Articles |
From the Department of Cell Biology and Ultrastructure Research, Institute for Arteriosclerosis Research, Münster, Germany (G.P., C.K., H.R.), and Imperial College School of Medicine, National Heart and Lung Institute, Royal Brompton Hospital, London, UK.
Correspondence to Dr Gabriele Plenz, Institute for Arteriosclerosis Research, Department of Cell Biology and Ultrastructure Research, Domagkstr 3, D-48149 Münster, Germany.
| Abstract |
|---|
|
|
|---|
Key Words: granulocyte-macrophage colony-stimulating factor smooth muscle cells human coronary artery atheroma
| Introduction |
|---|
|
|
|---|
Atherosclerosis is essentially an inflammatoryfibroproliferative response of the arterial wall involving a complex set of interconnected events, including endothelial injury, phenotypic alteration of SMCs, accumulation of monocytes, macrophages, and T lymphocytes, and formation of lipid-laden foam cells.1318 The cellular interactions underlying these events are regulated by cytokines and growth factors that are synthesized and released by the constituent cells of the arterial wall (endothelial cells, SMCs, macrophages, and T lymphocytes). Monocytes and macrophages are a major source of foam cells in the atherosclerotic plaque19; the accumulation and death of these cells lead to development of the lipid core, the classic feature of the lesion, which makes it prone to rupture and consequent life-threatening thrombosis.20,21 Key determining events in the pathogenesis of atherosclerosis are thus macrophage activation, proliferation, and survival, processes that are known to be regulated by CSFs.2224
Studies on CSFs in atherosclerosis to date have
centered principally on M-CSF and the
macrophage,22,23 but indirect evidence
implicating GM-CSF as a critical player has steadily mounted. M-CSF and
GM-CSF are reported to lower plasma cholesterol levels in
humans and animals,2527 and M-CSF enhances
uptake and degradation of acetylated LDL and increases
cholesterol esterification in human monocyte-derived
macrophages in vitro.28 A number of
cultured human cell types, including monocytes,
endothelial cells, and fibroblasts, have the capacity
to express GM-CSF in vitro,2931 and GM-CSF
expression in human arterial SMCs in vitro is reportedly
inducible by inflammatory mediators such as IL-1 or
TNF-
.32 In atherosclerotic lesions of
cholesterol-fed rabbits, GM-CSF has been immunolocalized to
macrophages, with low levels reported in
endothelial cells and SMCs.24
Taken together, these findings point to potentially important roles for
GM-CSF in atherogenesis, but in the absence of any data on GM-CSF
expression in the human artery in situ, it has not previously been
possible to assess their significance in human coronary heart
disease.
We investigated GM-CSF expression, at both the mRNA and protein levels, in intact tissue from undiseased and atherosclerotic human coronary arteries. Our findings reveal that GM-CSF is expressed in defined subpopulations of cells in the undiseased artery and that marked upregulation occurs in atherosclerotic lesions. Importantly, subpopulations of SMCs are a potentially significant source of GM-CSF in the human coronary arterial wall.
| Methods |
|---|
|
|
|---|
|
Isolation, Characterization, and Culture of Human
Arterial Smooth Muscle Cells
Endothelium was removed enzymatically from
aortic tissue or coronary arteries, and SMCs were subsequently
released by enzymatic digestion using 3 mg/mL
collagenase and 0.5 mg/mL
elastase.3638 The cells were cultured in DMEM
with 20% fetal bovine serum, 100 U/mL penicillin, 100 mg/mL
streptomycin, and 4 mmol/L L-glutamine. Cells
were routinely used between passages 3 and 6; for longer-term
cultivation experiments, cells up to passage 8 were used. All
components used in cell culture media were tested for endotoxin
contamination using the chromogenic Limulus
amebocyte lysate assay (endotoxin < 60 pg/mL, Endotect).
The purity of the SMC cultures was verified by immunohistochemistry
using specific SMC markers (see below). The decrease of the expression
of SMC-specific myosin during long-term cultivation experiments was
used as a marker for SMC "dedifferentiation," ie, change to the
synthetic phenotype.
Probes and Labeling Procedure
For hybridization, the recombinant cDNA clones hGM-CSF,
containing an insert complementary to the human GM-CSF mRNA (RD
Systems, Bad Nauheim, Germany), and G3PDH (Clontech, Heidelberg,
Germany), complementary to human
glyceraldehyde-3-phosphate dehydrogenase mRNA, were
used. For in vitro transcription, the GM-CSF cDNA was subcloned into a
pGEM vector (pGEM3Z, Promega Biotech, Madison, WI). The in vitro
transcription was performed according to the manufacturer's protocol
with modifications39 using digoxigenin-labeled
UTP.
Northern Blot Analysis
Total RNA was isolated from the cells according to the method of
Chirgwin et al.40 Northern blot analysis
was performed as previously described.41
Detection was performed with a modified detection protocol
(Boehringer Mannheim) and the chemoluminogenic substrate
CSP.
RT-PCR and Southern Blot Analysis
RNA from SMCs (undiseased coronary artery) was used. RNA
from human macrophages and human umbilical vein
endothelial cells was kindly provided by K. Peters
(Münster, Germany). One microgram of total RNA was reverse
transcribed after an initial denaturation step at 65°C for 5 minutes
in a total volume of 20 µL using 10 U/µL of Superscript II RNase
H- reverse transcriptase, 0.4 U/µL
ribonuclease inhibitor (MBI Fermentas GmbH), 25
ng/µL oligo[(dT)1218], 0.5
mmol/L each of dNTP, 5 mmol/L DTT, 1x first-strand
buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L
KCl, and 3 mmol/L MgCl2) freshly
diluted from 5x stock at 37°C for 60 minutes. Samples were heated at
95°C for 5 minutes to terminate reverse transcriptase activity. Total
RT products were subsequently used for PCR amplification.
The RT products (20 µL) were brought to a volume of 50 µL containing 3 mmol of MgCl2, 0.2 mmol/L each of dNTP, 1x buffer (20 mmol/L Tris-HCl, pH 8.4, and 50 mmol/L KCl), 2.5 U of Taq polymerase, and 0.8 µmol/L of both the following upstream and downstream PCR primers for GM-CSF (DNA accession no. X03021, GenBank): CAAGCTTCTGTACAAGCAGGGCCTG (sequence location 1673 to 1690) and GCTCTAGATCCCAGCAGTCAAAGGGG (sequence location 2652 to 2669) (product size, 204 bp). Amplification was carried out in a Biometra UNO thermocycler after an initial denaturation at 94.5°C for 2 minutes for 35 cycles using the following temperature and time profile: denaturation at 94°C for 30 seconds, primer annealing at 58°C for 30 seconds, primer extension at 72°C for 20 seconds, and a final extension of 72°C for 15 minutes. Aliquots of the PCR reaction products (8 µL) were analyzed on a 1% ethidium bromidestained agarose gel in 1 x Tris-borate electrophoresis buffer (90 mmol/L Tris-HCl, 90 mmol/L boric acid, and 2 mmol/L EDTA, pH 8.3) blotted on nylon filters and hybridized as described for Northern hybridization.
In Situ Hybridization
In situ hybridization was performed following methods modified
from those previously described.39 Enzymatically
released SMCs38 from coronary arteries
cultured on coverslips were fixed in 1%
paraformaldehyde; for tissues, paraffin-embedded
sections of material fixed in 4% paraformaldehyde and
cryosections were used. After rehydration, the slides were washed in
PBS and 5x Tris-EDTA buffer and treated with proteinase K (0 to 5.0
µg/mL 5x Tris-EDTA [50 mmol/L Tris-HCl, pH 8.0,
and 5 mmol/L EDTA]) for 10 minutes at room temperature.
The enzymatic digest was stopped with a Tris/glycine solution (50
mmol/L Tris-HCl and 0.2% glycine, pH 7.4). Cells and sections
were postfixed for 10 minutes in 1% or 4%
paraformaldehyde in PBS, washed in PBS, dehydrated in
an ascending series of ethanol, and air dried. Prehybridization was
performed in hybridization solution (50% formamide, 2x sodium
chloride/sodium phosphate/EDTA buffer [SSPE; 180 mmol/L
NaCl, 10 mmol/L
NaH2PO4, 1
mmol/L EDTA, pH 7.7], 10 mmol/L DTT, 2 mg/mL
herring sperm DNA, 200 µg/mL yeast tRNA, and 1 mg/mL
BSA) for 2 hours at 50°C. Before use, probes were heat denatured (10
minutes, 100°C) in hybridization solution. In situ hybridization was
performed either with 0.3 µg of digoxigenin-labeled cRNA-probe per
milliliter (antisense or sense strand of GM-CSF) or with hybridization
solution only at 50°C in a humidified chamber. For the lowest
stringency, buffers containing 2x SSC, and for the highest stringency,
0.1 x SSC, both at 50°C, were used.
Immunological Detection for In Situ Hybridization
Detection was performed with the aid of
anti-digoxigeninalkaline phosphatase according to the manufacturer's
instructions (Boehringer Mannheim). The alkaline phosphatase
staining procedure was performed in the dark for 4 hours or overnight
using NBT (67.5 µg/mL) and X-PO4 (35
µg/mL) as substrates. After a final incubation in Tris-EDTA
buffer (10 mmol/L Tris-HCl, pH 8.0, and 1
mmol/L EDTA) for 5 minutes, coverslips or sections were mounted
with Kaiser's glycerine gelatin.
Immunohistochemical Identification of Cell Types Combined With In
Situ Hybridization
The alkaline phosphatase detection procedure for in situ
hybridization was followed by immunohistochemical detection of
macrophages (mouse anti-human CD 68, clone PG-M1; DAKO,
Hamburg, Germany), endothelial cells (rabbit anti-human
von Willebrand factor; Sigma Chemical Co, Heidelberg, Germany),
or SMC-specific myosin (SM-1 and SM-2 ABC
isoforms,37 mouse anti-human myosin, clone hSM-V,
Sigma) using the peroxidase Vectastain Elite ABC kit according to the
manufacturer's instructions. In addition, because of the possibility
that hSM-V antibody may cross-react with the nonmuscle myosin
variant,37 a second SMC marker, HHF35 (mouse
IgG1, Enzo Diagnostic Inc), which recognizes smooth muscle
/
actin, was used. As secondary antibodies, biotin-conjugated
goat anti-rabbit IgG or horse anti-mouse IgG (Vector Laboratories,
Burlingane, CA) was used. The peroxidase staining procedure was
performed for 20 to 45 minutes at room temperature using AEC (0.2
mg/mL 0.5 mol/L sodium acetate buffer, pH 5.2) as
substrate. The sections were counterstained according to standard
procedures with methylene green and mounted with Kaiser's glycerine
gelatin.
Postembedding Immunogold Electron Microscopy
Immunocytochemical labeling of the ultrathin frozen
sections and the sections of Lowicryl-embedded tissue was performed by
floating grids serially on 10- to 20-µL droplets placed on parafilm
sheets. Pretreatment to block nonspecific binding sites and to quench
aldehydes present on the section surface was carried out with 10%
FCS in PBS (pH 7.4) for 15 minutes (for cryosections) or with 1% BSA
in PBS (pH 7.4) for 15 minutes (for Lowicryl sections). The sections
were incubated with mouse monoclonal anti-human GM-CSF primary antibody
(dilution, 1:150 to 1:250; Genzyme Corp, Cambridge, MA) in 5% FCS/PBS
(cryosections) or 1% BSA/PBS (Lowicryl sections) for 1 hour, followed
by four 5-minute washes in PBS to remove the unbound primary
antibodies. Controls, in which the primary antibody was omitted, were
processed in parallel. Incubation with gold-labeled secondary
antibodies (12-nm colloidal gold AffiniPure goat anti-mouse IgG,
Dianova, Hamburg, Germany) was then carried out for 1 hour, followed by
four 5-minute washes in PBS and five 2-minute rinses in distilled
water. In some experiments, double immunogold labeling, using the
GM-CSF primary antibody and hSM-V (to mark SMCs) was done. In this
case, cryosections incubated with GM-CSF primary antibodies followed by
anti-mouse 12-nm gold-labeled secondary antibodies, as described above,
were then treated with goat anti-mouse antibodies (as a blocking step)
before serial incubation with hSM-V (dilution, 1:100; 1 hour) and 6-nm
gold-labeled anti-mouse secondary antibodies (dilution, 1:20; 30
minutes), with intervening washing steps similar to those used in
single labeling. Omission of hSM-V incubation served as a control.
Before examination, sections were stained with 2% methylcellulose and
0.2% uranyl acetate (cryosections) or in saturated aqueous uranyl
acetate and lead citrate (Lowicryl sections). The grids were examined
with a Philips 201 or 410 electron microscope operated at 60
kV.
| Results |
|---|
|
|
|---|
|
The extent and pattern of GM-CSF mRNA expression in intimal thickenings
and early and advanced atherosclerotic lesions differed from those of
the undiseased vessel. Identical stages of lesion development in
different specimens displayed the same behavior in terms of GM-CSF mRNA
expression and distribution. GM-CSF mRNA-positive cells were observed
in the intima, media, and adventitia, although the distribution of
signal was not uniform and varied during lesion progression. The
endothelium of early lesions showed signal that
resembled that of undiseased vessels, with a small but distinct
increase apparent in advanced lesions (Figs 1
and 2
). In arteries showing minimally
thickened intimas, GM-CSF mRNA signal was unaltered in the intima but
increased in the media, showing uniform distribution extending
throughout the entire medial layer (Fig 1
, d). This GM-CSF mRNA signal
increased with further intimal thickening (Fig 1
, e) and was even more
prominent in overt atherosclerotic lesions (type V) (Fig 2
, a and b).
In overt lesions, GM-CSF mRNA-positive cells were observed scattered
throughout the entire intima. Conspicuous features were the presence of
small groups of particularly strongly positive cells concentrated
immediately beneath the endothelium and large foci of
positive cells deep in the intima, in the region of the plaque core
(Fig 2
, a and b). In contrast to the undiseased artery, signal was
apparent over major regions of the media (Fig 2
, b) and in the
adventitia, where conspicuous expression was apparent in the vasa
vasorum (Fig 2
, c). Further changes in the expression pattern were
observed in the most advanced lesion categories (types VI and VIII). At
this stage, a decline in GM-CSF mRNA signal was observed in both the
medial and intimal SMCs (Fig 2
, e and f). Distinct patches of high
signal intensity remained associated with the lipid-rich core (Fig 2
, e) and thrombi (Fig 2
, f).
|
Immunohistochemical Identification of Cells Expressing GM-CSF
mRNA
Results from in situ hybridization, as described above, permit
localization of GM-CSF mRNA-positive signal within the tissue as a
whole, but the ability to correlate the signal with the specific cell
types of the lesion is limited. To enable unambiguous identification of
the cell types that express GM-CSF mRNA, we combined in situ
hybridization with immunohistochemistry using cell-typespecific
antibodies to permit simultaneous identification of
endothelial cells, SMCs, and macrophages (Figs 3
and 4
).
|
|
Fig 3
shows the results obtained with undiseased arteries. The
subendothelial GM-CSF mRNA expression was clearly
localized to a subpopulation of SMCs in the intima (Fig 3
, a and b).
This localization was observable with both the HHF 35 and hSM-V SMC
markers. The signal in the media, adjacent to the intima, was also
confirmed to be of SMC origin. The GM-CSF mRNA expression attributed to
endothelial cells was confirmed with the
endothelial marker (Fig 3
, c). Macrophages were
not observed in the intima of undiseased arteries but were observed in
the adventitia, where they were found to be GM-CSF mRNA negative (Fig 3
, d).
Fig 4
presents results obtained on atherosclerotic lesions using
the combined in situ hybridization/cell-marking approach. Both SMCs and
macrophages were identified as GM-CSF mRNA-positive cells
within the intima. Examples of GM-CSF mRNA-positive SMCs beneath the
endothelium and scattered throughout the intima are
shown in Fig 4
, a and c. GM-CSF mRNA-positive SMCs were localized to
these sites with both cell markers, indicating expression of both the
SMC-specific myosin and actin by these cells. The two SMC markers also
confirmed the expression of GM-CSF mRNA by medial SMCs (Fig 4
, b). In
both the intima and the media, SMCs that did not express GM-CSF mRNA
were also common. A proportion of intimal GM-CSF mRNA-positive cells
that were not labeled by the SMC marker were demonstrated to be
macrophages (Fig 4
, d through f). In the conspicuous
accumulations of GM-CSF mRNA-positive cells at the plaque base,
macrophages were the most abundant cell type (Fig 4
, d and f),
although some expressing SMCs were also present, as demonstrated in
serial sections stained with each of the cell-type markers (Fig 4
, e
and f). For both macrophages and SMCs, GM-CSF mRNA signal was
observed in both lipid-laden cells and cells that had not accumulated
lipid (not shown). Results with the endothelial marker
confirmed the presence of GM-CSF mRNA in endothelial
cells (not shown). Some GM-CSF mRNA-containing cells did not react with
any of the cell markers; such cells were observed in the vessel lumen,
directly attached to the endothelium, in the intima,
and in the adventitia and were presumed to represent invading
monocytes, granulocytes, T cells, and fibroblasts. High levels of
GM-CSF mRNA were observed in the endothelium and media
of the vasa vasorum.
A summary of the pattern of GM-CSF expression observed during the
different stages of lesion development is given in Table 2
.
|
GM-CSF Expression in the SMC: Cell Culture and Electron
Microscope Immunocytochemistry
To confirm the in situ hybridization/cell-marking results and to
investigate further the SMC as a GM-CSF-producing cell, we conducted
experiments to determine whether cultures of pure SMCs expressed GM-CSF
mRNA and whether GM-CSF protein was detectable at the electron
microscopic level in SMCs of arterial tissue.
In situ hybridization of cultured human SMCs, enzymatically released
from media explants after three passages, demonstrated that GM-CSF mRNA
was constitutively expressed in vitro, in both cells derived from the
undiseased artery and those from atherosclerotic arteries (Fig 5
, a). RT-PCR analysis of the
constituent cell types of the normal vessel wall (Fig 5
, b) revealed
that only SMCs and endothelial cells express GM-CSF
mRNA, both at comparable levels. GM-CSF mRNA was not detected in human
macrophages cultivated under normal cell culture conditions.
When cultured aortic SMCs were maintained for long periods (7 weeks,
seven passages), during which dedifferentiation to a more synthetic
phenotype occurs, a marked elevation in GM-CSF expression was
apparent (Fig 6
).
|
|
In immunogold-labeling studies at the electron microscopic level, SMCs
were readily identifiable by their ultrastructural features. Gold
labeling demonstrated that GM-CSF is a protein localized in the
cytoplasmic matrix of intimal SMCs of the human coronary
artery. In cells from undiseased arteries showing a contractile
phenotype (Fig 7
, a), the
labeling density was uniform over a given cell but varied from one cell
to the next (12 to 40 gold particles/µm2).
Nuclei and mitochondria were devoid of label. The greater part of the
extracellular matrix contained no gold label (Fig 7
, a and b), but
occasional patches of amorphous immunopositive material were detected.
Label in the extracellular matrix was never observed in association
with collagen fibrils (Fig 7
, b and c). Double labeling with GM-CSF and
SMC (hSM-V) primary antibodies and gold markers of different diameters
confirmed the ultrastructural identification of SMCs (Fig 7
, d).
Similar results were observed with ultrathin cryosections and Lowicryl
sections.
|
SMCS of the synthetic phenotype (Fig 8
, a and b) and foam cells of SMC origin
from diseased tissue (Fig 8
, c) revealed a pattern of GM-CSF
localization similar to that of contractile-type cells, with the
protein localized uniformly throughout the cytoplasmic matrix (labeling
densities from 16 to 43 gold particles/µm2).
Label was entirely absent from the Golgi apparatus,
endoplasmic reticulum, vesicles, and other membrane-bound organelles
that are prominent features of the synthetic-state cell (Fig 8
, a and
b); correspondingly, no label was present over lipid droplets,
lysosomes, and cholesterol crystals in SMC foam
cells (Fig 8
, c). The extracellular matrix was largely devoid of label,
although, as in the undiseased tissue, isolated patches of labeling
were observed in association with amorphous noncollagenous material. In
no samples was there evidence of release of GM-CSF by exocytosis or of
endocytic uptake and degradation.
|
The specificity of the labeling patterns was confirmed in sections of control undiseased and diseased tissue (not exposed to primary antibody) run in parallel, which were consistently devoid of gold label.
| Discussion |
|---|
|
|
|---|
Comparison of our GM-CSF data from human atherosclerosis with that previously reported from the rabbit model24 must be interpreted with reference to arterial architecture. The human coronary artery, in contrast to the arteries of rabbits and other small mammals, characteristically has a thickened intima containing SMCs that differ in morphology and gene expression from SMCs of the media; these intimal cells characteristically show epithelioid or synthetic characteristics, particularly toward the luminal side of the vessel.4244 It is in this specific subpopulation of cells, of which there is no counterpart in the normal rabbit artery, that particularly pronounced GM-CSF expression was detected in the present study. A GM-CSFsecreting subpopulation of SMCs in this location is strategically placed to exert a marked proatherogenic stimulus, augmenting that of the scattered GM-CSFpositive endothelial cells.
The presence of such a potential inbuilt proatherogenic stimulus in histologically normal coronary artery might seem at odds with the absence of overt disease in these normal control samples. However, our demonstration by electron microscopic immunocytochemistry of the undiseased arteries that GM-CSF is predominantly confined within the SMCs is consistent with a large potential reservoir of the cytokine, which may progressively be released as the lesion progresses. The localization of GM-CSF to the cytoplasmic matrix rather than to membrane-bound secretory organelles as in some cell types45 indicates that release of GM-CSF from the SMC is mediated not by classic exocytosis but by other mechanisms, such as structural damage to or blebbing of the plasma membrane or death and disintegration of the cell following apoptosis.46 The low quantity of GM-CSF labeled in the extracellular matrix in all samples is consistent with the known biological activity of the cytokine, whose effects are known to be mediated at extremely low doses, at the limits of detectability by immunocytochemistry.
In keeping with our in situ hybridization and immunocytochemical findings on histologically normal and atherosclerotic arterial tissue, in situ hybridization, RT-PCR, and Northern blot analyses of cultured SMCs (isolated from both sources) revealed comparable levels of expression of GM-CSF mRNA over three subcultivations, with markedly increased expression on dedifferentiation to an activated synthetic phenotype (ie, conditions corresponding to those prevailing in the atherosclerotic plaque). Apart from SMCs, our in situ hybridization studies of tissue sections demonstrate that the GM-CSF gene is expressed in some endothelial cells of the undiseased human coronary artery and that endothelial expression is increased in atherosclerotic lesions. Furthermore, foci of accumulating macrophages in the atherosclerotic lesion show especially abundant GM-CSF expression. Again, the observations on cultured cells accord closely with these data, with RT-PCR analysis of cultured endothelial cells revealing GM-CSF mRNA levels similar to those of SMCs.
The hypothesis that such multiple sources of GM-CSF could act as one of the key regulators of macrophage survival, proliferation, and accumulation in the atherosclerotic lesion has previously been suggested from animal model and cultured cell studies,24,32 and our present findings provide the first evidence of the applicability of this hypothesis to the human lesion. In contrast to M-CSF, which has a selective action on macrophage differentiation and is known to be expressed in rabbit and human atherosclerotic lesions,2224 GM-CSF additionally affects the differentiation of T lymphocytes, neutrophils, and eosinophils4750 and stimulates proliferation in a number of nonhemopoietic cell types.51 GM-CSF may therefore act as a polyfunctional regulator in atherogenesis, as part of a "CSF network" involving cytokine-stimulated mesenchymal cells and inflammatory leukocytes, analogous to that postulated for other inflammatory lesions.24,32,51
Within such a framework, GM-CSF production by the endothelium and subendothelial SMCs of the normal arterial vessel wall could play a role in initiation of the inflammatory-type response, with further stimulation of expression as oxidized LDL accumulates,31,52 the resultant activation of inflammatory cells subsequently providing a major source of the cytokine during the progression stage of the disease. This hypothesis is in agreement with our observation that normal cultivated macrophages do not express GM-CSF but that abundant expression occurs in the activated macrophages of the atherosclerotic vessel wall. Finally, intimal SMC-derived GM-CSF could also play an important role as an early stimulus to phenotypic transformation and migration of medial SMCs, and in highly fibrotic atherosclerotic lesions containing few macrophages, subsequent augmentation of these effects could occur by an autocrine mechanism alone.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received April 25, 1997; accepted July 11, 1997.
| References |
|---|
|
|
|---|
2.
Metcalf D. The granulocyte-macrophage
colony-stimulating factors. Science. 1985;229:1622.
3. Metcalf D. The molecular control of cell division, differentiation commitment and maturation into haemopoietic cells. Nature. 1989;339:2730.[Medline] [Order article via Infotrieve]
4. Metcalf D. Control of granulocytes and macrophages: molecular, cellular, and clinic aspects. Science. 1992;254:529533.
5. Nakata K, Akagawa KS, Fukayama M, Hayashi Y, Kadokura M, Tokunaga T. Granulocyte-macrophage colony-stimulating factor promotes the proliferation of human alveolar macrophages in vitro. J Immunol. 1991;147:12661272.[Abstract]
6.
Clark SC, Kamen R. The human hematopoietic
colony-stimulating factors. Science. 1987;236:12291237.
7. Nathan CF. Secretory products of macrophages. J Clin Invest. 1987;79:319326.
8. Ölberg F, Botling J, Nilsson K. Macrophages and cytokine network. Transplant Proc. 1993;25:20442047.[Medline] [Order article via Infotrieve]
9. Bussolino F, Colotta F, Bocchietto E, Guglielmetti A, Mantovani A. Recent developments in the cell biology of granulocyte-macrophage colony-stimulating factor and granulocyte colony-stimulating factor: activities on endothelial cells. Int J Clin Res. 1993;23:812.
10. Raivich G, Gerhmann J, Kreutzberg GW. Increase of macrophage colony-stimulating factor and granulocyte-macrophage colony-stimulating factor receptors in the regenerating rat facial nucleus. J Neurosci Res. 1991;30:682686.[Medline] [Order article via Infotrieve]
11. Hart MN, Fabry Z, Love-Homan L, Keiner J, Sadewasser KL, Moore SA. Brain microvascular smooth muscle and endothelial cells produce granulocyte macrophage colony-stimulating factor and support colony formation of granulocyte-macrophage-like cells. Am J Pathol. 1992;141:421427.[Abstract]
12. Cousins DJ, Staynov DZ, Lee TH. Regulation of interleukin-5 and granulocyte-macrophage colony-stimulating factor expression. Am J Respir Crit Care Med.. 1994;150:S50S53.
13. Wissler RW. Theories and new horizons in the pathogenesis of atherosclerosis and the mechanisms of clinical effects. Arch Pathol Lab Med. 1992;116:12811291.[Medline] [Order article via Infotrieve]
14.
Nilsson J. Cytokines and smooth muscle cells in
atherosclerosis. Cardiovasc Res. 1993;27:11841190.
15. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801809.[Medline] [Order article via Infotrieve]
16. Ross R. Cell biology of atherosclerosis. Annu Rev Physiol. 1995;57:791804.[Medline] [Order article via Infotrieve]
17. Stemme S, Hansson GK. Immune mechanisms in atherogenesis. Ann Med. 1994;26:141146.[Medline] [Order article via Infotrieve]
18. Yokota T, Hansson GK. Immunological mechanisms in atherosclerosis. J Intern Med.. 1995;238:479489.[Medline] [Order article via Infotrieve]
19. Aqel NM, Ball RY, Waldmann H, Mitchinson MJ. Identification of macrophages and smooth muscle cells in human atherosclerosis using monoclonal antibodies. J Pathol. 1985;146:197204.[Medline] [Order article via Infotrieve]
20.
Davies MJ, Thomas AC. Plaque fissuring: the cause
of acute myocardial infarction, sudden ischaemic death, and crescendo
angina. Br Heart J. 1985;53:363373.
21. Fuster V, Stein B, Ambrose JA, Badimon L, Badimon JJ, Chesebro JH. Atherosclerotic plaque rupture and thrombosis: evolving concepts. Circulation. 1990;82(suppl II):II-47II-59.
22. Clinton SK, Underwood R, Hayes L, Sherman ML, Kufe DW, Libby P. Macrophage colony-stimulating factor gene expression in vascular cells and in experimental and human atherosclerosis. Am J Pathol. 1992;140:301316.[Abstract]
23. Rosenfeld ME, Ylä-Herttuala S, Lipton BA, Ord VA, Witztum JL, Steinberg D. Macrophage colony-stimulating factor mRNA and protein in atherosclerotic lesions of rabbits and humans. Am J Pathol.. 1992;140:291300.[Abstract]
24. Wang J, Wang S, Lu Y, Weng Y, Gown AM. GM-CSF and M-CSF expression is associated with macrophage proliferation in progressing and regressing rabbit atheromatous lesions. Exp Mol Pathol.. 1994;61:109118.[Medline] [Order article via Infotrieve]
25.
Nimer SD, Champlin R, Golde DW. Serum
cholesterol-lowering activity of
granulocyte-macrophage colony-stimulating factor.
JAMA. 1988;260:32973300.
26. Motoyoshi K, Yoshida K, Hatake K, et al. Recombinant and native human urinary colony-stimulating factor directly augments granulocytic and granulocyte-macrophage colony-stimulating factor production of human peripheral blood monocytes. Exp Hematol.. 1989;17:6871.[Medline] [Order article via Infotrieve]
27. Ishibashi T, Yokoyama K, Shindo J, et al. Human granulocyte-macrophage colony-stimulating factor lowers the levels of plasma cholesterol with an increase in mRNA for very low density lipoprotein receptor in rabbits. Ann N Y Acad Sci. 1995;748:630633.[Medline] [Order article via Infotrieve]
28.
Ishibashi S, Inaba T, Shimano H, et al. Monocyte
colony-stimulating factor enhances uptake and degradation of
acetylated low density lipoproteins and cholesterol
esterification in human monocyte-derived macrophages.
J Biol Chem. 1990;265:1410914117.
29.
Sieff CA, Niemayer CM, Mentuzer SJ, Faller DV.
Interleukin-1, tumor necrosis factor and production of colony
stimulating factors by cultured mesenchymal cells. Blood. 1988;72:13161323.
30.
Seelentag W, Mermod JJ, Vassalli P. Interleukin-1 and
tumor necrosis factor-
additively increase the levels of
granulocyte-macrophage and granulocyte colony stimulating
factor (CSF) mRNA in human fibroblasts. Eur J Immunol. 1989;19:209212.[Medline]
[Order article via Infotrieve]
31. Rajavashisth TB, Andalibi A, Territo MC, et al. Induction of endothelial cell expression of granulocyte and macrophage colony-stimulating factors by modified low-density lipoproteins. Nature. 1990;344:254257.[Medline] [Order article via Infotrieve]
32. Filonzi EL, Zoellner H, Stanton H, Hamilton JA. Cytokine regulation of granulocyte-macrophage colony-stimulating factor and macrophage colony-stimulating factor production in human arterial smooth muscle cells. Atherosclerosis. 1993;99:241252.[Medline] [Order article via Infotrieve]
33.
Stary HC, Chandler AB, Dinsmore RE, et al. A definition
of advanced types of atherosclerotic lesions and a
histological classification of
atherosclerosis: a report from the Committee on
Vascular Lesions of the Council on
Arteriosclerosis, American Heart Association.
Circulation. 1995;92:13551374.
34. Tokuyasu KT. Immunocytochemistry on ultrathin frozen sections. Histochem J. 1980;12:381403.[Medline] [Order article via Infotrieve]
35. Völker W, Frick B, Robenek H. A simple device for low temperature polymerization of Lowicryl K4M resin. J Microsc.. 1985;138:9193.
36. Campbell GR, Campbell JH. The phenotypes of smooth muscle cells expressed in human atheroma. Ann N Y Acad Sci. 1990;598:143158.[Medline] [Order article via Infotrieve]
37.
Owens KG. Regulation of differentiation of vascular
smooth muscle cells. Physiol Rev. 1995;75:487509.
38. Thie M, Schlumberger W, Semich R, Rauterberg J, Robenek H. Aortic smooth muscle cells in collagen lattice culture: effects on ultrastructure, proliferation and collagen synthesis. Eur J Cell Biol. 1991;55:295304.[Medline] [Order article via Infotrieve]
39. Plenz G, Gan Y, Raabe HM, Müller PK. Expression of vigilin in chicken cartilage and bone. Cell Tissue Res. 1993;273:381389.[Medline] [Order article via Infotrieve]
40. Chirgwin JM, Przbyla AE, MacDonald E, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry. 1979;18:52945299.[Medline] [Order article via Infotrieve]
41. Loffler JA, Plenz G, Siegert R, Weerda H, Muller PK. Experimental tissue expansion induces changes in expression of procollagen I and III messenger RNA. Eur Arch Otorhinolaryngol. 1995;252:475477.[Medline] [Order article via Infotrieve]
42. Severs NJ, Robenek H. Constituents of the arterial wall and atherosclerotic plaque: an introduction to atherosclerosis. In: Robenek H, Severs NJ, eds. Cell Interactions in Atherosclerosis. Boca Raton, Fla: CRC Press; 1992:149.
43.
Stary HC, Blankenhorn DH, Chandler AB, et al. Special
report: a definition of the intima of human arteries and of its
atherosclerosis-prone regions. A report from the
Committee on Vascular Lesions of the Council on
Arteriosclerosis, American Heart Association.
Circulation. 1992;85:391405.
44.
Schwartz SM, DeBlois D, O'Brien ERM. The intima: soil
for atherosclerosis and restenosis. Circ
Res. 1995;77:445465.
45.
Levi-Schaffer F, Lacy P, Severs NJ, et al. Association
of granulocyte-macrophage colony-stimulating factor with the
crystalloid granules of human eosinophils. Blood.. 1995;85:25792586.
46. Bennett MR, Evan GI, Schwartz SM. Apoptosis of human vascular smooth muscle cells derived from normal vessels and coronary atherosclerotic plaques. J Clin Invest. 1995;95:22662274.
47. Weisbart RH, Golde DW, Clark SC, Wong GG, Gassib JC. Human granulocyte macrophage colony-stimulating factor is a neutrophil activator. Nature. 1985;314:361364.[Medline] [Order article via Infotrieve]
48. Donahue RE, Wang EA, Stone DK, et al. Stimulation of haematopoiesis in primates by continuous infusion of recombinant human GM-CSF. Nature. 1986;321:872875.[Medline] [Order article via Infotrieve]
49.
Welte K, Bonilla MA, Gillio AP, et al. Recombinant
human granulocyte colony-stimulating factor: effects on hematopoiesis
in normal and cyclophosphamide-treated primates. J Exp Med. 1987;165:941948.
50.
Gasson JC. Molecular physiology of
granulocyte-macrophage colony-stimulating factor.
Blood. 1991;77:11311145.
51.
Dedhar S, Gaboury L, Galloway P, Eaves C. Human
granulocyte-macrophage colony-stimulating factor is a growth
factor active on a variety of cell types of nonhemopoietic origin.
Proc Natl Acad Sci U S A.. 1988;85:92539257.
52. Liao F, Berliner JA, Mehrabian M, et al. Minimally modified low density lipoprotein is biologically active in vivo in mice. J Clin Invest. 1991;87:22532257.
This article has been cited by other articles:
![]() |
S. W. Waldo, Y. Li, C. Buono, B. Zhao, E. M. Billings, J. Chang, and H. S. Kruth Heterogeneity of Human Macrophages in Culture and in Atherosclerotic Plaques Am. J. Pathol., April 1, 2008; 172(4): 1112 - 1126. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tanimoto, Y. Murata, K.-Y. Wang, M. Tsutsui, K. Kohno, and Y. Sasaguri Monocyte Chemoattractant Protein-1 Expression Is Enhanced by Granulocyte-Macrophage Colony-stimulating Factor via Jak2-Stat5 Signaling and Inhibited by Atorvastatin in Human Monocytic U937 Cells J. Biol. Chem., February 22, 2008; 283(8): 4643 - 4651. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Shaposhnik, X. Wang, M. Weinstein, B. J. Bennett, and A. J. Lusis Granulocyte Macrophage Colony-Stimulating Factor Regulates Dendritic Cell Content of Atherosclerotic Lesions Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): 621 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ditiatkovski, B.-H. Toh, and A. Bobik GM-CSF Deficiency Reduces Macrophage PPAR-{gamma} Expression and Aggravates Atherosclerosis in ApoE-Deficient Mice Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2337 - 2344. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Kim, M. Zhou, and L. M. Wahl Angiotensin II increases human monocyte matrix metalloproteinase-1 through the AT2 receptor and prostaglandin E2: implications for atherosclerotic plaque rupture J. Leukoc. Biol., July 1, 2005; 78(1): 195 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sasaguri, K.-Y. Wang, A. Tanimoto, M. Tsutsui, H. Ueno, Y. Murata, Y. Kohno, S. Yamada, and H. Ohtsu Role of Histamine Produced by Bone Marrow-Derived Vascular Cells in Pathogenesis of Atherosclerosis Circ. Res., May 13, 2005; 96(9): 974 - 981. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Murata, A. Tanimoto, K.-Y. Wang, M. Tsutsui, Y. Sasaguri, F. De Corte, and H. Matsushita Granulocyte Macrophage-Colony Stimulating Factor Increases the Expression of Histamine and Histamine Receptors in Monocytes/Macrophages in Relation to Arteriosclerosis Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 430 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Stolle, B. Weitkamp, J. Rauterberg, S. Lorkowski, and P. Cullen Laser Microdissection-based Analysis of mRNA Expression in Human Coronary Arteries with Intimal Thickening J. Histochem. Cytochem., November 1, 2004; 52(11): 1511 - 1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. PLENZ, H. ESCHERT, S. BEISSERT, V. ARPS, J. R. SINDERMANN, H. ROBENEK, and W. VOLKER Alterations in the vascular extracellular matrix of granulocyte macrophage colony-stimulating factor (GM-CSF) -deficient mice FASEB J, August 1, 2003; 17(11): 1451 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Idel, P. Ellinghaus, C. Wolfrum, J.-R. Nofer, J. Gloerich, G. Assmann, F. Spener, and U. Seedorf Branched Chain Fatty Acids Induce Nitric Oxide-dependent Apoptosis in Vascular Smooth Muscle Cells J. Biol. Chem., December 13, 2002; 277(51): 49319 - 49325. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Sindermann, P. Babij, J. C. Klink, C. Kobbert, G. Plenz, J. Ebbing, L. Fan, and K. L. March Smooth muscle-specific expression of SV40 large TAg induces SMC proliferation causing adaptive arterial remodeling Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2714 - H2724. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. G. Athyros, A. A. Papageorgiou, V. V. Athyrou, D. S. Demitriadis, and A. G. Kontopoulos Atorvastatin and Micronized Fenofibrate Alone and in Combination in Type 2 Diabetes With Combined Hyperlipidemia Diabetes Care, July 1, 2002; 25(7): 1198 - 1202. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Plenz, H. Eschert, M. Erren, T. Wichter, M. Bohm, M. Flesch, H. H. Scheld, and M. C. Deng The interleukin-6/interleukin-6-receptorsystem is activated in donor hearts J. Am. Coll. Cardiol., May 1, 2002; 39(9): 1508 - 1512. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Plenz, Z. F. Song, T. D.T. Tjan, C. Koenig, H. A. Baba, M. Erren, M. Flesch, T. Wichter, H. H. Scheld, and M. C. Deng Activation of the cardiac interleukin-6 system in advanced heart failure Eur J Heart Fail, August 1, 2001; 3(4): 415 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sugiyama, Y. Okada, G. K. Sukhova, R. Virmani, J. W. Heinecke, and P. Libby Macrophage Myeloperoxidase Regulation by Granulocyte Macrophage Colony-Stimulating Factor in Human Atherosclerosis and Implications in Acute Coronary Syndromes Am. J. Pathol., March 1, 2001; 158(3): 879 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Parhofer, P. H. R. Barrett, and P. Schwandt Atorvastatin Improves Postprandial Lipoprotein Metabolism in Normolipidemic Subjects J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4224 - 4230. [Abstract] [Full Text] |
||||
![]() |
T. Saitoh, H. Kishida, Y. Tsukada, Y. Fukuma, J. Sano, M. Yasutake, N. Fukuma, Y. Kusama, and H. Hayakawa Clinical significance of increased plasma concentration of macrophage colony-stimulating factor in patients with angina pectoris J. Am. Coll. Cardiol., March 1, 2000; 35(3): 655 - 665. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Plenz, A. Dorszewski, W. Volker, Y. S. Ko, N. J. Severs, G. Breithardt, and H. Robenek Cholesterol-Induced Changes of Type VIII Collagen Expression and Distribution in Carotid Arteries of Rabbit Arterioscler Thromb Vasc Biol, October 1, 1999; 19(10): 2395 - 2404. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Plenz, S. Reichenberg, C. Koenig, J. Rauterberg, M. C. Deng, H. A. Baba, and H. Robenek Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) Modulates the Expression of Type VIII Collagen mRNA in Vascular Smooth Muscle Cells and Both Are Codistributed During Atherogenesis Arterioscler Thromb Vasc Biol, July 1, 1999; 19(7): 1658 - 1668. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Ko, H.-I Yeh, M. Haw, E. Dupont, R. Kaba, G. Plenz, H. Robenek, and N. J. Severs Differential Expression of Connexin43 and Desmin Defines Two Subpopulations of Medial Smooth Muscle Cells in the Human Internal Mammary Artery Arterioscler Thromb Vasc Biol, July 1, 1999; 19(7): 1669 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Plenz, A. Dorszewski, G. Breithardt, and H. Robenek Expression of Type VIII Collagen After Cholesterol Diet and Injury in the Rabbit Model of Atherosclerosis Arterioscler Thromb Vasc Biol, May 1, 1999; 19(5): 1201 - 1209. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |