Articles |
From the Department of Medicine, University College London Medical School, Rayne Institute (S.H., G.C., S.E.H., P.J.T.); the MRC Epidemiology and Medical Care Unit, Wolfson Institute of Preventive Medicine, The Medical College of St Bartholomew's Hospital, London (G.M., J.A.C.); and the Clinical Epidemiology Unit, University of Manchester Medical School, Manchester (K.C.), UK.
Correspondence to Dr Philippa Talmud, Division of Cardiovascular Genetics, Department of Medicine, UCL Medical School, Rayne Institute, University St, London WC1E 6JJ, UK. E-mail ptalmud{at}medicine.ucl.ac.uk
| Abstract |
|---|
|
|
|---|
G
transition at position -93. The frequency in healthy white men was
3.4% (n=1575). There was an 83% allelic association between -93T
G
and Asp9
Asn (D9N); all N9 mutations occurred on a -93G
allele, but not all -93G mutations occurred on an N9 allele.
It was thus possible to assess the effect on plasma
triglyceride (Tg) levels of the rare -93G mutation in the
presence of the wild-type D9. Carriers of the -93G, with
genotype TG/DD, had significantly lower Tg levels than TT/DD
individuals (1.36 versus 1.78 mmol/L, P=.01); carriers
of both mutations (TG/DN) had the highest Tg levels (1.93 mmol/L).
When the group was stratified above and below the sample mean for body
mass index (BMI), carriers of the -93G on a D9 allele (TG/DD) were
"protected" against the Tg-raising effect of obesity, as assessed
by BMI. In Afro-Caribbeans (n=91), the carrier frequency of -93G was
18-fold higher (63%), with weaker (17%) allelic association between
-93G and N9. In vitro, the -93G promoter had 24% higher activity
than the -93T in a rat smooth muscle cell line and 18% higher
activity in a human adrenal cell line. A protein identified by
band-shift assays bound to the -93G but not to the -93T allele,
which may explain the lower Tg levels in -93G carriers.
Key Words: lipoprotein lipase promoter mutation SSCP Afro-Caribbean plasma triglycerides
| Introduction |
|---|
|
|
|---|
More than 50 mutations in the coding region, or splice mutations in the LPL gene, have been identified in individuals with LPL deficiency, giving rise to familial LPL deficiency (type I hyperlipoproteinemia).6 7 8 This is a rare recessive disorder, which usually presents in childhood and occurs at a frequency of 1 in 106. There is some evidence that heterozygous family members may have elevated Tg levels and present with the lipid profile of familial combined hyperlipidemia.9 However, since these mutations are rare, with a carrier frequency of 1 in 103, their impact at a population level is small.
Recently we and others have identified two common mutations in the LPL gene, an aspartic acid to asparagine change at amino acid 9, D9N, and an asparagine to serine change at amino acid 291, N291S.10 11 12 Unlike the mutations that are associated with familial chylomicronemia, which greatly reduce or abolish LPL activity, these mutations only partially reduce LPL activity. In the UK and other countries in Europe, both mutations occur at a frequency of 1% to 4% in healthy individuals; N9 occurs at increased frequency in patients with combined hyperlipidemia or coronary artery disease.10 11 Both mutations are associated with higher Tg and lower HDL levels in carriers, and this problem is compounded in individuals with a raised BMI.10 12 13 14
The aim of the present study was to identify common mutations in
the promoter of the LPL gene that may be associated with modulation of
LPL gene expression. The promoter of the LPL gene has been well
characterized,15 16 and deletion mapping has identified a
number of transcription factor binding sites detailed in Fig 1
. Recently (1995), Tanuma et
al17 identified a number of LSEs in the region -225 to
-81, and their data suggest that these elements might play a role in
suppressing LPL transcription. Thus, within the promoter, there are a
number of potential sites where sequence differences could modulate LPL
gene expression.
|
Using SSCP analysis, a common T
G transition was found at
nucleotide -93 of the LPL promoter. High-throughput
screening was used to identify carriers of this mutation in healthy
middle-aged men participating in NPHSII and in a sample of healthy
Afro-Caribbeans and Gujarati Indians. The frequency and impact of the
-93G mutation on plasma Tg levels and its effect on LPL gene
expression in vitro are presented.
| Methods |
|---|
|
|
|---|
Specific screening for the -93T/G mutation was undertaken in DNA samples obtained through two separate studies: (1) a total of 1575 healthy male subjects aged 40 to 64 years, all of whom had been recruited as part of the NPHSII project and were free of coronary artery disease at the time of entry into the study, as assessed by questionnaire and electrocardiography14 and (2) a total of 91 Afro-Caribbeans (51 men and 40 women) for genotype analysis and 70 Gujarati Indians (38 men and 36 women), recruited as part of the Brent and Harrow Study.18
Biochemical Analysis
Cholesterol and Tg concentrations were determined by
standard colorimetric methods.14
DNA Analysis
Blood was collected in 10-mL Na-EDTA tubes and kept frozen at
-20°C. DNA was extracted by the salting-out method19 or
as previously described.20
Five overlapping oligonucleotide pairs (numbered 1
through 5) were designed for PCR amplification of the LPL gene from
nucleotide +226 to -489 (a 715-bp fragment),
presented in Fig 1
. PCR was carried out on a Hybaid Omnigene
machine. The optimum amplification conditions and the sequence of the
amplification primers (Genosys) are given in Table 1
. The reactions were carried out in a
standard buffer, supplied by GIBCO-BRL, with 100 ng of each primer,
0.05% W-1, and 0.5 U Taq polymerase (GIBCO-BRL) per
reaction, with a final MgCl2 concentration as
presented in Table 1
.
