Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:2489-2499
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1997;17:2489-2499.)
© 1997 American Heart Association, Inc.
Smooth Muscle Cells Express Granulocyte-Macrophage Colony-Stimulating Factor in the Undiseased and Atherosclerotic Human Coronary Artery
Gabriele Plenz;
Carsten Koenig;
Nicholas J. Severs;
;
Horst Robenek
From the Department of Cell Biology and Ultrastructure Research,
Institute for Arteriosclerosis Research, Münster, Germany (G.P., C.K.,
H.R.), and Imperial College School of Medicine, National Heart and Lung
Institute, Royal Brompton Hospital, London, UK.
Correspondence to Dr Gabriele Plenz, Institute for Arteriosclerosis Research, Department of Cell Biology and Ultrastructure Research, Domagkstr 3, D-48149 Münster, Germany.
 |
Abstract
|
|---|
Abstract Granulocyte-macrophage colony-stimulating
factor (GM-CSF),
one of a family of cytokines that regulate
proliferation in
macrophages and other types of cells, has been
implicated in
the inflammatory-fibroproliferative response of
atherosclerosis.
However, previous studies have been
restricted to cultured cells
and animal models. In the present
study, we investigated GM-CSF
expression in undiseased and
atherosclerotic human coronary
arteries at both the mRNA and
protein levels. Dual in situ hybridization/cell-marking
experiments
demonstrated that subpopulations of intimal smooth
muscle cells (SMCs)
and endothelial cells express the cytokine
in
the histologically normal human coronary artery
and that
augmented expression occurs at these sites, and in
macrophage
accumulations and medial SMCs, in the
atherosclerotic vessel.
Corresponding data were obtained by in situ
hybridization and
reverse transcriptionpolymerase chain reaction and
Northern
analyses of cultured cells. Cultured human
coronary arterial
SMCs showed constitutive
expression of GM-CSF in cells that
had adopted an activated
synthetic phenotype. Electron microscope
immunocytochemistry
revealed that GM-CSF is a protein localized
in the cytoplasmic matrix
of SMCs of both the undiseased and
atherosclerotic vessel wall;
extracellular matrix was largely
unlabeled, with only occasional small
patches of amorphous immunopositive
material. The expression of GM-CSF
by subpopulations of intimal
SMCs in the undiseased artery and the
marked upregulation of
GM-CSF apparent in atherosclerotic lesions
suggest roles for
the cytokine in the cellular events
underlying initiation and
progression of the human atherosclerotic
lesion.
Key Words: granulocyte-macrophage colony-stimulating factor smooth muscle cells human coronary artery atheroma
 |
Introduction
|
|---|
Granulocyte-macrophage
colony-stimulating factor, or GM-CSF,
is a glycoprotein
cytokine that was first characterized for
its ability to
stimulate progenitor hemopoietic cells to proliferate
and differentiate
into mature granulocytes and
macrophages.
1,2 GM-CSF was subsequently
shown to have multiple effects on mature
macrophages and
lymphocytes, notably in immune activation and
in stimulating
proliferation,
35 acting in concert with
other
members of the CSF family (M-CSF, granulocyte CSF, and
IL-3) as a key
mediator in inflammation and host defense.
68
CSFs,
including GM-CSF, are rapidly synthesized by a variety of cell
types
in response to injury, the ensuing accumulation of monocytes
and
macrophages and T lymphocytes in the tissue being the hallmarks
of
the inflammatory response.
4,912
Atherosclerosis is essentially an
inflammatoryfibroproliferative response of the arterial
wall involving a complex set of interconnected events, including
endothelial injury, phenotypic alteration of SMCs,
accumulation of monocytes, macrophages, and T lymphocytes, and
formation of lipid-laden foam cells.1318 The
cellular interactions underlying these events are regulated by
cytokines and growth factors that are synthesized and released
by the constituent cells of the arterial wall
(endothelial cells, SMCs, macrophages, and T
lymphocytes). Monocytes and macrophages are a major source of
foam cells in the atherosclerotic plaque19; the
accumulation and death of these cells lead to development of the lipid
core, the classic feature of the lesion, which makes it prone to
rupture and consequent life-threatening
thrombosis.20,21 Key determining events in the
pathogenesis of atherosclerosis are thus
macrophage activation, proliferation, and survival, processes
that are known to be regulated by CSFs.2224
Studies on CSFs in atherosclerosis to date have
centered principally on M-CSF and the
macrophage,22,23 but indirect evidence
implicating GM-CSF as a critical player has steadily mounted. M-CSF and
GM-CSF are reported to lower plasma cholesterol levels in
humans and animals,2527 and M-CSF enhances
uptake and degradation of acetylated LDL and increases
cholesterol esterification in human monocyte-derived
macrophages in vitro.28 A number of
cultured human cell types, including monocytes,
endothelial cells, and fibroblasts, have the capacity
to express GM-CSF in vitro,2931 and GM-CSF
expression in human arterial SMCs in vitro is reportedly
inducible by inflammatory mediators such as IL-1 or
TNF-
.32 In atherosclerotic lesions of
cholesterol-fed rabbits, GM-CSF has been immunolocalized to
macrophages, with low levels reported in
endothelial cells and SMCs.24
Taken together, these findings point to potentially important roles for
GM-CSF in atherogenesis, but in the absence of any data on GM-CSF
expression in the human artery in situ, it has not previously been
possible to assess their significance in human coronary heart
disease.
We investigated GM-CSF expression, at both the mRNA and protein levels,
in intact tissue from undiseased and atherosclerotic human
coronary arteries. Our findings reveal that GM-CSF is expressed
in defined subpopulations of cells in the undiseased artery and that
marked upregulation occurs in atherosclerotic lesions. Importantly,
subpopulations of SMCs are a potentially significant source of GM-CSF
in the human coronary arterial wall.
 |
Methods
|
|---|
Patients, Samples, and Tissue Preparation
Human coronary artery specimens were obtained from the
explanted
hearts of male patients undergoing cardiac transplantation
and
from tissue discarded during surgical operations, as detailed
in
Table 1

. The protocol used for this study
fulfilled local
ethical requirements. Undiseased arterial
samples were obtained
from 7 patients (n=7), and atherosclerotic
samples were obtained
from 18 patients (adaptive thickening, n=4;
preatheroma, type
II and III lesions, n = 5;
atheroma and fibroatheroma, type
IV and V
lesions, n=14; complicated lesion, n=4; and type VIII
lesion,
n=3).
33 Immediately on removal of the heart or
excision
of surgical tissue, coronary artery samples from
proximal areas
of the arteria coronaria dextra and arteria coronaria
sinistra
were either placed in DMEM or prepared for structural studies.
The
latter specimens were either fixed in 4%
paraformaldehyde fixative
in PBS or placed in
cryoprotective medium (Cambridge Instruments)
on small cork disks for
snap-freezing in liquid nitrogen and
subsequent cryosectioning. The
frozen samples were stored at
-80°C until required. The
paraformaldehyde-fixed samples
were trimmed, and
selected areas containing plaques were taken
for electron microscopy.
The remaining tissue was processed
for paraffin embedding following
standard histological procedure.
Two low-denaturation
preparation procedures were used for electron
microscopy and
immunocytochemistry, cryoultramicrotomy according
to the method of
Tokuyasu
34 and embedding at low temperature
in
the acrylic resin Lowicryl K4M following the protocol described
by
Völker et al.
35
Isolation, Characterization, and Culture of Human
Arterial Smooth Muscle Cells
Endothelium was removed enzymatically from
aortic tissue or coronary arteries, and SMCs were subsequently
released by enzymatic digestion using 3 mg/mL
collagenase and 0.5 mg/mL
elastase.3638 The cells were cultured in DMEM
with 20% fetal bovine serum, 100 U/mL penicillin, 100 mg/mL
streptomycin, and 4 mmol/L L-glutamine. Cells
were routinely used between passages 3 and 6; for longer-term
cultivation experiments, cells up to passage 8 were used. All
components used in cell culture media were tested for endotoxin
contamination using the chromogenic Limulus
amebocyte lysate assay (endotoxin < 60 pg/mL, Endotect).
The purity of the SMC cultures was verified by immunohistochemistry
using specific SMC markers (see below). The decrease of the expression
of SMC-specific myosin during long-term cultivation experiments was
used as a marker for SMC "dedifferentiation," ie, change to the
synthetic phenotype.
Probes and Labeling Procedure
For hybridization, the recombinant cDNA clones hGM-CSF,
containing an insert complementary to the human GM-CSF mRNA (RD
Systems, Bad Nauheim, Germany), and G3PDH (Clontech, Heidelberg,
Germany), complementary to human
glyceraldehyde-3-phosphate dehydrogenase mRNA, were
used. For in vitro transcription, the GM-CSF cDNA was subcloned into a
pGEM vector (pGEM3Z, Promega Biotech, Madison, WI). The in vitro
transcription was performed according to the manufacturer's protocol
with modifications39 using digoxigenin-labeled
UTP.
Northern Blot Analysis
Total RNA was isolated from the cells according to the method of
Chirgwin et al.40 Northern blot analysis
was performed as previously described.41
Detection was performed with a modified detection protocol
(Boehringer Mannheim) and the chemoluminogenic substrate
CSP.
RT-PCR and Southern Blot Analysis
RNA from SMCs (undiseased coronary artery) was used. RNA
from human macrophages and human umbilical vein
endothelial cells was kindly provided by K. Peters
(Münster, Germany). One microgram of total RNA was reverse
transcribed after an initial denaturation step at 65°C for 5 minutes
in a total volume of 20 µL using 10 U/µL of Superscript II RNase
H- reverse transcriptase, 0.4 U/µL
ribonuclease inhibitor (MBI Fermentas GmbH), 25
ng/µL oligo[(dT)1218], 0.5
mmol/L each of dNTP, 5 mmol/L DTT, 1x first-strand
buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L
KCl, and 3 mmol/L MgCl2) freshly
diluted from 5x stock at 37°C for 60 minutes. Samples were heated at
95°C for 5 minutes to terminate reverse transcriptase activity. Total
RT products were subsequently used for PCR amplification.
The RT products (20 µL) were brought to a volume of 50 µL
containing 3 mmol of MgCl2, 0.2
mmol/L each of dNTP, 1x buffer (20 mmol/L Tris-HCl,
pH 8.4, and 50 mmol/L KCl), 2.5 U of Taq polymerase, and
0.8 µmol/L of both the following upstream and downstream
PCR primers for GM-CSF (DNA accession no. X03021, GenBank):
CAAGCTTCTGTACAAGCAGGGCCTG (sequence location 1673 to 1690) and
GCTCTAGATCCCAGCAGTCAAAGGGG (sequence location 2652 to 2669)
(product size, 204 bp). Amplification was carried out in a Biometra
UNO thermocycler after an initial denaturation at 94.5°C for 2
minutes for 35 cycles using the following temperature and time profile:
denaturation at 94°C for 30 seconds, primer annealing at 58°C for
30 seconds, primer extension at 72°C for 20 seconds, and a final
extension of 72°C for 15 minutes. Aliquots of the PCR reaction
products (8 µL) were analyzed on a 1% ethidium
bromidestained agarose gel in 1 x Tris-borate electrophoresis
buffer (90 mmol/L Tris-HCl, 90 mmol/L boric
acid, and 2 mmol/L EDTA, pH 8.3) blotted on nylon filters
and hybridized as described for Northern hybridization.
In Situ Hybridization
In situ hybridization was performed following methods modified
from those previously described.39 Enzymatically
released SMCs38 from coronary arteries
cultured on coverslips were fixed in 1%
paraformaldehyde; for tissues, paraffin-embedded
sections of material fixed in 4% paraformaldehyde and
cryosections were used. After rehydration, the slides were washed in
PBS and 5x Tris-EDTA buffer and treated with proteinase K (0 to 5.0
µg/mL 5x Tris-EDTA [50 mmol/L Tris-HCl, pH 8.0,
and 5 mmol/L EDTA]) for 10 minutes at room temperature.
The enzymatic digest was stopped with a Tris/glycine solution (50
mmol/L Tris-HCl and 0.2% glycine, pH 7.4). Cells and sections
were postfixed for 10 minutes in 1% or 4%
paraformaldehyde in PBS, washed in PBS, dehydrated in
an ascending series of ethanol, and air dried. Prehybridization was
performed in hybridization solution (50% formamide, 2x sodium
chloride/sodium phosphate/EDTA buffer [SSPE; 180 mmol/L
NaCl, 10 mmol/L
NaH2PO4, 1
mmol/L EDTA, pH 7.7], 10 mmol/L DTT, 2 mg/mL
herring sperm DNA, 200 µg/mL yeast tRNA, and 1 mg/mL
BSA) for 2 hours at 50°C. Before use, probes were heat denatured (10
minutes, 100°C) in hybridization solution. In situ hybridization was
performed either with 0.3 µg of digoxigenin-labeled cRNA-probe per
milliliter (antisense or sense strand of GM-CSF) or with hybridization
solution only at 50°C in a humidified chamber. For the lowest
stringency, buffers containing 2x SSC, and for the highest stringency,
0.1 x SSC, both at 50°C, were used.
Immunological Detection for In Situ Hybridization
Detection was performed with the aid of
anti-digoxigeninalkaline phosphatase according to the manufacturer's
instructions (Boehringer Mannheim). The alkaline phosphatase
staining procedure was performed in the dark for 4 hours or overnight
using NBT (67.5 µg/mL) and X-PO4 (35
µg/mL) as substrates. After a final incubation in Tris-EDTA
buffer (10 mmol/L Tris-HCl, pH 8.0, and 1
mmol/L EDTA) for 5 minutes, coverslips or sections were mounted
with Kaiser's glycerine gelatin.
Immunohistochemical Identification of Cell Types Combined With In
Situ Hybridization
The alkaline phosphatase detection procedure for in situ
hybridization was followed by immunohistochemical detection of
macrophages (mouse anti-human CD 68, clone PG-M1; DAKO,
Hamburg, Germany), endothelial cells (rabbit anti-human
von Willebrand factor; Sigma Chemical Co, Heidelberg, Germany),
or SMC-specific myosin (SM-1 and SM-2 ABC
isoforms,37 mouse anti-human myosin, clone hSM-V,
Sigma) using the peroxidase Vectastain Elite ABC kit according to the
manufacturer's instructions. In addition, because of the possibility
that hSM-V antibody may cross-react with the nonmuscle myosin
variant,37 a second SMC marker, HHF35 (mouse
IgG1, Enzo Diagnostic Inc), which recognizes smooth muscle
/
actin, was used. As secondary antibodies, biotin-conjugated
goat anti-rabbit IgG or horse anti-mouse IgG (Vector Laboratories,
Burlingane, CA) was used. The peroxidase staining procedure was
performed for 20 to 45 minutes at room temperature using AEC (0.2
mg/mL 0.5 mol/L sodium acetate buffer, pH 5.2) as
substrate. The sections were counterstained according to standard
procedures with methylene green and mounted with Kaiser's glycerine
gelatin.
Postembedding Immunogold Electron Microscopy
Immunocytochemical labeling of the ultrathin frozen
sections and the sections of Lowicryl-embedded tissue was performed by
floating grids serially on 10- to 20-µL droplets placed on parafilm
sheets. Pretreatment to block nonspecific binding sites and to quench
aldehydes present on the section surface was carried out with 10%
FCS in PBS (pH 7.4) for 15 minutes (for cryosections) or with 1% BSA
in PBS (pH 7.4) for 15 minutes (for Lowicryl sections). The sections
were incubated with mouse monoclonal anti-human GM-CSF primary antibody
(dilution, 1:150 to 1:250; Genzyme Corp, Cambridge, MA) in 5% FCS/PBS
(cryosections) or 1% BSA/PBS (Lowicryl sections) for 1 hour, followed
by four 5-minute washes in PBS to remove the unbound primary
antibodies. Controls, in which the primary antibody was omitted, were
processed in parallel. Incubation with gold-labeled secondary
antibodies (12-nm colloidal gold AffiniPure goat anti-mouse IgG,
Dianova, Hamburg, Germany) was then carried out for 1 hour, followed by
four 5-minute washes in PBS and five 2-minute rinses in distilled
water. In some experiments, double immunogold labeling, using the
GM-CSF primary antibody and hSM-V (to mark SMCs) was done. In this
case, cryosections incubated with GM-CSF primary antibodies followed by
anti-mouse 12-nm gold-labeled secondary antibodies, as described above,
were then treated with goat anti-mouse antibodies (as a blocking step)
before serial incubation with hSM-V (dilution, 1:100; 1 hour) and 6-nm
gold-labeled anti-mouse secondary antibodies (dilution, 1:20; 30
minutes), with intervening washing steps similar to those used in
single labeling. Omission of hSM-V incubation served as a control.
Before examination, sections were stained with 2% methylcellulose and
0.2% uranyl acetate (cryosections) or in saturated aqueous uranyl
acetate and lead citrate (Lowicryl sections). The grids were examined
with a Philips 201 or 410 electron microscope operated at 60
kV.
 |
Results
|
|---|
Distribution of GM-CSF mRNA in the Undiseased Arterial
Wall and in Atherosclerotic Lesions
We first compared the overall patterns of GM-CSF mRNA expression
in
undiseased and atherosclerotic arterial samples by in
situ hybridization.
Sections of undiseased vessel consistently
revealed distinct
GM-CSF mRNA-positive cells (Fig 1

, a and b). The hybridization
signal was
most conspicuous in the superficial intimal region.
Expression of
GM-CSF mRNA was apparent in the endothelium and
in
cells that were irregularly scattered in a zone extending
25 to 50
µm beneath the endothelium. The
endothelial signal
was not uniform, however; some
endothelial cells showed weak
expression, and others
showed none at all. Occasional positive
cells were also apparent in the
medial region adjacent to the
intima, although here the overall levels
of signal were lower,
and the major part of the media revealed no
expression (Fig
1

, a and b). Negative controls using labeled sense RNA
were
completely devoid of signal (Fig 1

, c). The pattern of expression
that
was illustrated, although showing minor variation between samples,
was
consistently observed in sections from all patients
examined.

View larger version (169K):
[in this window]
[in a new window]
|
Figure 1. In situ hybridization illustrating the pattern of
GM-CSF mRNA expression in undiseased human coronary artery and
during early lesion development. The in situ hybridization was done on
paraffin sections and cryosections from nonatherosclerotic arteries
(Table 1 , samples 1 to 5, 17, and 23) and early lesions (Table 1 ,
samples 7, 12, 14, 16, 18, 20, and 22) using an antisense GM-CSF
cRNA-probe. a, Survey view. b, Detail at higher magnification. Note the
conspicuous expression of GM-CSF mRNA in some but not all
endothelial cells and in superficial intimal cells
beneath the endothelium. c, Negative control using
digoxigenin-labeled sense cRNA coding for GM-CSF. d, Survey view of an
artery showing minimal intimal thickening. e, Expression in typical
type III and IV lesions. GM-CSF mRNA signal is apparent in
endothelial cells and the
subendothelial region. Prominent signal is also
observed in medial SMCs. Bright-field images of paraffin sections,
original magnification x150 (a), x300 (b and c), x40 (d), and x100
(e). A indicates adventitia; E, endothelium; I, intima;
L, lumen; and M, media. Arrowheads indicate the internal and external
elastic laminae.
|
|
The extent and pattern of GM-CSF mRNA expression in intimal thickenings
and early and advanced atherosclerotic lesions differed from those of
the undiseased vessel. Identical stages of lesion development in
different specimens displayed the same behavior in terms of GM-CSF mRNA
expression and distribution. GM-CSF mRNA-positive cells were observed
in the intima, media, and adventitia, although the distribution of
signal was not uniform and varied during lesion progression. The
endothelium of early lesions showed signal that
resembled that of undiseased vessels, with a small but distinct
increase apparent in advanced lesions (Figs 1
and 2
). In arteries showing minimally
thickened intimas, GM-CSF mRNA signal was unaltered in the intima but
increased in the media, showing uniform distribution extending
throughout the entire medial layer (Fig 1
, d). This GM-CSF mRNA signal
increased with further intimal thickening (Fig 1
, e) and was even more
prominent in overt atherosclerotic lesions (type V) (Fig 2
, a and b).
In overt lesions, GM-CSF mRNA-positive cells were observed scattered
throughout the entire intima. Conspicuous features were the presence of
small groups of particularly strongly positive cells concentrated
immediately beneath the endothelium and large foci of
positive cells deep in the intima, in the region of the plaque core
(Fig 2
, a and b). In contrast to the undiseased artery, signal was
apparent over major regions of the media (Fig 2
, b) and in the
adventitia, where conspicuous expression was apparent in the vasa
vasorum (Fig 2
, c). Further changes in the expression pattern were
observed in the most advanced lesion categories (types VI and VIII). At
this stage, a decline in GM-CSF mRNA signal was observed in both the
medial and intimal SMCs (Fig 2
, e and f). Distinct patches of high
signal intensity remained associated with the lipid-rich core (Fig 2
, e) and thrombi (Fig 2
, f).

View larger version (116K):
[in this window]
[in a new window]
|
Figure 2. In situ hybridization illustrating the typical
pattern of GM-CSF mRNA expression in advanced (type V), complicated
(type VI), and fibrocollagenous (type VIII) lesions. The in situ
hybridization was carried out on paraffin sections and cryosections
from tissue samples 6, 8 to 13, 15, 18, 19, and 21 to 23 (Table 1 )
using an antisense GM-CSF cRNA probe. a and b, Detail from selected
areas of an eccentric lesion. Prominent GM-CSF mRNA signal is apparent
in endothelial cells, the
subendothelial region, and focal areas of the plaque
core and plaque base. Signal is also observed in medial SMCs (b) and in
the vasa vasorum of the adventitia (c), where
endothelial cells and a surrounding ring of medial SMCs
were positive. d, Negative control using digoxigenin-labeled sense cRNA
coding for GM-CSF. In type VI and VIII lesions (e and f), GM-CSF
expression is decreased. Accumulations of GM-CSFexpressing cells were
observed in the core region of the plaque (e) and of thrombus formation
(f). The media is devoid of signal (e) in these advanced lesions.
Bright-field images of cryosections, original magnification x100 (a,
b, and d through f) and x200 (c). A indicates adventitia; E,
endothelium; I, intima; L, lumen; and M, media.
Arrowheads indicate the internal and external elastic laminae.
|
|
Immunohistochemical Identification of Cells Expressing GM-CSF
mRNA
Results from in situ hybridization, as described above, permit
localization of GM-CSF mRNA-positive signal within the tissue as a
whole, but the ability to correlate the signal with the specific cell
types of the lesion is limited. To enable unambiguous identification of
the cell types that express GM-CSF mRNA, we combined in situ
hybridization with immunohistochemistry using cell-typespecific
antibodies to permit simultaneous identification of
endothelial cells, SMCs, and macrophages (Figs 3
and 4
).

View larger version (124K):
[in this window]
[in a new window]
|
Figure 3. Immunohistochemical
identification of GM-CSF mRNA-expressing cells in undiseased arteries.
Immunohistochemistry was performed with cell-typespecific antibodies
after in situ hybridization with antisense GM-CSF cRNA. For in situ
hybridization, detection was with the alkaline
phosphatase/NBTX-PO4 system (dark blue stain); for
immunohistochemistry, detection was with the peroxidase/AEC system (red
stain). Nuclei were counterstained with methylene green (green stain).
Optimal viewing of the in situ hybridization signal in combination with
the cell markers requires adaptation of the procedure to give lower
levels of label intensity than are routinely used in single labeling
experiments. a and b, SMC identification (a, HHF35, mouse monoclonal
anti-human / actin; and b, hSM-V, mouse monoclonal anti-human SMC
myosin). GM-CSF mRNA-expressing SMCs are identified in the intima
(large arrows) and in the area of the media (small arrows) adjacent to
the internal elastic lamina. Identical results were obtained when HHF35
was used as the SMC marker. c, Endothelial cell
identification (rabbit anti-human von Willebrand factor). d,
Macrophages (identified with mouse monoclonal anti-human CD 68)
localized exclusively in the adventitia. These macrophages did
not express GM-CSF mRNA. Bright-field images of cryosections, original
magnification x100 (a) and x250 (b through d). A indicates
adventitia; E, endothelium; I, intima; L, lumen; and M,
media. Arrowheads indicate the internal and external elastic
laminae.
|
|

View larger version (146K):
[in this window]
[in a new window]
|
Figure 4. Immunohistochemical identification of cell types,
combined with GM-CSF mRNA localization by in situ hybridization, in
atherosclerotic lesions. The in situ hybridization used antisense
GM-CSF cRNA probe and was followed by immunohistochemical marking with
SMC-specific antibody hSM-V (a, b, c, and e),
macrophage-specific antibody (d and f), or
endothelial marker (not shown). For in situ
hybridization, detection was with the alkaline
phosphatase/NBTX-PO4 system (dark blue stain); for
immunohistochemistry, detection was with the peroxidase/AEC system (red
stain). a, Survey view of part of a lesion showing SMC marking. The
GM-CSF mRNA signal is seen both colocalized and separately from the SMC
marker, demonstrating that some but not all the GM-CSFpositive cells
of the intima are SMCs. b, Medial SMCs labeled with the SMC marker. A
subpopulation of these cells is seen to express GM-CSF mRNA. c, Detail
of the area shown in a, illustrating SMCs that express GM-CSF (open
arrows). Note that not all SMCs express GM-CSF (arrows) and that other
cells, not labeled with the marker, are GM-CSF mRNApositive (stars).
d, Accumulation of GM-CSF mRNApositive cells at the base of the
plaque, identified as macrophages. e and f, Serial sections
showing a lower-power survey view of the area from which d is taken,
stained with SMC marker (e) and macrophage marker (f). In this
macrophage-rich zone, although most of the GM-CSF mRNA is
colocalized with the macrophage marker, some GM-CSF
mRNApositive SMCs are also present (open arrows). Bright-field
images of cryosections, original magnification x150 (a, b, e, and f)
and x300 (c and d). A indicates adventitia; E,
endothelium; I, intima; L, lumen; and M, media.
Arrowheads indicate the internal and external elastic laminae.
|
|
Fig 3
shows the results obtained with undiseased arteries. The
subendothelial GM-CSF mRNA expression was clearly
localized to a subpopulation of SMCs in the intima (Fig 3
, a and b).
This localization was observable with both the HHF 35 and hSM-V SMC
markers. The signal in the media, adjacent to the intima, was also
confirmed to be of SMC origin. The GM-CSF mRNA expression attributed to
endothelial cells was confirmed with the
endothelial marker (Fig 3
, c). Macrophages were
not observed in the intima of undiseased arteries but were observed in
the adventitia, where they were found to be GM-CSF mRNA negative (Fig 3
, d).
Fig 4
presents results obtained on atherosclerotic lesions using
the combined in situ hybridization/cell-marking approach. Both SMCs and
macrophages were identified as GM-CSF mRNA-positive cells
within the intima. Examples of GM-CSF mRNA-positive SMCs beneath the
endothelium and scattered throughout the intima are
shown in Fig 4
, a and c. GM-CSF mRNA-positive SMCs were localized to
these sites with both cell markers, indicating expression of both the
SMC-specific myosin and actin by these cells. The two SMC markers also
confirmed the expression of GM-CSF mRNA by medial SMCs (Fig 4
, b). In
both the intima and the media, SMCs that did not express GM-CSF mRNA
were also common. A proportion of intimal GM-CSF mRNA-positive cells
that were not labeled by the SMC marker were demonstrated to be
macrophages (Fig 4
, d through f). In the conspicuous
accumulations of GM-CSF mRNA-positive cells at the plaque base,
macrophages were the most abundant cell type (Fig 4
, d and f),
although some expressing SMCs were also present, as demonstrated in
serial sections stained with each of the cell-type markers (Fig 4
, e
and f). For both macrophages and SMCs, GM-CSF mRNA signal was
observed in both lipid-laden cells and cells that had not accumulated
lipid (not shown). Results with the endothelial marker
confirmed the presence of GM-CSF mRNA in endothelial
cells (not shown). Some GM-CSF mRNA-containing cells did not react with
any of the cell markers; such cells were observed in the vessel lumen,
directly attached to the endothelium, in the intima,
and in the adventitia and were presumed to represent invading
monocytes, granulocytes, T cells, and fibroblasts. High levels of
GM-CSF mRNA were observed in the endothelium and media
of the vasa vasorum.
A summary of the pattern of GM-CSF expression observed during the
different stages of lesion development is given in Table 2
.
GM-CSF Expression in the SMC: Cell Culture and Electron
Microscope Immunocytochemistry
To confirm the in situ hybridization/cell-marking results and to
investigate further the SMC as a GM-CSF-producing cell, we conducted
experiments to determine whether cultures of pure SMCs expressed GM-CSF
mRNA and whether GM-CSF protein was detectable at the electron
microscopic level in SMCs of arterial tissue.
In situ hybridization of cultured human SMCs, enzymatically released
from media explants after three passages, demonstrated that GM-CSF mRNA
was constitutively expressed in vitro, in both cells derived from the
undiseased artery and those from atherosclerotic arteries (Fig 5
, a). RT-PCR analysis of the
constituent cell types of the normal vessel wall (Fig 5
, b) revealed
that only SMCs and endothelial cells express GM-CSF
mRNA, both at comparable levels. GM-CSF mRNA was not detected in human
macrophages cultivated under normal cell culture conditions.
When cultured aortic SMCs were maintained for long periods (7 weeks,
seven passages), during which dedifferentiation to a more synthetic
phenotype occurs, a marked elevation in GM-CSF expression was
apparent (Fig 6
).

View larger version (101K):
[in this window]
[in a new window]
|
Figure 5. Demonstration of expression of GM-CSF mRNA by SMCs
and other vascular cell types. a, In situ hybridization demonstrates
GM-CSF mRNA signal in cultured human SMCs isolated from undiseased
coronary artery. SMCs isolated from atherosclerotic arteries
showed a comparable expression pattern (not shown). The area at right,
top, shows detail from the left; the area at right, bottom, shows
negative control using sense cRNA probes. b, RT-PCR analysis
showing the presence of GM-CSF mRNA in normal SMCs (1 and 1'), human
umbilical vein endothelial cells (2 and 2'), and human
macrophages (3 and 3'). The macrophages were derived
from peripheral blood monocytes, differentiated to
macrophages by cultivation in Petri dishes for 7 days in RPMI
1640 supplemented with 20% human serum. Left, Ethidium
bromidestained gel showing RT-PCR products. Right, Luminograph of
a Southern blot analysis (using digoxigenin-labeled antisense
probes for GM-CSF) demonstrating the specificity of the amplification
products.
|
|

View larger version (9K):
[in this window]
[in a new window]
|
Figure 6. Expression of GM-CSF mRNA during long-term
cultivation of SMCs derived from normal human coronary artery.
For each stage, 5 µg of RNA was analyzed by Northern
blotting. For hybridization, a digoxigenin-labeled riboprobe of human
GM-CSF (50 ng/mL) was used. Hybridization was at 70°C overnight.
Northern blots were measured by densitometric scanning. Densitometric
values of GM-CSF mRNA expression were corrected for G3PDH mRNA values.
Corrected values were normalized against the level of expression
determined at the second passage. A marked elevation in GM-CSF
expression is apparent between 6 and 7 weeks, as the cells
dedifferentiate to an activated synthetic phenotype.
Data were confirmed by RT-PCR analysis (not shown).
|
|
In immunogold-labeling studies at the electron microscopic level, SMCs
were readily identifiable by their ultrastructural features. Gold
labeling demonstrated that GM-CSF is a protein localized in the
cytoplasmic matrix of intimal SMCs of the human coronary
artery. In cells from undiseased arteries showing a contractile
phenotype (Fig 7
, a), the
labeling density was uniform over a given cell but varied from one cell
to the next (12 to 40 gold particles/µm2).
Nuclei and mitochondria were devoid of label. The greater part of the
extracellular matrix contained no gold label (Fig 7
, a and b), but
occasional patches of amorphous immunopositive material were detected.
Label in the extracellular matrix was never observed in association
with collagen fibrils (Fig 7
, b and c). Double labeling with GM-CSF and
SMC (hSM-V) primary antibodies and gold markers of different diameters
confirmed the ultrastructural identification of SMCs (Fig 7
, d).
Similar results were observed with ultrathin cryosections and Lowicryl
sections.

View larger version (158K):
[in this window]
[in a new window]
|
Figure 7. Electron micrographs of ultrathin frozen sections
showing immunogold labeling of GM-CSF in normal human coronary
artery. a, SMCs of the contractile phenotype are positively
labeled; portions of two contractile-type cells are shown in this
field, characterized by a cytoplasm (Cyt) filled with contractile
filaments and relatively few membrane-bound organelles. Gold label is
distributed uniformly over the cytoplasmic matrix, at a density that
varies from one cell to the next. Nuclei (N), mitochondria, and other
intracellular organelles are devoid of label. No labeling of the
extracellular matrix (MX) is observed; however, occasional labeling is
apparent elsewhere in the extracellular matrix. b, Abundant collagen
(C) in the extracellular matrix, with no labeling of GM-CSF. c, Groups
of gold particles scattered over electron-dense amorphous material,
again with no label associated with the collagen. d, Double immunogold
labeling using SMC marker (hSM-V) and antiGM-CSF primary antibody is
shown to confirm the identity of the GM-CSFproducing cells. Note the
presence of both sizes of gold particles (arrowhead, 6 nm gold/hSM-V;
and arrow, 12 nm gold/GM-CSF) within the cell. PL indicates plasma
membrane. Bars = 0.5 µm.
|
|
SMCS of the synthetic phenotype (Fig 8
, a and b) and foam cells of SMC origin
from diseased tissue (Fig 8
, c) revealed a pattern of GM-CSF
localization similar to that of contractile-type cells, with the
protein localized uniformly throughout the cytoplasmic matrix (labeling
densities from 16 to 43 gold particles/µm2).
Label was entirely absent from the Golgi apparatus,
endoplasmic reticulum, vesicles, and other membrane-bound organelles
that are prominent features of the synthetic-state cell (Fig 8
, a and
b); correspondingly, no label was present over lipid droplets,
lysosomes, and cholesterol crystals in SMC foam
cells (Fig 8
, c). The extracellular matrix was largely devoid of label,
although, as in the undiseased tissue, isolated patches of labeling
were observed in association with amorphous noncollagenous material. In
no samples was there evidence of release of GM-CSF by exocytosis or of
endocytic uptake and degradation.

View larger version (205K):
[in this window]
[in a new window]
|
Figure 8. a and b, Immunogold labeling of GM-CSF in
synthetic-state SMCs. The label is seen uniformly throughout the
cytoplasm (Cyt); the abundant membrane-bound organelles, including the
Golgi apparatus (G), noncoated (UC) vesicles, and coated
vesicles (CV), are free of label. In the extracellular matrix (MX),
occasional gold label is seen over amorphous material but never in
association with collagen (C), as in the undiseased artery. c,
Immunogold labeling of GM-CSF in a foam cell of SMC origin from an
atherosclerotic lesion. As in contractile- and synthetic-state cells,
GM-CSF is localized to the cytoplasmic matrix (Cyt), which contains
uniformly distributed label. The lipid droplets (Li),
cholesterol crystals (CC), and lysosomes (Ly),
which are the hallmark of these cells, as well as mitochondria (M), are
devoid of label. Ultrathin frozen sections. Bars = 0.5
µm.
|
|
The specificity of the labeling patterns was confirmed in sections of
control undiseased and diseased tissue (not exposed to primary
antibody) run in parallel, which were consistently devoid of
gold label.
 |
Discussion
|
|---|
The principal novel findings of the present study are
that GM-CSF
is expressed in histologically normal and
atherosclerotic human
coronary arteries and that subpopulations
of SMCs form an important
source of this cytokine. These
conclusions, which are based
on comprehensive experimental data from in
situ hybridization
backed by PCR and Northern analyses,
together with dual in situ
hybridization/immunocell marking and
electron microscopic
immunocytochemistry, significantly extend findings
of previous
studies. Although GM-CSF expression has previously been
reported
in a range of cultured human cell types relevant to
atherogenesis
2931 and in
atheromatous aortic lesions of
cholesterol-fed rabbits,
24 cultured
SMCs were reported to express GM-CSF only after stimulation
with other
cytokines,
32 and in the rabbit model, no
SMC GM-CSF
production was detectable in control
arteries.
24 Our results,
in contrast, indicate
that GM-CSF is constitutively expressed
in nonstimulated cultures of
human coronary arterial SMCs and
that intimal SMCs
in the histologically normal as well as the
diseased
human coronary artery are significant producers of
the
cytokine. Although the prevalence of
atherosclerosis makes
it impossible to rule out the
absence of incipient disease in
the arterial samples
classified as normal in our study, histological
assessment
provides a more rigorous test of absence from disease than
do
clinical, physiological, or
symptomatic criteria, and the samples
may therefore be
regarded as typical of the disease-free state
in the adult human
population.
Comparison of our GM-CSF data from human
atherosclerosis with that previously reported from the
rabbit model24 must be interpreted with reference
to arterial architecture. The human coronary
artery, in contrast to the arteries of rabbits and other small mammals,
characteristically has a thickened intima containing SMCs that differ
in morphology and gene expression from SMCs of the media; these intimal
cells characteristically show epithelioid or synthetic characteristics,
particularly toward the luminal side of the
vessel.4244 It is in this specific
subpopulation of cells, of which there is no counterpart in the normal
rabbit artery, that particularly pronounced GM-CSF expression was
detected in the present study. A GM-CSFsecreting subpopulation of
SMCs in this location is strategically placed to exert a marked
proatherogenic stimulus, augmenting that of the scattered
GM-CSFpositive endothelial cells.
The presence of such a potential inbuilt proatherogenic stimulus in
histologically normal coronary artery might
seem at odds with the absence of overt disease in these normal control
samples. However, our demonstration by electron microscopic
immunocytochemistry of the undiseased arteries that GM-CSF is
predominantly confined within the SMCs is consistent with a
large potential reservoir of the cytokine, which may
progressively be released as the lesion progresses. The localization of
GM-CSF to the cytoplasmic matrix rather than to membrane-bound
secretory organelles as in some cell types45
indicates that release of GM-CSF from the SMC is mediated not by
classic exocytosis but by other mechanisms, such as structural damage
to or blebbing of the plasma membrane or death and disintegration of
the cell following apoptosis.46 The low
quantity of GM-CSF labeled in the extracellular matrix in all samples
is consistent with the known biological activity of the
cytokine, whose effects are known to be mediated at extremely
low doses, at the limits of detectability by immunocytochemistry.
In keeping with our in situ hybridization and immunocytochemical
findings on histologically normal and atherosclerotic
arterial tissue, in situ hybridization, RT-PCR, and
Northern blot analyses of cultured SMCs (isolated from both
sources) revealed comparable levels of expression of GM-CSF mRNA over
three subcultivations, with markedly increased expression on
dedifferentiation to an activated synthetic phenotype
(ie, conditions corresponding to those prevailing in the
atherosclerotic plaque). Apart from SMCs, our in situ hybridization
studies of tissue sections demonstrate that the GM-CSF gene is
expressed in some endothelial cells of the undiseased
human coronary artery and that endothelial
expression is increased in atherosclerotic lesions. Furthermore, foci
of accumulating macrophages in the atherosclerotic lesion show
especially abundant GM-CSF expression. Again, the observations on
cultured cells accord closely with these data, with RT-PCR
analysis of cultured endothelial cells
revealing GM-CSF mRNA levels similar to those of SMCs.
The hypothesis that such multiple sources of GM-CSF could act as one of
the key regulators of macrophage survival, proliferation, and
accumulation in the atherosclerotic lesion has previously been
suggested from animal model and cultured cell
studies,24,32 and our present findings
provide the first evidence of the applicability of this hypothesis to
the human lesion. In contrast to M-CSF, which has a selective action on
macrophage differentiation and is known to be expressed in
rabbit and human atherosclerotic lesions,2224
GM-CSF additionally affects the differentiation of T lymphocytes,
neutrophils, and eosinophils4750 and stimulates
proliferation in a number of nonhemopoietic cell
types.51 GM-CSF may therefore act as a
polyfunctional regulator in atherogenesis, as part of a "CSF
network" involving cytokine-stimulated mesenchymal cells and
inflammatory leukocytes, analogous to that postulated for other
inflammatory lesions.24,32,51
Within such a framework, GM-CSF production by the
endothelium and subendothelial SMCs of
the normal arterial vessel wall could play a role in
initiation of the inflammatory-type response, with further stimulation
of expression as oxidized LDL accumulates,31,52
the resultant activation of inflammatory cells subsequently providing a
major source of the cytokine during the progression stage of
the disease. This hypothesis is in agreement with our observation that
normal cultivated macrophages do not express GM-CSF but that
abundant expression occurs in the activated macrophages
of the atherosclerotic vessel wall. Finally, intimal SMC-derived GM-CSF
could also play an important role as an early stimulus to phenotypic
transformation and migration of medial SMCs, and in highly fibrotic
atherosclerotic lesions containing few macrophages, subsequent
augmentation of these effects could occur by an autocrine mechanism
alone.
 |
Selected Abbreviations and Acronyms
|
|---|
| AEC |
= |
3-amino-9-ethylcarbazole |
| CSF |
= |
colony-stimulating factor |
| DTT |
= |
dithiothreitol |
| FCS |
= |
fetal calf serum |
| GM-CSF |
= |
granulocyte-macrophage colony-stimulating factor |
| Ig |
= |
immunoglobulin |
| IL |
= |
interleukin |
| M-CSF |
= |
macrophage colony-stimulating factor |
| NBT |
= |
nitroblue tetrazolium |
| RT-PCR |
= |
reverse transcriptionpolymerase chain reaction |
| SMC |
= |
smooth muscle cell |
| TNF |
= |
tumor necrosis factor |
| X-PO4 |
= |
5-bromo-4-chloro-3-indolyl phosphate |
|
 |
Acknowledgments
|
|---|
This study was supported by the Deutsche Forschungsgemeinschaft
(grants
SFB 310 and SFB 223) and the British-German Academic Research
Collaboration
program (project 815). We thank K. Schlattmann, M.
Opalka, and
B. Milskemper for their technical expertise. Part of this
work
will be included in the doctoral thesis of C. Koenig.
Received April 25, 1997;
accepted July 11, 1997.
 |
References
|
|---|
-
Burgess AW, Metcalf D. The nature and action of
granulocyte-macrophage colony stimulating factors.
Blood. 1980;56:947958.[Abstract/Free Full Text]
-
Metcalf D. The granulocyte-macrophage
colony-stimulating factors. Science. 1985;229:1622.[Abstract/Free Full Text]
-
Metcalf D. The molecular control of cell division,
differentiation commitment and maturation into haemopoietic cells.
Nature. 1989;339:2730.[Medline]
[Order article via Infotrieve]
-
Metcalf D. Control of granulocytes and
macrophages: molecular, cellular, and clinic aspects.
Science. 1992;254:529533.
-
Nakata K, Akagawa KS, Fukayama M, Hayashi Y, Kadokura
M, Tokunaga T. Granulocyte-macrophage colony-stimulating factor
promotes the proliferation of human alveolar macrophages in
vitro. J Immunol. 1991;147:12661272.[Abstract]
-
Clark SC, Kamen R. The human hematopoietic
colony-stimulating factors. Science. 1987;236:12291237.[Abstract/Free Full Text]
-
Nathan CF. Secretory products of
macrophages. J Clin Invest. 1987;79:319326.
-
Ölberg F, Botling J, Nilsson K.
Macrophages and cytokine network. Transplant
Proc. 1993;25:20442047.[Medline]
[Order article via Infotrieve]
-
Bussolino F, Colotta F, Bocchietto E, Guglielmetti A,
Mantovani A. Recent developments in the cell biology of
granulocyte-macrophage colony-stimulating factor and
granulocyte colony-stimulating factor: activities on
endothelial cells. Int J Clin Res. 1993;23:812.
-
Raivich G, Gerhmann J, Kreutzberg GW. Increase of
macrophage colony-stimulating factor and
granulocyte-macrophage colony-stimulating factor receptors in
the regenerating rat facial nucleus. J Neurosci Res. 1991;30:682686.[Medline]
[Order article via Infotrieve]
-
Hart MN, Fabry Z, Love-Homan L, Keiner J, Sadewasser
KL, Moore SA. Brain microvascular smooth muscle and
endothelial cells produce granulocyte
macrophage colony-stimulating factor and support colony
formation of granulocyte-macrophage-like cells. Am J
Pathol. 1992;141:421427.[Abstract]
-
Cousins DJ, Staynov DZ, Lee TH. Regulation of
interleukin-5 and granulocyte-macrophage colony-stimulating
factor expression. Am J Respir Crit Care Med.. 1994;150:S50S53.
-
Wissler RW. Theories and new horizons in the
pathogenesis of atherosclerosis and the mechanisms of
clinical effects. Arch Pathol Lab Med. 1992;116:12811291.[Medline]
[Order article via Infotrieve]
-
Nilsson J. Cytokines and smooth muscle cells in
atherosclerosis. Cardiovasc Res. 1993;27:11841190.[Free Full Text]
-
Ross R. The pathogenesis of
atherosclerosis: a perspective for the 1990s.
Nature. 1993;362:801809.[Medline]
[Order article via Infotrieve]
-
Ross R. Cell biology of
atherosclerosis. Annu Rev Physiol. 1995;57:791804.[Medline]
[Order article via Infotrieve]
-
Stemme S, Hansson GK. Immune mechanisms in
atherogenesis. Ann Med. 1994;26:141146.[Medline]
[Order article via Infotrieve]
-
Yokota T, Hansson GK. Immunological mechanisms in
atherosclerosis. J Intern Med.. 1995;238:479489.[Medline]
[Order article via Infotrieve]
-
Aqel NM, Ball RY, Waldmann H, Mitchinson MJ.
Identification of macrophages and smooth muscle cells in human
atherosclerosis using monoclonal antibodies.
J Pathol. 1985;146:197204.[Medline]
[Order article via Infotrieve]
-
Davies MJ, Thomas AC. Plaque fissuring: the cause
of acute myocardial infarction, sudden ischaemic death, and crescendo
angina. Br Heart J. 1985;53:363373.[Free Full Text]
-
Fuster V, Stein B, Ambrose JA, Badimon L, Badimon JJ,
Chesebro JH. Atherosclerotic plaque rupture and thrombosis: evolving
concepts. Circulation. 1990;82(suppl II):II-47II-59.
-
Clinton SK, Underwood R, Hayes L, Sherman ML, Kufe DW,
Libby P. Macrophage colony-stimulating factor gene expression
in vascular cells and in experimental and human
atherosclerosis. Am J Pathol. 1992;140:301316.[Abstract]
-
Rosenfeld ME, Ylä-Herttuala S, Lipton BA, Ord VA,
Witztum JL, Steinberg D. Macrophage colony-stimulating factor
mRNA and protein in atherosclerotic lesions of rabbits and humans.
Am J Pathol.. 1992;140:291300.[Abstract]
-
Wang J, Wang S, Lu Y, Weng Y, Gown AM. GM-CSF and M-CSF
expression is associated with macrophage proliferation in
progressing and regressing rabbit atheromatous lesions.
Exp Mol Pathol.. 1994;61:109118.[Medline]
[Order article via Infotrieve]
-
Nimer SD, Champlin R, Golde DW. Serum
cholesterol-lowering activity of
granulocyte-macrophage colony-stimulating factor.
JAMA. 1988;260:32973300.[Abstract]
-
Motoyoshi K, Yoshida K, Hatake K, et al. Recombinant
and native human urinary colony-stimulating factor directly augments
granulocytic and granulocyte-macrophage colony-stimulating
factor production of human peripheral blood
monocytes. Exp Hematol.. 1989;17:6871.[Medline]
[Order article via Infotrieve]
-
Ishibashi T, Yokoyama K, Shindo J, et al. Human
granulocyte-macrophage colony-stimulating factor lowers the
levels of plasma cholesterol with an increase in mRNA for
very low density lipoprotein receptor in rabbits. Ann N Y Acad
Sci. 1995;748:630633.[Medline]
[Order article via Infotrieve]
-
Ishibashi S, Inaba T, Shimano H, et al. Monocyte
colony-stimulating factor enhances uptake and degradation of
acetylated low density lipoproteins and cholesterol
esterification in human monocyte-derived macrophages.
J Biol Chem. 1990;265:1410914117.[Abstract/Free Full Text]
-
Sieff CA, Niemayer CM, Mentuzer SJ, Faller DV.
Interleukin-1, tumor necrosis factor and production of colony
stimulating factors by cultured mesenchymal cells. Blood. 1988;72:13161323.[Abstract/Free Full Text]
-
Seelentag W, Mermod JJ, Vassalli P. Interleukin-1 and
tumor necrosis factor-
additively increase the levels of
granulocyte-macrophage and granulocyte colony stimulating
factor (CSF) mRNA in human fibroblasts. Eur J Immunol. 1989;19:209212.[Medline]
[Order article via Infotrieve]
-
Rajavashisth TB, Andalibi A, Territo MC, et al.
Induction of endothelial cell expression of granulocyte
and macrophage colony-stimulating factors by modified
low-density lipoproteins. Nature. 1990;344:254257.[Medline]
[Order article via Infotrieve]
-
Filonzi EL, Zoellner H, Stanton H, Hamilton JA.
Cytokine regulation of granulocyte-macrophage
colony-stimulating factor and macrophage colony-stimulating
factor production in human arterial smooth muscle
cells. Atherosclerosis. 1993;99:241252.[Medline]
[Order article via Infotrieve]
-
Stary HC, Chandler AB, Dinsmore RE, et al. A definition
of advanced types of atherosclerotic lesions and a
histological classification of
atherosclerosis: a report from the Committee on
Vascular Lesions of the Council on
Arteriosclerosis, American Heart Association.
Circulation. 1995;92:13551374.[Abstract/Free Full Text]
-
Tokuyasu KT. Immunocytochemistry on ultrathin frozen
sections. Histochem J. 1980;12:381403.[Medline]
[Order article via Infotrieve]
-
Völker W, Frick B, Robenek H. A simple device for
low temperature polymerization of Lowicryl K4M resin. J
Microsc.. 1985;138:9193.
-
Campbell GR, Campbell JH. The phenotypes of
smooth muscle cells expressed in human atheroma. Ann
N Y Acad Sci. 1990;598:143158.[Medline]
[Order article via Infotrieve]
-
Owens KG. Regulation of differentiation of vascular
smooth muscle cells. Physiol Rev. 1995;75:487509.[Abstract/Free Full Text]
-
Thie M, Schlumberger W, Semich R, Rauterberg J, Robenek
H. Aortic smooth muscle cells in collagen lattice culture: effects on
ultrastructure, proliferation and collagen synthesis. Eur J Cell
Biol. 1991;55:295304.[Medline]
[Order article via Infotrieve]
-
Plenz G, Gan Y, Raabe HM, Müller PK. Expression
of vigilin in chicken cartilage and bone. Cell Tissue Res. 1993;273:381389.[Medline]
[Order article via Infotrieve]
-
Chirgwin JM, Przbyla AE, MacDonald E, Rutter WJ.
Isolation of biologically active ribonucleic acid from sources enriched
in ribonuclease. Biochemistry. 1979;18:52945299.[Medline]
[Order article via Infotrieve]
-
Loffler JA, Plenz G, Siegert R, Weerda H, Muller PK.
Experimental tissue expansion induces changes in expression of
procollagen I and III messenger RNA. Eur Arch
Otorhinolaryngol. 1995;252:475477.[Medline]
[Order article via Infotrieve]
-
Severs NJ, Robenek H. Constituents of the
arterial wall and atherosclerotic plaque: an introduction
to atherosclerosis. In: Robenek H, Severs NJ, eds.
Cell Interactions in Atherosclerosis. Boca
Raton, Fla: CRC Press; 1992:149.
-
Stary HC, Blankenhorn DH, Chandler AB, et al. Special
report: a definition of the intima of human arteries and of its
atherosclerosis-prone regions. A report from the
Committee on Vascular Lesions of the Council on
Arteriosclerosis, American Heart Association.
Circulation. 1992;85:391405.[Free Full Text]
-
Schwartz SM, DeBlois D, O'Brien ERM. The intima: soil
for atherosclerosis and restenosis. Circ
Res. 1995;77:445465.[Free Full Text]
-
Levi-Schaffer F, Lacy P, Severs NJ, et al. Association
of granulocyte-macrophage colony-stimulating factor with the
crystalloid granules of human eosinophils. Blood.. 1995;85:25792586.[Abstract/Free Full Text]
-
Bennett MR, Evan GI, Schwartz SM. Apoptosis of
human vascular smooth muscle cells derived from normal vessels and
coronary atherosclerotic plaques. J Clin
Invest. 1995;95:22662274.
-
Weisbart RH, Golde DW, Clark SC, Wong GG, Gassib JC.
Human granulocyte macrophage colony-stimulating factor is a
neutrophil activator. Nature. 1985;314:361364.[Medline]
[Order article via Infotrieve]
-
Donahue RE, Wang EA, Stone DK, et al. Stimulation of
haematopoiesis in primates by continuous infusion of recombinant human
GM-CSF. Nature. 1986;321:872875.[Medline]
[Order article via Infotrieve]
-
Welte K, Bonilla MA, Gillio AP, et al. Recombinant
human granulocyte colony-stimulating factor: effects on hematopoiesis
in normal and cyclophosphamide-treated primates. J Exp Med. 1987;165:941948.[Abstract/Free Full Text]
-
Gasson JC. Molecular physiology of
granulocyte-macrophage colony-stimulating factor.
Blood. 1991;77:11311145.[Free Full Text]
-
Dedhar S, Gaboury L, Galloway P, Eaves C. Human
granulocyte-macrophage colony-stimulating factor is a growth
factor active on a variety of cell types of nonhemopoietic origin.
Proc Natl Acad Sci U S A.. 1988;85:92539257.[Abstract/Free Full Text]
-
Liao F, Berliner JA, Mehrabian M, et al. Minimally
modified low density lipoprotein is biologically active in vivo in
mice. J Clin Invest. 1991;87:22532257.
This article has been cited by other articles:

|
 |

|
 |
 
S. W. Waldo, Y. Li, C. Buono, B. Zhao, E. M. Billings, J. Chang, and H. S. Kruth
Heterogeneity of Human Macrophages in Culture and in Atherosclerotic Plaques
Am. J. Pathol.,
April 1, 2008;
172(4):
1112 - 1126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tanimoto, Y. Murata, K.-Y. Wang, M. Tsutsui, K. Kohno, and Y. Sasaguri
Monocyte Chemoattractant Protein-1 Expression Is Enhanced by Granulocyte-Macrophage Colony-stimulating Factor via Jak2-Stat5 Signaling and Inhibited by Atorvastatin in Human Monocytic U937 Cells
J. Biol. Chem.,
February 22, 2008;
283(8):
4643 - 4651.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Shaposhnik, X. Wang, M. Weinstein, B. J. Bennett, and A. J. Lusis
Granulocyte Macrophage Colony-Stimulating Factor Regulates Dendritic Cell Content of Atherosclerotic Lesions
Arterioscler. Thromb. Vasc. Biol.,
March 1, 2007;
27(3):
621 - 627.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ditiatkovski, B.-H. Toh, and A. Bobik
GM-CSF Deficiency Reduces Macrophage PPAR-{gamma} Expression and Aggravates Atherosclerosis in ApoE-Deficient Mice
Arterioscler. Thromb. Vasc. Biol.,
October 1, 2006;
26(10):
2337 - 2344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Kim, M. Zhou, and L. M. Wahl
Angiotensin II increases human monocyte matrix metalloproteinase-1 through the AT2 receptor and prostaglandin E2: implications for atherosclerotic plaque rupture
J. Leukoc. Biol.,
July 1, 2005;
78(1):
195 - 201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sasaguri, K.-Y. Wang, A. Tanimoto, M. Tsutsui, H. Ueno, Y. Murata, Y. Kohno, S. Yamada, and H. Ohtsu
Role of Histamine Produced by Bone Marrow-Derived Vascular Cells in Pathogenesis of Atherosclerosis
Circ. Res.,
May 13, 2005;
96(9):
974 - 981.
[Abstract]
[Full Text]
|