor. Blood. 1991;77:1131–1145.[Free Full Text]
  51. Dedhar S, Gaboury L, Galloway P, Eaves C. Human granulocyte-macrophage colony-stimulating factor is a growth factor active on a variety of cell types of nonhemopoietic origin. Proc Natl Acad Sci U S A.. 1988;85:9253–9257.[Abstract/Free Full Text]
  52. Liao F, Berliner JA, Mehrabian M, et al. Minimally modified low density lipoprotein is biologically active in vivo in mice. J Clin Invest. 1991;87:2253–2257.



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
S. W. Waldo, Y. Li, C. Buono, B. Zhao, E. M. Billings, J. Chang, and H. S. Kruth
Heterogeneity of Human Macrophages in Culture and in Atherosclerotic Plaques
Am. J. Pathol., April 1, 2008; 172(4): 1112 - 1126.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Tanimoto, Y. Murata, K.-Y. Wang, M. Tsutsui, K. Kohno, and Y. Sasaguri
Monocyte Chemoattractant Protein-1 Expression Is Enhanced by Granulocyte-Macrophage Colony-stimulating Factor via Jak2-Stat5 Signaling and Inhibited by Atorvastatin in Human Monocytic U937 Cells
J. Biol. Chem., February 22, 2008; 283(8): 4643 - 4651.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
Z. Shaposhnik, X. Wang, M. Weinstein, B. J. Bennett, and A. J. Lusis
Granulocyte Macrophage Colony-Stimulating Factor Regulates Dendritic Cell Content of Atherosclerotic Lesions
Arterioscler. Thromb. Vasc. Biol., March 1, 2007; 27(3): 621 - 627.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
M. Ditiatkovski, B.-H. Toh, and A. Bobik
GM-CSF Deficiency Reduces Macrophage PPAR-{gamma} Expression and Aggravates Atherosclerosis in ApoE-Deficient Mice
Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2337 - 2344.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M. P. Kim, M. Zhou, and L. M. Wahl
Angiotensin II increases human monocyte matrix metalloproteinase-1 through the AT2 receptor and prostaglandin E2: implications for atherosclerotic plaque rupture
J. Leukoc. Biol., July 1, 2005; 78(1): 195 - 201.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
Y. Sasaguri, K.-Y. Wang, A. Tanimoto, M. Tsutsui, H. Ueno, Y. Murata, Y. Kohno, S. Yamada, and H. Ohtsu
Role of Histamine Produced by Bone Marrow-Derived Vascular Cells in Pathogenesis of Atherosclerosis
Circ. Res., May 13, 2005; 96(9): 974 - 981.
[Abstract] [Full Text]