|
Detection of the -93T/G mutation was carried out by PCR with oligonucleotides LPLPRO 3 and 4. For screening of the mutation, DNA, predried onto the microtiter plate, was used, producing a PCR fragment of 203 bp. The -93G introduces an Hae III site, and after digestion, fragment sizes are 153 bp and 50 bp. These fragments were separated by 7.5% polyacrylamide gel electrophoresis, using MADGE.21
Amplification of exon 2 and detection of the D9N mutation by Taq I digestion was performed as previously described.10 Subsequently, a replacement 3' oligonucleotide (5'AGGGCAAATTTACTTGCGATG3') was designed to produce a smaller PCR fragment and eliminate the constant Taq I site, thus producing Taq I digestion fragments of 76 bp in the presence of the N9 mutation and 52 bp and 24 bp fragments in the absence of the mutation (D9). The smaller digestion products make it possible to resolve the fragments on a 7.5% polyacrylamide MADGE gel and thus speeded up the screening process.
Previously, 773 individuals from NPHSII had been screened for the D9N mutation.10 An additional 802 were now screened in addition to the Brent and Harrow Afro-Caribbean and Gujarati Indian group.
SSCP Analysis
SSCP analysis was carried out essentially as described
by Gudnason et al,22 except that 0.25 µL of
[32P]
-dCTP at 10 µCi/µL (3000 mCi/mmol; Amersham)
was added to each sample to be amplified and the dCTP was reduced to
0.02 mmol/L. Direct sequencing of variants detected by SSCP
was carried out with one of the primers used in the amplification
reaction and a second biotinylated oligonucleotide,
thus allowing the purification of single-stranded DNA with
streptavidin-coated beads (Dynal) and sequencing according to the
Sequenase protocol (USB).
Cell Culture
A10 cells, a rat smooth muscle cell line (a kind gift from Dr O.
Yalkinoglu, Bayer AG, Wuppertal, Germany) were grown at 37°C in 5%
CO2 in Dulbecco's modified Eagle's medium containing 10%
FCS, 100 U/500 mL penicillin, 100 U/500 mL streptomycin, 25
mmol/L HEPES, 1 g/L glucose, 2 mmol/L sodium
pyruvate, and 1 mmol/L L-glutamine. The medium
was changed every 3 days. NCIH295 cells, a human adrenal cell line
expressing LPL, were maintained in RPMI-1640 medium supplemented with
10 µL/mL insulin-transferrin sodium selenite, 1 nmol/L
hydrocortisone, and 1 nmol/L ß-estrogen as described
previously.23
The luciferase gene was used as a reporter to test the promoter activity of the -93T/G variants. A 357-bp fragment (from the translation start site to -161 bp) of the human LPL promoter was amplified from individuals homozygous for either the -93T or -93G allele, using oligonucleotides designed to give Sac I (5') and HindIII (3') cutting sites. The digested fragment was cloned immediately upstream of the luciferase coding region into Sac I/HindIII digested luciferase enhancer vector, pGL3-enhancer (Promega). After cloning, integrity of the insert was tested by sequencing on an ABI Prism 377 DNA sequencer (Applied Biotechnology Inc).
Transient transfections of A10 cells were carried out by using the Lipofectin liposomal reagent (GIBCO-BRL) with 5 µg pGL3-enhancer vector containing promoter insert and 1 µg of a ß-galactosidaseexpressing control vector. NCIH295 cells were transiently transfected in the same manner, except 2.5 µg of pGL3-enhancer was used. A10 and NCIH295 cells were harvested after a further 48 and 72 hours, respectively, with Promega cell-culture lysis reagent. The extract was stored at -70°C until assayed for luciferase activity, ß-galactosidase activity, and total protein.
Luciferase Assay
The Promega luciferase assay employing coenzyme A as an
alternative substrate for luciferase was used. Luciferase assay reagent
and cell extract were allowed to equilibrate to room temperature for 30
minutes of nonuse. To assay for luciferase, 20 µL of luciferase assay
reagent was added to 4 µL of cell extract and mixed by pipetting.
Luminosity was measured over a 10-second period in a Turner Designs
TD-20 luminometer (Promega).
ß-Galactosidase Assay
Cell extract (150 µL) was mixed with 150 µL of assay
buffer (120 mmol/L Na2HPO4, 80
mmol/L NaH2PO4, 2 mmol/L
magnesium chloride, 100 mmol/L ß-mercaptoethanol, and
1.33 mg/mL o-nitrophenyl
ß-D-galactopyranoside), vortexed briefly, and incubated
overnight at 37°C. Five hundred microliters of 1 mol/L sodium
carbonate was added to stop the reaction, and 1 mL of purified water
was added to dissolve the precipitate formed due to the presence of
cell-culture lysis buffer. ß-Galactosidase activity was measured as
A420 and used as a measure of transfection efficiency.
Bradford Assay
Diluted cell extract (100 µL) was used in 5 mL of assay
reagent (for 1 L: 100 mg Coomassie blue G250, 50 mL 95% ethanol, 100
mL 85% phosphoric acid, and 850 mL distilled water). A595
was used as a measure of protein concentration, which was obtained by
comparison with a BSA standard curve. Protein concentration was used as
a measure of cell number in the extraction.
Bandshift Assay
Nuclear extracts used in the bandshift assay were prepared by
snap-freezing a pellet of A10 cells (2x106 cells) at
-70°C and lysing in five times the volume of whole-cell extraction
buffer containing 10 mmol/L HEPES (pH 7.9), 0.4
mol/L NaCl, 1.5 mmol/L MgCl2, 0.1
mmol/L EGTA, 0.5 mmol/L DTT, 5% glycerol, and
0.5 mmol/L PMSF. The protein concentration of the extract
was determined by the Bradford assay and adjusted to 1.5
µg/µL by dilution with whole-cell extraction buffer.
Aliquots were stored at -70°C until required.
Oligonucleotides for the T or G probe were as follows: -93T AGTGAATTTAGGTCCCTCCCCCCAA and -93G AGTGAATTTAGGGCCCTCCCCCCAA.
Complementary oligonucleotides were also synthesized. Oligonucleotides were labeled using Ready-To-Go T4 polynucleotide kinase (Pharmacia Biotech) in a 50-µL reaction.
Bandshift assays were performed as described in the Pharmacia LKB BandShift kit (Pharmacia Biotech).
Computation and Statistical Analysis
Nuclear factor binding sites were screened for using the website
http://bimas.dcrt.nih.gov/molbio/signal. Biometric data previously
obtained for each of the studies were used for comparison of carriers
with noncarriers. The gene-counting method with a
2 test with Yates' correction was used to
compare the frequency of the -93G variant allele between the
different groups. Linkage disequilibrium between the two variant sites
(-93T/G and D9N) was estimated by using the correlation coefficient
.24 All other tests and transformations were performed
with the SPSS/PC+ statistical package. A maximum-likelihood algorithm
method was used to determine the most likely "phase" of the
-93T/G and D9N mutations in those individuals heterozygous for
both.25 To test differences in Tg concentrations, values
were adjusted for age (for NPHSII) and log transformed before
statistical analysis. The method of Welch et al,26
which tests for equality of means without assuming equal variances in
each group, was used in preference to an ANOVA, since there was a
significant difference in the variance in Tg levels among the three
genotype groups in NPHSII (P=.03). Since the
subjects contributed differently to the overall mean according to how
many Tg measurements they had had, the subjects' overall Tg mean was
weighted by the number of measurements. Statistical significance was
considered to be P=.05.
| Results |
|---|
|
|
|---|
G
substitution at position -93, was found in both PCR fragments, in the
overlapping region of the two PCR products. This T
G transition
creates an Hae III cutting site and also destroys an
Ava II site.
High-throughput genotyping, using small-scale PCR and Hae
III digestion, resolved by MADGE, was used to identify carriers of the
-93T/G mutation. The frequency of this mutation was investigated in
the healthy control subjects from the NPHSII study and in the healthy
Afro-Caribbeans and Gujarati Indians participating in the Brent and
Harrow study. These results are presented in Table 2
. The carrier frequency of the -93G
allele was 3.4% in the NPHSII healthy men. In Gujarati Indians,
the frequency (2.9%) was not significantly different from the NPHSII
group. However, in Afro-Caribbeans, the -93G allele occurred in 57
of the 91 individuals, a frequency of 62.6%. Furthermore, among
Afro-Caribbeans, there were 14 individuals who were homozygous for the
mutation.
|
What became evident on identifying carriers of the -93T/G mutation was
that within the group of individuals who had been screened previously
for the D9N mutation,10 all individuals who were carriers
of N9 were also carriers of the -93G. Those NPHSII samples not
previously genotyped for D9N, and the Brent and Harrow samples,
were therefore screened for the N9 mutation to estimate the allelic
association between these two variant sites, and the observed
distribution of the genotype classes are presented in
Table 3
. In the NPHSII sample, 45 of 54
-93G carriers were also carriers of the N9, representing
83% allelic association (
=.91, P=.0001). In the
Afro-Caribbeans, the carrier frequency of the -93G (57 of 91) was
18-fold higher than in the NPHSII white group; in total, 14 of the 57
carriers were homozygous for the -93G, with the genotype GG/DN
or GG/DD. Furthermore, of the 57 -93G Afro-Caribbean carriers, only 10
were carriers of N9, giving 17% allelic association (-=.32,
P=NS). The carrier frequency of the N9 mutation (10 of
91;10.9%) was also higher in this group compared with NPHSII (45 of
1575; 2.8%, P=.03). In the Gujarati Indians, the carrier
frequency of the -93G was 2.9%; no N9 carriers were detected in this
group, although N9 carriers have been identified in other Asian Indian
samples (unpublished data, P Talmud and A Panaloo, 1995).
|
In the 1575 NPHSII men, 43 were doubly heterozygous TG/DN and 9 were
carriers of the -93G (TG/DD); however, we did not identify a single
individual in this sample nor in the Afro-Caribbeans (Table 3
) or
Gujarati Indians who carried the N9 mutation on a -93T allele.
Using the maximum-likelihood algorithm,25 it is highly
likely that all N9 mutations are always on a -93G allele, and thus
the effect of N9 without the -93G cannot be assessed. The effect on
plasma lipid levels could be assessed for those detected variants,
-93T/D9 (TT/DD), -93G/N9 (TG/DN), and -93G/D9 (TG/DD), and in the
NPHSII study baseline, and five annual measures of lipids were
available. It was therefore possible to look at effects on Tg levels
over the 6-year period (Fig 2
), and the
overall results are presented in Table 4
. Taking the mean Tg levels over 6 years
compared with those of the individuals who had only the wild-type
alleles, TT/DD, and who had mean plasma Tg levels of 1.76
mmol/L, carriers of the -93G/D9 with genotype TG/DD had
significantly lower plasma Tg levels (1.32 mmol/L;
P=.01). By contrast, those individuals who were carriers of
both mutations (TG/DN, including 2 homozygotes, GG/NN) had higher
plasma Tg levels (1.89 mmol/L; P=.31, NS;
overall test for the difference between the three
genotypes, P=.01). Thus, the -93G/D9 allele was
associated with a 31% lowering of Tg levels compared with wild-type,
whereas the -93G/N9 allele was associated with an 8.4% increase
in Tg levels (P=NS). The Tg variance in the TG/DD group was
0.07 compared with 0.18 in the TT/DD group and 0.27 in the TG/DN
groups, which suggests that in TG/DD individuals, the -93G/D9
allele is having a homeostatic effect. For the sample of
Afro-Caribbeans, full data on lipid levels and BMI were unavailable, so
no meaningful analysis could be carried out.
|
|
To test whether there was an interaction between BMI and Tg according
to genotype, individuals were stratified according to the mean
of the sample BMI (< or >26.5 kg/m2; Fig 3
). Individuals with the common
genotype (TT/DD) and low BMI had lower Tg levels than those
TT/DD individuals with high BMI (1.67 versus 2.08 mmol/L,
respectively P<.0001; 25% increase), characteristic of the
Tg-raising effect of high BMI. In individuals with the genotype
TG/DN, this BMI-associated increase in Tg was much larger (1.57 versus
2.33 mmol/L, P=.03; 48% increase). This N9-BMI
interaction has previously been reported.10 13 However, in
carriers of the -93G with D9 (TG/DD), the BMI effect was absent, and
the group of individuals with a BMI above the sample mean had a lower
mean Tg level of 1.15 mmol/L (27.2% lowering), but this
difference was not statistically significant.
|
To test whether the -93T
G mutation was itself functional, a 357-bp
fragment of the LPL promoter from the translation start site to bp
-161, with either the T or G at position -93, was cloned into
pGL3-enhancer, a luciferase reporter gene vector. the two constructs,
pGL3/-93T and pGL3/-93G, were then used to transfect a rat smooth
muscle cell line, A10, and a human adrenal cell line,
NCIH295.23 The mean results from four repeat experiments,
each representing 7 to 10 transfected plates for each
construct, are given in Fig 4
. These
results are corrected for transfection efficiency and protein content.
Compared with the T allele, given as 100%, the G allele
consistently showed significantly higher luciferase activity,
with a mean of 124% (±2.4%, P=.05) in the A10 cells and
118% (±16%, P=.097, NS) in adrenal NCIH295 cells.
|
To analyze further the interaction of the -93T
G with
nuclear factors, two labeled 25-mer double-stranded
oligonucleotides, from nucleotides -81 to
-104, with either a T or G at position -93, were used in a bandshift
assay with cellular extracts from A10 cells (Fig 5
). A DNA-protein complex was observed
with -93G probe (lane 9) but not with -93T probe (lane 3). This
interaction was not competed out with increasing amounts of unlabeled T
competitor (lanes 10 and 11). However, with increasing amounts of
unlabeled G competitor (lanes 12 through 14), the intensity of the band
was reduced, thus diluting the effect of the labeled probe binding to
the protein extract.
|
| Discussion |
|---|
|
|
|---|
G transition at position -93. This mutation was
previously reported by Yang et al27 to occur in an
individual who had a T-to-C substitution at nucleotide -39
of the LPL gene, but on the other chromosome. In a sample of healthy
white men from the UK, the carrier frequency of this mutation is 3.4%.
Several of the DNA samples used in the SSCP analysis were from
individuals of Afro-Caribbean origin, and from the initial SSCP
screening, it was obvious that the -93G allele was much more
common in this group. Genotyping a sample of 91 Afro-Caribbeans showed
that the -93G carrier frequency was 18-fold higher than in the whites
(62.6% versus 3.4%).
Since the NPHSII sample had been genotyped for both mutations,
it became apparent that there was very strong allelic association
between -93G and N9 (83%; -=.91, P=.00001), with 17% of
-93G alleles being on the wild-type D9 background (-93G/D9). We
did not identify a single individual who carried the N9 allele
without the -93G (genotype TT/DN), and since the healthy
individuals are drawn from an outbreeding general population, it is
highly unlikely that those individuals heterozygous for both mutations
are a genetically distinct group from those heterozygotes for either
mutation alone. That is, the phase of the two mutations (haplotype)
found in those individuals heterozygous for both can be accurately
inferred from the phase of the unambiguously observed haplotypes for
those heterozygous for either mutation alone. In the Afro-Caribbeans,
the allelic association was much weaker, with only 17% allelic
association (-=.32, P=NS) between -93G and N9. These
results suggest that the -93T
G is the older of the two mutations
and that the N9 mutation occurred on a -93G. The strong allelic
association that exists in whites suggests that little recombination
has occurred between the two variant sites. The difference in allelic
association of the two variable sites in Afro-Caribbeans compared
with whites may be explained by the increased frequency of the -93G in
Afro-Caribbeans.
Carriers of the N9 mutation have been shown to have higher plasma Tg levels than D9 carriers.10 However, it was evident that all N9 carriers were also carriers of -93G, suggesting the possibility that the elevated Tg levels associated with N910 were in fact due to the functional effect of the -93G. Since it was possible to identify carriers of the -93G distinct from N9, the effect on lipid levels of the promoter mutation on a D9 background could be assessed. From the NPHSII study, at baseline and over the subsequent 5-year period, the mean Tg level in carriers of -93G (genotype TG/DD) was consistently lower than in noncarriers (mean of 31%, which was statistically significant, P=.01). We do not know why there is an increase in Tg in years 4 and 5 in TG/DN individuals. It could be that year 3 was a low estimate, but whatever the reason, the increase in plasma Tg levels from year 3 (1.72 mmol/L) to year 4 (2.11 mmol/L) of 0.39 mmol/L was not statistically significant.
Several previous studies have shown that the LPL N9 mutation shows an
interaction with BMI;10 13 therefore, carriers of the
mutation with BMI in the top half or tertile of BMI for the group have
Tg levels significantly higher than noncarriers within the same BMI
range. Both we and others have shown that the D9N mutation produces
defective LPL with residual activity of 70%, though specific activity
is close to normal.10 28 Evidence from in vitro studies on
N9 suggest that the secretion rate is reduced, which accounts for the
reduced activity.10 28 Thus, a hypothesis to explain this
Tg-BMI interaction is that in the presence of increased
production of VLDL associated with increased body weight, the
defective N9-LPL is overwhelmed, resulting in decreased Tg catabolism
rate and thus elevated Tg levels. Results from the present study
(Fig 3
) show that in the healthy white men with a BMI below the sample
mean, there was no difference in Tg levels among the three
genotype groups. In those with BMI in the top half compared
with those with the common allele (TT/DD), the TG/DN carriers had a
12% higher mean Tg level, which was not statistically significant.
However, in the group with the genotype TG/DD, mean Tg levels
at the higher BMI range were lower than in those TG/DD carriers with
BMI below the sample mean (-27%, P=.05). It is therefore
possible that the -93G allele may "protect" against the
lipid-raising effect of the increased production of Tg-rich
particles.
In whites, the -93G allele occurs in 83% of carriers on the same
chromosome as the N9 variant, which in vitro results in a moderately
lower (
70% of wild-type) level of LPL secretion.28 It
is likely that in an individual heterozygous for both mutations,
upregulation of this secretion-defective LPL would result in a
larger-than-expected proportion of secretion-defective heterodimer LPL
being produced. Therefore, the overall effect of carrying the two
mutations is to raise plasma Tg levels, with the -93G/N9 allele
being a predisposing factor for
hypertriglyceridemia, interacting with
other genetic or environmental factors, such as obesity.
To date, only one other naturally occurring mutation in the promoter of
the LPL gene has been identified. The mutation, a T
C substitution at
-39, occurs in the Oct-I binding site, which results in a reduction by
85% of promoter activity compared with wild-type, and was identified
in a patient with familial combined
hyperlipidemia.27 We screened for the -39
mutation in 116 combined hyperlipidemic patients, using
allele-specific oligonucleotides (results not
shown) and found no carriers of this mutation. Yang et
al27 reported the identification of the -93T/G mutation
in the same patient, but reported no effect on promoter activity. A10
cells, although of rat origin, have been used previously in in vitro
studies of human gene expression.29 Functional assays
presented here, using the luciferase gene as a reporter, show
24% increased promoter activity of the -93G compared with the T
allele. Using a human adrenal cell line, NCIH295, which has been
shown to secrete LPL,23 a similar (18%) increase in
luciferase activity was seen with the G allele. For a common
mutation with small effect, this is the order of increase that would be
predicted. This observation suggests a mechanism for the -93G/D9
allele-associated reduction in plasma Tg levels in vivo, by
resulting in increased LPL mRNA and protein and thus increased
catabolism of Tg-rich particles. Since the -93 nucleotide
lies within the region of LSE-2, identified by Tanuma et
al17 as a potential LSE, it is possible that the T-to-G
change at -93 results specifically in the disruption of LSE-2, leading
to increased expression of LPL. However, evidence from the bandshift
assay does not support this hypothesis, since the T allele did not
bind a nuclear protein under the assay conditions. In contrast, the
increased promoter activity of the -93G-luciferase fusion protein
suggested that the -93G has a motif that is recognized by a nuclear
factor that does not bind (or binds very poorly) to the T allele;
hence, the T competitor could not compete out the G protein
interaction, while increasing amounts of unlabeled G probe did.
Therefore, results from both the luciferase and bandshift assays
clearly demonstrate that the G allele results in increased promoter
activity, and the interaction with protein extract suggests this
activity is due to binding of a nuclear factor to the G allele,
which enhances promoter activity.
The 18-fold higher carrier frequency in the -93G in Afro-Caribbeans compared with Caucasians suggests that -93G is in fact the ancestral form of the LPL gene, providing a nuclear binding recognition sequence that could promote LPL expression. Support of this hypothesis comes from DNA sequencing of the LPL promoter from gorilla, orangutan, and chimpanzee; all three species have a G at position -93 (unpublished data, S Hall, 1996). If the "out-of-Africa" hypothesis is correct, it could be speculated that migrating individuals carried the rarer -93T allele, which then became the common allele in whites. Our data suggest that the G-to-T change at -93 leads to the loss of a recognition sequence for a nuclear protein that can upregulate LPL expression in the face of increasing Tg and that this ability has been lost in -93T white carriers. Identification of this endogenous protein will be necessary to confirm our hypothesis.
Thus, the transfection data support a direct effect of the -93G variant on LPL transcription, and its association with lower Tg levels might be due to higher levels of LPL mRNA in muscle and adipose tissue and thus higher levels of secretion of LPL. LPL activity measures of -93G carriers may clarify this possibility, but it is likely that owing to the insensitivity and large coefficient of variation of the postheparin LPL assay, a moderate difference of 24% predicted from the A10 transfection data (18% in NCIH295 cells) may not be easily detectable. In white populations, the impact of -93G on lipid levels will not be large, because of the low frequency of the mutation. However, in people of Afro-Caribbean origin, in whom the frequency is dramatically higher and most of the -93G mutations occur independently of the N9, the impact at the population level might be greater, which might directly contribute to the lower plasma Tg levels and thus the reduced coronary artery disease risk reported in Afro-Caribbeans.30 31 Studies are under way to test this hypothesis.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received October 14, 1996; accepted January 15, 1997.
| References |
|---|
|
|
|---|
2.
Bainton D, Miller NE, Bolton CH, Yarnell JW, Sweetnam
PM, Baker IA, Lewis B, Elwood PC. Plasma
triglyceride and high density lipoprotein
cholesterol as predictors of ischaemic heart disease in
British men: the Caerphilly and Speedwell Collaborative Heart Disease
Studies. Br Heart J. 1992;68:60-66.
3. Assmann G, Schulte H. Role of triglycerides in coronary artery disease: lessons from the Prospective Cardiovascular Munster Study. Am J Cardiol. 1992;70:10H-13H.[Medline] [Order article via Infotrieve]
4. Bengtsson C, Bjorkelund C, Lapidus L, Lissner L. Associations of serum lipid concentrations and obesity with mortality in women: 20-year follow up of participants in prospective population study in Gothenburg, Sweden. BMJ. 1993;307:1385-1388.
5.
Beisiegel U, Weber W, Bengtsson-Olivecrona G.
Lipoprotein lipase enhances the binding of chylomicrons to low density
lipoprotein receptorrelated protein. Proc Natl Acad Sci
U S A. 1991;88:8342-8346.
6. Santamarina Fojo S, Brewer HB Jr. Lipoprotein lipase: structure, function and mechanism of action. Int J Clin Lab Res. 1994;24:143-147.[Medline] [Order article via Infotrieve]
7. Hayden MR, Ma Y. Molecular genetics of human lipoprotein lipase deficiency. Mol Cell Biochem. 1992;113:171-176.[Medline] [Order article via Infotrieve]
8. Lalouel J, Wilson DE, Iverius PH. Lipoprotein lipase and hepatic triglyceride lipase: molecular and genetic aspects. Curr Opin Lipidol. 1992;3:86-95.
9. Babirak SP, Brown BG, Brunzell JD. Familial combined hyperlipidemia and abnormal lipoprotein lipase. Arterioscler Thromb. 1992;12:1176-1183.[Abstract]
10.
Mailly F, Tugrul Y, Reymer PW, Bruin T, Seed M,
Groenemeyer BF, Asplund-Carlson A, Vallance D, Winder AF, Miller GJ,
Kastelein JJP, Hamsten A, Olivecrona G, Humphries SE, Talmud PJ. A
common variant in the gene for lipoprotein lipase (Asp9
Asn):
functional implications and prevalence in normal and
hyperlipidemic subjects. Arterioscler Thromb Vasc
Biol. 1995;15:468-478.
11. Reymer PW, Gagne E, Groenemeyer BE, Zhang H, Forsyth I, Jansen H, Seidell JC, Kromhout D, Lie KE, Kastelein J, Hayden MR. A lipoprotein lipase mutation (Asn291Ser) is associated with reduced HDL cholesterol levels in premature atherosclerosis. Nat Genet. 1995;10:28-34.[Medline] [Order article via Infotrieve]
12.
Fisher RM, Mailly F, Peacock RE, Hamsten A, Seed M,
Yudkin JS, Beisiegel U, Feussner G, Miller G, Humphries SE, Talmud PJ.
Interaction of the lipoprotein lipase asparagine 291
serine mutation
with body mass index determines elevated plasma
triacylglycerol concentrations: a study in
hyperlipidemic subjects, myocardial infarction
survivors, and healthy adults. J Lipid Res. 1995;36:2104-2112.[Abstract]
13. Mailly F, Fisher R, Nicaud V, Luong L, Evans AE, Marques-Vidal P, Luc G, Arveiler D, Bard JM, Poirier O, Talmud P, Humphries SE. Association between the LPL-D9N mutation in lipoprotein lipase gene and plasma lipid traits in myocardial infarction survivors from the ECTIM study. Atherosclerosis. 1996;122:21-28.[Medline] [Order article via Infotrieve]
14. Miller GJ, Bauer KA, Barzegar S, Cooper JA, Rosenberg RD. Increased activation of the haemostatic system in men at high risk of fatal coronary heart disease. Thromb Haemost. 1996;75:767-771.[Medline] [Order article via Infotrieve]
15.
Previato L, Parrott CL, Santamarina Fojo S, Brewer HB
Jr. Transcriptional regulation of the human lipoprotein lipase gene in
3T3-L1 adipocytes. J Biol Chem. 1991;266:18958-18963.
16.
Enerback S, Ohlsson BG, Samuelsson L, Bjursell
G. Characterization of the human lipoprotein lipase (LPL)
promoter: evidence of two cis-regulatory regions,
LP-alpha and LP-beta, of importance for the differentiation-linked
induction of the LPL gene during adipogenesis. Mol Cell
Biol. 1992;12:4622-4633.
17. Tanuma Y, Nakabayashi H, Esumi M, Endo H. A silencer element for the lipoprotein lipase gene promoter and cognate double- and single-stranded DNA-binding proteins. Mol Cell Biol. 1995;15:517-523.[Abstract]
18. Cruickshank JK, Cooper J, MacDuff J, Burnett M. Ethnic differences in fasting plasma C-peptide and insulin in relation to glucose tolerance and blood pressure. Lancet. 1991;338:842-844.[Medline] [Order article via Infotrieve]
19.
Miller SA, Dykes DD, Polesky HF. A simple
salting out procedure for extracting DNA from human nucleated
cells. Nucleic Acids Res. 1988;16:1215.
20.
Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel
SS, Miller OJ, Breg WR, Jones HW Jr, Rary JM. Analysis
of human Y-chromosomespecific reiterated DNA in chromosome
variants. Proc Natl Acad Sci U S A. 1977;74:1245-1249.
21. Day IN, Humphries SE. Electrophoresis for genotyping: microtiter array diagonal gel electrophoresis on horizontal polyacrylamide gels, hydrolink, or agarose. Anal Biochem. 1994;222:389-395.[Medline] [Order article via Infotrieve]
22.
Gudnason V, Mak YT, Betteridge J, McCarthy SN,
Humphries S. Use of the single-strand conformational
polymorphism method to detect recurrent and novel mutations in the
low-density lipoprotein receptor gene in patients with familial
hypercholesterolemia: detection of a novel
mutation Asp200
Gly. Clin Investig.. 1993;71:331-337.[Medline]
[Order article via Infotrieve]
23.
Staels B, Martin G, Martinez M, Albert C,
Peinado-Onsurbe J, Saladin R, Hum DW, Reina M, Vilaro S, Auwerx
J. Expression and regulation of the lipoprotein lipase gene in
human adrenal cortex. J Biol Chem. 1996;271:17425-17432.
24. Chakravarti A, Buetow KH, Antonarakis SE, Waber PG, Boehm CD, Kazazian HH. Nonuniform recombination within the human beta-globin gene cluster. Am J Hum Genet. 1984;36:1239-1258.[Medline] [Order article via Infotrieve]
25.
Templeton AR, Sing CF, Kessling A, Humphries S.
A cladistic analysis of phenotype associations with
haplotypes inferred from restriction endonuclease mapping, II: the
analysis of natural populations. Genetics. 1988;120:1145-1154.
26. Welch W, James J, Brown-Forsythe BF. Robust alternatives to traditional analysis of variance. In: Reed JF, Stark DB, eds. Computer Methods and Programs in Biomedicine. Amsterdam, Netherlands: Elsevier Science; 1988:233-237.
27.
Yang WS, Nevin DN, Peng R, Brunzell JD, Deeb SS.
A mutation in the promoter of the lipoprotein lipase (LPL) gene in a
patient with familial combined hyperlipidemia and low
LPL activity. Proc Natl Acad Sci U S A. 1995;92:4462-4466.
28. Zhang H, Henderson H, Gagne SE, Clee SM, Miao L, Liu G, Hayden MR. Common sequence variants of lipoprotein lipase: standardized studies of in vitro expression and catalytic function. Biochim Biophys Acta. 1996;1302:159-166.[Medline] [Order article via Infotrieve]
29.
Ye S, Erikksson P, Hamsten A, Kirkinen M, Humphries SE,
Henney AM. Progression of coronary
atherosclerosis is associated with a common genetic
variant of the human stromelysin-1 promoter results in reduced gene
expression. J Biol Chem. 1996;271:13055-13060.
30. Fontbonne A, Papoz L, Eschwege E, Roger M, Saint Paul M, Simon D. Features of insulin-resistance syndrome in men from French Caribbean Islands: the Telecom Study. Diabetes. 1992;41:1385-1389.[Abstract]
31. Chaturvedi N, McKeigue PM, Marmot MG. Relationship of glucose intolerance to coronary risk in Afro-Caribbeans compared with Europeans. Diabetologia. 1994;37:765-772.[Medline] [Order article via Infotrieve]
32. Currie RA, Eckel RH. Characterization of a high affinity octamer transcription factor binding site in the human lipoprotein lipase promoter. Arch Biochem Biophys. 1992;298:630-639.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
H. Wang and R. H. Eckel Lipoprotein lipase: from gene to obesity Am J Physiol Endocrinol Metab, August 1, 2009; 297(2): E271 - E288. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Wittrup, R. V. Andersen, A. Tybjaerg-Hansen, G. B. Jensen, and B. G. Nordestgaard Combined Analysis of Six Lipoprotein Lipase Genetic Variants on Triglycerides, High-Density Lipoprotein, and Ischemic Heart Disease: Cross-Sectional, Prospective, and Case-Control Studies from the Copenhagen City Heart Study J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1438 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. L. Ruel, D. Gaudet, P. Perron, J. Bergeron, P. Julien, and B. Lamarche Characterization of LDL Particle Size Among Carriers of a Defective or a Null Mutation in the Lipoprotein Lipase Gene: The Quebec LIPD Study Arterioscler Thromb Vasc Biol, July 1, 2002; 22(7): 1181 - 1186. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. McGladdery and J. J. Frohlich Lipoprotein lipase and apoE polymorphisms: relationship to hypertriglyceridemia during pregnancy J. Lipid Res., November 1, 2001; 42(11): 1905 - 1912. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cruickshank, J. Mbanya, R Wilks, B Balkau, N McFarlane-Anderson, and T Forrester Sick genes, sick individuals or sick populations with chronic disease? The emergence of diabetes and high blood pressure in African-origin populations Int. J. Epidemiol., February 1, 2001; 30(1): 111 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dachet, O. Poirier, F. Cambien, J. Chapman, and M. Rouis New Functional Promoter Polymorphism, CETP/-629, in Cholesteryl Ester Transfer Protein (CETP) Gene Related to CETP Mass and High Density Lipoprotein Cholesterol Levels : Role of Sp1/Sp3 in Transcriptional Regulation Arterioscler Thromb Vasc Biol, February 1, 2000; 20(2): 507 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cheng, M. A. Grow, C. Pallaud, W. Klitz, H. A. Erlich, S. Visvikis, J. J. Chen, C. R. Pullinger, M. J. Malloy, G. Siest, et al. A Multilocus Genotyping Assay for Candidate Markers of Cardiovascular Disease Risk Genome Res., October 1, 1999; 9(10): 936 - 949. [Abstract] [Full Text] |
||||
![]() |
H. H. Wittrup, A. Tybjærg-Hansen, and B. G. Nordestgaard Lipoprotein Lipase Mutations, Plasma Lipids and Lipoproteins, and Risk of Ischemic Heart Disease : A Meta-Analysis Circulation, June 8, 1999; 99(22): 2901 - 2907. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Wittrup, A. Tybjærg-Hansen, R. Steffensen, S. S. Deeb, J. D. Brunzell, G. Jensen, and B. G. Nordestgaard Mutations in the lipoprotein lipase Gene Associated With Ischemic Heart Disease in Men : The Copenhagen City Heart Study Arterioscler Thromb Vasc Biol, June 1, 1999; 19(6): 1535 - 1540. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Talmud, S. Hall, S. Holleran, R. Ramakrishnan, H. N. Ginsberg, and S. E. Humphries LPL promoter -93T/G transition influences fasting and postprandial plasma triglycerides response in African-Americans and Hispanics J. Lipid Res., June 1, 1998; 39(6): 1189 - 1196. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1997 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |