Articles |
From the Joseph J. Jacobs Center for Thrombosis and Vascular Biology, Cleveland Clinic Foundation, Cleveland, Ohio, and the Department of Cardiovascular Medicine (N.B., R.L.), Stanford University, Stanford, Calif.
Correspondence to Jane Hoover-Plow, Department of Molecular Cardiology, Joseph J. Jacobs Center for Thrombosis and Vascular Biology/FF20, Cleveland Clinic Foundation, 9500 Euclid Ave, Cleveland, OH 44195.
| Abstract |
|---|
|
|
|---|
Key Words: lipoprotein(a) lysine-binding site recombinant apo(a) functional immunoassay
| Introduction |
|---|
|
|
|---|
The kringles of plasminogen, including K4 and K5, function as LBS. The LBS of plasminogen recognize lysines, primarily carboxy-terminal lysines.6 7 This activity is responsible for the binding of plasminogen to lysine-Sepharose and, more importantly, for the interaction of plasminogen and plasmin with substrates,8 9 inhibitors,10 and cellular receptors.11 12 Lp(a) also binds to lysine-Sepharose,3 several cell types, including hepatocytes,13 14 monocytes,15 16 17 and endothelial cells,18 19 and extracellular matrices20 21 and matrix proteins.22 23 These interactions can be inhibited, at least in part, by lysine and lysine analogues.18 19 21 In addition, Lp(a) can also interfere with certain functions of plasminogen that are mediated by the LBS.15 19 24 25 26 These data indicate that one or more of the kringles of apo(a) has LBS activity. On the basis of the crystal structure of K4 of plasminogen,27 the LBS is composed of a trough lined by three aromatic residues, flanked on one end by two anionic (Asp, Asp) residues and at the other end by two cationic (Lys, Arg) residues. The sequence of apo(a) shows that its final kringle 4 repeat, K4-37 (nomenclature of McLean et al5 ), has the appropriate residues to form an LBS. This prediction has been experimentally supported by using mutated recombinant K4-3728 and by showing that naturally occurring apo(a) with a single amino acid substitution in K4-37 lacks LBS function.29 30 On the basis of their amino acid sequences, other apo(a) kringles are predicted to be lower-affinity LBS, to be nonfunctional, or to have a relaxed specificity.31 32
The pathogenicity of Lp(a) as a risk factor for cardiovascular disease may depend on its LBS,26 33 34 which imparts unique functions to Lp(a) not shared with LDL, including a potential to interfere with fibrinolysis. However, the LBS function of Lp(a) varies within the population.30 35 36 This variability is due at least in part to amino acid polymorphisms in K4-37,37 38 but other heterogeneities in Lp(a) structure,1 such as the lipid and carbohydrate composition or the overall organization of the particle, may also influence LBS function.
The current approach to measure the LBS function of Lp(a) is to use lysine-Sepharose chromatography.30 35 36 This approach is cumbersome, requires relatively large samples, and does not discriminate graded variations in LBS activity. Accordingly, the purpose of the present study was to develop a less cumbersome and more accurate assay to quantify the LBS function of Lp(a). An immunoassay that can assess the LBS function of Lp(a) in a small amount of plasma has been developed that can quantify the effects of enzymatic, chemical, and mutational modifications of Lp(a) on LBS. Ultimately, this assay will permit an examination of the relationship of size, concentration, and LBS activity of Lp(a) in plasma samples from patients with atherosclerotic cardiovascular disease.
| Methods |
|---|
|
|
|---|
Construction of Apo(a) cDNA Expression Plasmid
The expression plasmid pCMha8, containing eight K4-like domains
as well as the K5-like and protease-like domains, was constructed
from the apo(a) cDNA expression plasmid pRK5ha17, which has been
described by Koschinsky et al.39 Briefly, plasmid pRK5ha17
was partially digested with HindIII, which cleaves in 12
positions (1113, 1455, 1797, 2139, 2823, 3165, 3507, 3849, 4191, 4533,
and 4875) in the apo(a) cDNA sequence and position 7890 in the 3'
untranslated region.5 The resulting fragments, which
eliminated most repeated kringles but retained the K4-32'
untranslated region, were isolated and relegated. After transformation,
a clone that eliminated nine repeated kringles was isolated. The
resulting construct, which encoded the 5' untranslated region, the
signal sequence, the first two K4-like repeats, and a fusion kringle
containing 149 bp of the third K4-like domain and 341 bp of K4-32,
followed by the K4-33K4-37, K5-like, and protease-like domain and
67 bp of the 3' untranslated sequence, was confirmed by DNA
sequencing.
Site Direct Mutagenesis
Substitution mutants were prepared by using a unique
site-elimination mutagenesis kit (Pharmacia Biotech Inc) according
to the manufacturer's suggestions. Briefly,
5'GAATCCAGCGGCCCCTTGG3', a complementary
oligonucleotide (Lysmuta) consisting of 3-bp mutant
sequences that changed amino acid Asp at positions 55 and 57 in K4-37
of the r-apo(a) to Ala and Ala, was synthesized to eliminate the
two negatively charged residues of the lysine-binding
pocket.40 The mutation sequences also introduced a unique
Not I recognition site. This primer was annealed to
heat-denatured plasmid pCMha8 together with a second
oligonucleotide (Xhomuta),
5'GGTTCTATCCATTGAATTCTAGATCTCGTCGACCCTG3', which eliminates a unique
Xho I site from the vector backbone. The annealed primers
were extended and ligated with T4 polymerase and
T4 ligase. After digestion with Xho I to
linearize wild-type plasmids, the mixture was used to transform
repair-deficient Escherichia coli strain BMH71-18MutS.
Plasmid DNA prepared from a culture of the transformed cells was
subjected to a second round of Xho I digestion and
transformation to become further enriched with mutated plasmids.
Mutants were identified by Not I digestion and confirmed by
DNA sequencing. The resulting plasmid was designated pCMha8Lysmuta.
Cell Culture and Transfection
The 293 cells (human embryonic kidney41 ) were
cultured in 60-mm dishes with Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum. Transfection experiments were
performed by using lipofectin (Life Technologies, Inc). Plasmids pCMha8
and pCMha8Lysmuta were purified by using ion-exchange columns
(Qiagen Inc). The 293 cells were seeded at 0.75x106
cells per 60-mm dish, and transfection was performed when the cells
attained 40% to 60% confluence. For each dish, 10 µg of either
plasmid DNA was mixed with 1.5 mL Opti-MEM medium (GIBCO/BRL) in a
polystyrene tube, and 1.5 mL Opti-MEM containing 70 µg lipofectin
(GIBCO/BRL) was added. The lipofectin/DNA complexes were allowed to
form for 15 minutes at room temperature and added to the dishes after
washing the monolayers twice with Puck's saline A (GIBCO/BRL). After 5
hours, the medium was replaced by 5 mL Opti-MEM, and incubation was
continued for 24 hours. The medium was harvested, adjusted to 1 mmol/L
phenylmethylsulfonyl fluoride, centrifuged for 10
minutes at 4000g to remove cell debris, and concentrated
from 50 to 1 mL by using Centriprep 100 concentrator (Amicon
Inc). The concentrated medium was analyzed by using reducing
sodium dodecyl sulfatepolyacrylamide gel
electrophoresis and subsequent immunoblotting. The
concentrated medium containing the r-apo(a) was added directly to
the LBS-Lp(a) assay. The concentrations of r-apo(a) were
determined by using the MACRA Lp(a) assay kit.
LBS-Lp(a) Assay
To identify an antibody specific for LBS, 96-well microtiter
plates were coated with 20 µg/mL Lp(a) or plasminogen in
PBS (150 mmol/L NaCl and 10 mmol/L phosphate buffer, pH 7.4) and
incubated overnight at 4°C. Plates were washed four times with buffer
I (PBS, 1 g/L BSA, 0.2 g/L sodium azide, 0.5 g/L Tween 20, and 10 U/L
aprotinin) and coated with 30 g/L gelatin in PBS at 200 µL/well for
60 minutes at 23°C. Plates were incubated at 37°C to melt the
gelatin, which was removed by aspiration. A 100-µL aliquot of a
candidate antibody was added to wells at increasing dilutions in the
presence or absence of 200 mmol/L EACA and incubated for 2 hours at
37°C. Plates were washed four times with 200 µL per well of buffer
I. To each well was added 100 µL alkaline phosphataseconjugated
secondary antibody (raised against mouse or rabbit IgG) that was
diluted in 100 mmol/L Tris, 100 mmol/L NaCl, 5 mmol/L
MgCl2, and 0.5 g/L Tween 20, pH 7.5, and incubated
for 1 hour at 37°C. Plates were washed four times with 200 µL
buffer I, and 100 µL pnitrophenyl phosphate at 1 mg/mL
in buffer (in mmol/L: Tris-HCl 100, NaCl 100, and MgCl2 5,
pH 9.5) was added to each well. The reaction was stopped with 1 mmol/L
NaOH after 10 minutes at room temperature, and the absorbance of
individual wells was read at 405 nm by using a spectrophotometer.
The antibody ultimately identified as detecting the LBS of Lp(a) was raised in rabbits against the K4 of plasminogen.42 The anti-K4 antibodies were immunopurified by applying the initial antiserum to a plasminogen-Sepharose column (4 mg plasminogen/mL) and eluting the desired antibody with 200 mmol/L EACA.43 The immunopurified antibody was then used in the assays at 0.06 to 0.6 mg/L.
To identify the Lp(a) capture antibody, candidate antibodies were absorbed onto microtiter wells overnight at 4°C. The wells were washed four times with buffer I and coated with 30 g/L gelatin as described above. Various dilutions of reference Lp(a), negative and positive Lp(a) serum diluted in PBS, purified kringle-containing proteins diluted in PBS with 3 g/L BSA, and medium containing r-apo(a) were added to the antibody-coated wells and incubated for 1 hour at 37°C. The wells were then washed four times with buffer I, and the LBS antibody identified above was added at the selected dilution in 100 µL. After 2 hours at 37°C the plates were washed four times with buffer I, and the secondary disclosing antibody was added as described above.
Quantification of Plasma Lp(a)
The concentration of Lp(a) in plasma samples was determined by
using an established method44 45 or a commercial assay
[MACRA Lp(a) kit] using the kit standards and the isolated reference
Lp(a) standard. Both assays are specific for Lp(a) in the presence of
plasminogen, high triglyceride levels or high
cholesterol, and Lp(a) quantification is not affected by
apo(a) size.44 46 The specificity of the apo(a) antibodies
used in these assays has been described.44 45
| Results |
|---|
|
|
|---|
|
The reactivity of the immunopurified anti-K4 with the LBS of Lp(a) was
evaluated further. The binding of varying concentrations of this
antibody to immobilized Lp(a) and plasminogen
in the presence or absence of EACA is shown in Fig 1
. In
the absence of EACA, the antibody reacted in a dose-dependent
manner with both immobilized Lp(a) and
plasminogen. EACA effectively blocked the binding of all
antibody concentrations to both target antigens.
|
While the above data indicate that anti-K4 reacts only with unoccupied
LBS, this antiserum does not discriminate between the LBS of Lp(a) from
plasminogen or other potential LBS-containing proteins. To
establish specificity for the LBS of Lp(a), monoclonal antibodies to
apo(a) were used to selectively capture Lp(a). For this purpose, the
anti-apo(a)-coated microtiter plates provided in commercially
available assay kits (MACRA, Strategic Diagnostics,
Apo-Tek, PerImmune) for quantifying Lp(a) were employed. The plates
from two different suppliers gave similar results. Both capture
antibodies from these two kits have been
characterized45 46 and are reported not to bind to
plasminogen, LDL, VLDL, or HDL. In addition, neither
triglycerides, hemoglobin, nor bilirubin interfere with the
Lp(a) quantification in these assays. The capture antibody is reported
to be insensitive to size polymorphism. Lp(a) or other
kringle-containing proteins were added to these plates followed by
anti-K4 and then the disclosing reagents. In this configuration, Lp(a)
(6.7 mg/L protein) gave a positive signal (absorbance=1.1), but
plasminogen, at its plasma concentrations of 200 mg/L
(30 000-fold above the test Lp[a] concentration), reacted poorly
(absorbance<0.2). Other kringle-containing proteins at their
approximate plasma concentrations, urokinase (100 ng/L) and
tissue-type plasminogen activator (100
ng/L), also gave minimal signals (absorbance<0.2). Furthermore, the
LBS activity of the isolated Lp(a) was not altered when assayed in the
presence of various plasma proteins (Table 2
). The
absorbance for the LBS activity of the Lp(a) plus the other proteins
was 97% to 108% of the reference Lp(a) alone.
|
Further evidence for the appropriate specificity of the assay with
anti-apo(a) as a capturing reagent and anti-K4 as an LBS reporter
is provided in the analysis shown in Fig 2
. When
a constant concentration of isolated Lp(a) was added to various
dilutions of an Lp(a)-negative plasma, the same signal was obtained at
all plasma dilutions. A number of plasma samples, including
hyperlipidemic plasma, have been tested in a similar
manner (Table 3
). The LBS activity of isolated Lp(a) (20
µg/mL) added in varying dilutions to either normolipidemic or
hyperlipidemic plasma was similar (coefficient of
variation=8%). Thus, the naturally occurring plasma proteins with
kringles, including plasminogen, did not interfere with the
assay. EACA blocked binding at all dilutions, indicating that the LBS
of the captured Lp(a) must be unoccupied for reaction with the anti-K4.
In addition, these data also demonstrate the feasibility of measuring
the LBS status of Lp(a) within plasma samples.
|
|
The final configuration and format of the LBS-Lp(a) immunoassay used to
quantify the LBS function of Lp(a) are summarized in Fig 3
. Step 1 entails a 1-hour incubation of the
Lp(a)-containing sample, such as plasma, in microtiter wells coated
with anti-apo(a) as a capturing antibody. Step 2 involves a 2-hour
incubation with the immunopurified anti-K4. In step 3 the disclosing
antibody is added, and after 1 hour the colorimetric
reaction is developed by the addition of substrate.
|
By using this configuration, varying concentrations of a
single-isoform Lp(a) were added to the assay. This particular Lp(a)
is completely retained on lysine-Sepharose columns.1 47 A
dose-response curve was obtained with evidence of saturation at
Lp(a) concentrations >5 mg/L (Fig 3
, bottom). In subsequent
experiments, this Lp(a) was used as a reference standard. The LBS
activity within unknown samples was quantified relative to this
reference Lp(a) as: percent reference Lp(a)=[absorbance of unknown (5
mg/L)x100]÷absorbance reference standard (5 mg/L). The dilution of
the test sample required to obtain 5 mg/L Lp(a) was determined by using
the MACRA Lp(a) assay kit. Specific applications of the LBS-Lp(a)
immunoassay using this protocol are described below.
LBS Activity of Purified Lp(a)
Two Lp(a) preparations from different donors were introduced into
the LBS-Lp(a) immunoassay at 5 µg/mL in the presence of varying
concentrations of lysine and EACA (Fig 4
). The two
lysine analogues produced similar dose-dependent inhibition of
antibody binding to the two Lp(a) isoforms (Fig 4
). The average
IC50 values for the two donors were 0.5 and 3.7 mmol/L for
EACA and lysine, respectively. These values are in excellent agreement
with those obtained for these compounds in an earlier lysine-bead
assay47 (1.3 and 3.8 mmol/L for EACA and lysine,
respectively). Thus, the LBS-Lp(a) immunoassay appears to accurately
report on the relative affinity of the LBS for lysine analogs.
|
LBS Function of Lp(a) in Plasma
The LBS-Lp(a) immunoassay was used to assess plasma samples
containing Lp(a) with established defects in LBS activity, ie, the
Lp(a) isolated from these plasma samples showed minimal retention on
lysine-Sepharose columns. The three samples used, kindly provided by Dr
Angelo Scanu, included two plasma samples with Lp(a) particles having
the Trp
Arg substitution at position 72 of K4-37, a substitution
known to markedly diminish the LBS function of Lp(a).29 30
The LBS activity of these plasma samples was quantified relative to the
reference Lp(a) as described above (Table 4
). The two
patients with the Trp
Arg substitution showed extremely low activity
in the LBS-Lp(a) immunoassay [0% and 5.7% of the reference standard
Lp(a)]. Rhesus monkey Lp(a), which also has the Trp
Arg mutation at
K4-37, has low binding to lysine-Sepharose columns30 and
lysine-bead assays47 and low LBS activity (13%) as
well. Another plasma sample known to have low reactivity with
lysine-Sepharose (8%) but lacking the Trp
Arg mutation also
exhibited low LBS-Lp(a) activity (6.7%). As discussed by Scanu et
al,30 the sample with low LBS activity but lacking the
Trp
Arg mutation may have another mutation of one or more amino acids
critical for LBS activity.48 In a wild-type plasma
sample prepared in identical fashion, another patient yielded an
LBS-Lp(a) activity of 98.6%, indicating that other Lp(a) particles in
plasma could approach the functional activity of the reference Lp(a)
standard.
|
Next, the relationship between LBS activity and total Lp(a) levels was
assessed in a panel of 29 plasma samples (Fig 5
).
LBS-Lp(a) activities extended from undetectable levels (0%) to levels
similar to and slightly exceeding the reference standard (defined as
100%). The relationship between LBS activity and the Lp(a)
concentration in this group of samples was not well correlated; the
correlation coefficient (R2) was only .476.
Thus, the LBS-Lp(a) immunoassay reported on a distinct property of
Lp(a).
|
r-Apo(a)
To test the prediction that K4-37 contains the most prominent LBS
of apo(a), this site was destroyed by changing the two key anionic
residues of the LBS (Asp 55 and 57) to alanine by in vitro mutagenesis.
The wild-type and the mutated K4-37 were expressed in an
r-apo(a) with eight K4-like domains followed by a single
K5 and a protease domain; Western blotting of the wild-type and
mutant r-apo(a) was performed (Fig 6
). The two
r-apo(a) reacted similarly with the apo(a) antibody used and were
of similar electrophoretic mobility. The culture media containing the
wild-type and mutated r-apo(a) were concentrated and
introduced into the LBS-Lp(a) assay in the presence or absence of EACA
(Fig 7
). As controls, conditioned medium from 293 cells
after 24 hours and concentrated (fourfold) conditioned medium were
tested for interference in the LBS assay. Adding 5 µg/mL of the
reference Lp(a) to these samples at varying dilutions (from zero to
1:243) did not change the LBS activity of the Lp(a). The coefficient of
variation was within the experimental error (medium, 6%; conditioned
medium, 6%; and concentrated conditioned medium, 3%). Nonspecific
binding determined in the presence of 100 mmol/L EACA was subtracted.
In the absence of EACA, the signal obtained with wild-type
r-apo(a) was 1.9-fold higher than with the mutant
r-apo(a). At 1 mmol/L EACA, the signal obtained with the
wild-type r-apo(a) was reduced by 63%. The signal obtained
with mutant r-apo(a) was reduced by 41%. Thus, LBS function was
substantially but not fully abolished in the mutant r-apo(a).
|
|
| Discussion |
|---|
|
|
|---|
When varying concentrations of lysine or EACA were introduced into the LBS-Lp(a) immunoassay, they produced a dose-dependent inhibition of signal. The concentrations of lysine and EACA required for 50% inhibition in the LBS-Lp(a) immunoassay were very similar to those required47 for blocking the binding of isolated Lp(a) to lysine-Sepharose beads. This similarity suggests that the LBS-Lp(a) immunoassay can be used to determine the relative affinity of the LBS of Lp(a) for lysine analogues. Blockade of the LBS of Lp(a) may be a useful therapeutic approach to limiting the pathogenetic effects of Lp(a). The LBS-Lp(a) immunoassay should provide a useful approach for screening various lysine-LBS inhibitors for potency and determining their consistency among Lp(a) samples from different patients. The LBS-Lp(a) immunoassay should also provide a method for screening the effects of modifications of the Lp(a) particle on LBS activity. While several studies49 50 51 indicate that the apo(a) portion of Lp(a) extends away from the apoB-100 and lipid core, apoB is closely associated with the lipid core. The apo(a) is attached to apoB via a disulfide linkage at K4-36.52 The K4-37 kringle is located close to the kringle, as are K4-32 to K4-35, which, according to Ernst et al,53 may also have LBS activity and be important for the assembly of the Lp(a) particle. These kringles near the attachment point of apoB to apo(a) may have variable LBS activity in different Lp(a) particles depending on the size and content of the lipid core or modification of the apoproteins. Detergent53 or low salt concentration29 influences LBS activity, supporting the potential for variable LBS function. Taken together, our data indicate that K4-37 is the primary determinant of the LBS activity of Lp(a). However, other factors, such as the exposure of secondary LBS in other kringles, changes in the organization of the lipoprotein particle, or the association of plasma proteins, may influence LBS function. It appears that the LBS-Lp(a) assay can faithfully report on such variations in the LBS function of Lp(a).
The LBS-Lp(a) immunoassay was applied to a small panel of plasma
samples. LBS activity ranged from 0% to 100% of the reference Lp(a).
The binding of Lp(a) from different individuals to a lysine-Sepharose
column varies from 40% to 80%, 17% to 91%, and 30% to
70%.35 36 54 The explanation for these ranges of LBS
activity could be one or more of the following. Mutations in K4-37 may
reduce or abolish LBS activity; other kringles with or without
mutations may have some LBS function53 ; in vivo
modifications (eg, oxidation,55
reduction,54 56 sialyation/desialyation,57 or
lipid composition and degradation58 ) of Lp(a) may
influence LBS activity; and kringle number may influence the
accessibility of some kringles, ie, Lp(a) size may influence LBS
activity.59 Limited correlation was found in the samples
studied between the Lp(a) concentrations in these plasmas and LBS
activity. Thus, the LBS-Lp(a) immunoassay may report on a distinct
property of Lp(a) independent of its plasma concentration. Nearly 20
retrospective and prospective studies have confirmed that Lp(a) is a
major risk factor for coronary heart disease and
stroke.60 61 62 63 Karmansky et al36 compared two
groups of patients, one with moderate and one with severe
coronary artery disease, and found that the LBS activity of
Lp(a) was nearly threefold higher in the severe coronary artery
disease patients. Not all subjects with high Lp(a) levels have high LBS
activity (Table 1
), just as size is not an absolute predictor of
concentration.64 65 A good test for the usefulness of the
LBS-Lp(a) assay would be to analyze a population in which high
a Lp(a) level is not a risk factor compared with a population in which
high Lp(a) is a risk factor. Studies are now under way to determine the
relationship between the signal in the LBS-Lp(a) immunoassay and
pathogenesis in such well-characterized panels of clinical
specimens. One interesting possibility is that the LBS-Lp(a)
immunoassay will help to identify those patients with elevated Lp(a)
levels who are at particularly high risk for the development of
coronary disease. As a cautionary caveat, the signal
obtained with plasma samples in the LBS-Lp(a) immunoassay is critically
dependent on the input concentration of Lp(a). The
heterogeneity among individual Lp(a) samples can
influence their quantification in the initial Lp(a)
assays.66 Thus, further development and use of the
LBS-Lp(a) immunoassay must be closely coordinated with development of
reliable assays for Lp(a) quantification.
The LBS-Lp(a) immunoassay was used to characterize the LBS activity of a wild-type and mutant r-apo(a). On the basis of initial sequencing, wild-type K4-37 was predicted to have a functional LBS. This supposition has been supported by molecular modeling,29 31 by characterization of Lp(a) particles containing naturally occurring substitutions within this LBS, and by expression and analyses of this recombinant kringle. The mutant r-apo(a) contained two substitutions at the critical aspartic acid residues in the LBS of K4-37 and should have diminished LBS activity.48 Consistent with these predictions, the mutant r-apo(a) showed a significant decrease in reactivity in the LBS-Lp(a) immunoassay relative to wild-type r-apo(a). Nevertheless, the LBS-Lp(a) activity of the mutant r-apo(a) was not fully lost. Assembly of apo(a) into LDL requires LBS activity and is inhibited by EACA.49 67 68 While our study was in progress, Ernst et al53 reported that r-apo(a) may contain two LBSs, one associated with K4-37 and a second within the K4-32K4-36 region, and suggested that this second LBS is not expressed within the intact Lp(a) particle. Edelstein et al69 have shown that apo(a) from rhesus monkeys binds LDL particles to form Lp(a); this incorporation is EACA-sensitive. Nevertheless, rhesus monkey Lp(a), which has a nonfunctional LBS in K4-37 due to a point substitution,29 does not have an exposed LBS. Thus, the existence of two LBS in apo(a), with only the one in K4-37 being available in the intact human Lp(a) particle, provides one possible explanation for our data and is consistent with recent reports. Transgenic mice that express human apo(a) or Lp(a) are more susceptible to diet-induced atherosclerosis than control animals.70 The in vivo effects of mutant r-apo(a), either as free apo(a) or incorporated into Lp(a) particles, should be very informative in terms of assessing the contributions of the two potential LBS (K4-37 and K4-32K4-36) to the pathogenesis of Lp(a). The analyses of these mice to determine whether Lp(a) particles are formed, and, if so, whether the particles have LBS function, should resolve the contributions of the two LBS to Lp(a) assembly.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received June 23, 1995; accepted December 19, 1995.
| References |
|---|
|
|
|---|
2.
Utermann G. The mysteries of
lipoprotein(a). Science. 1989;246:904-910.
3.
Eaton DL, Fless GM, Kohr WJ, McLean JW, Xu Q-T, Miller
CG, Lawn RM, Scanu AM. Partial amino acid sequence of
apolipoprotein(a) shows that it is homologous to
plasminogen. Proc Natl Acad Sci U S A. 1987;84:3224-3228.
4. Sottrup-Jensen L, Claeys H, Zajdel M, Petersen TE, Magnusson S. The primary structure of human plasminogen: isolation of two lysine-binding fragments and one `mini' plasminogen (MW 38,000) by elastase-catalyzed-specific limited proteolysis. In: Davidson JF, Rowan RM, Samama MM, Desnoyers PC, eds. Progress in Chemical Fibrinolysis and Thrombolysis, III. New York, NY: Raven Press; 1978:191-209.
5. McLean JW, Tomlinson JE, Kuang W-J, Eaton DL, Chen EY, Fless GM, Scanu AM, Lawn RM. cDNA sequence of human apolipoprotein(a) is homologous to plasminogen. Nature. 1987;330:132-137. [Medline] [Order article via Infotrieve]
6. Skoza L, Tse AO, Semar M, Johnson AJ. Comparative activities of amino acid and polypeptide inhibitors on natural and synthetic substrates. Ann N Y Acad Sci. 1968;146:659-672. [Medline] [Order article via Infotrieve]
7. Winn ES, Hu S-P, Hochschwender SM, Laursen RA. Studies on the lysine-binding sites of human plasminogen: the effect of ligand structure on the binding of lysine analogs to plasminogen. Eur J Biochem. 1980;104:579-586. [Medline] [Order article via Infotrieve]
8.
Lucas MA, Fretto LJ, McKee PA. The binding of
human plasminogen to fibrin and fibrinogen.
J Biol Chem. 1983;258:4249-4256.
9.
Knudsen BS, Silverstein RL, Leung LLK, Harpel PC,
Nachman RL. Binding of plasminogen to extracellular
matrix. J Biol Chem. 1986;261:10765-10771.
10. Wiman B, Collen D. On the kinetics of the reaction between human antiplasmin and plasmin. Eur J Biochem. 1978;84:573-578. [Medline] [Order article via Infotrieve]
11.
Miles LA, Dahlberg CM, Plow EF. The
cell-binding domains of plasminogen and their function
in plasma. J Biol Chem. 1988;263:11928-11934.
12. Miles LA, Dahlberg CM, Plescia J, Felez J, Kato K, Plow EF. Role of cell-surface lysines in plasminogen binding to cells: identification of alpha-enolase as a candidate plasminogen receptor. Biochemistry. 1991;30:1682-1691. [Medline] [Order article via Infotrieve]
13.
Kostner GM. Interaction of Lp(a) and of apo(a)
with liver cells. Arterioscler Thromb. 1993;13:1101-1109.
14.
Snyder ML, Hay RV, Whitington PF, Scanu AM, Fless
GM. Binding and degradation of lipoprotein(a) and LDL by primary
cultures of human hepatocytes.
Arterioscler Thromb. 1994;14:770-779.
15. Miles LA, Fless GM, Levin EG, Scanu AM, Plow EF. A potential basis for the thrombotic risks associated with lipoprotein(a). Nature. 1989;339:301-303. [Medline] [Order article via Infotrieve]
16.
Snyder ML, Polacek D, Scanu AM, Fless GM.
Comparative binding and degradation of lipoprotein(a) and low density
lipoprotein by human monocyte derived macrophages.
J Biol Chem. 1992;267:339-346.
17. Haberland ME, Fless G, Scanu AM, Fogelman AM. Malondialdehyde modification of lipoprotein(a) produces avid uptake by human monocyte-macrophages. J Biol Chem. 1992;2670:4143-4151.
18. Miles LA, Fless GM, Scanu AM, Baynham P, Sebald MT, Skocir P, Curtiss LK, Levin EG, Hoover-Plow JL, Plow EF. Interaction of Lp(a) with plasminogen binding sites on cells. Thromb Haemost. 1995;73:458-465. [Medline] [Order article via Infotrieve]
19. Hajjar KA, Gavish D, Breslow JL, Nachman RL. Lipoprotein(a) modulation of endothelial cell surface fibrinolysis and its potential role in atherosclerosis. Nature. 1989;339:303-305. [Medline] [Order article via Infotrieve]
20.
Tabas I, Li Y, Brocia RW, Xu SW, Swenson TL, Williams
KJ. Lipoprotein lipase and sphingomyelinase synergistically
enhance the association of atherogenic lipoproteins with smooth muscle
cells and extracellular matrix. J Biol
Chem. 1993;268:20419-20432.
21. Miles LA, Sebald MT, Fless GM, Scanu AM, Hoover-Plow JL, Plow EF. Interaction of lipoprotein(a) [Lp(a)] with the extracellular matrix. Blood. 1993;82:1785a. Abstract.
22.
Van der Hoek YY, Sangrar W, Côté GP,
Kastelein JJP, Koschinsky ML. Binding of recombinant
apolipoprotein(a) to extracellular matrix proteins.
Arterioscler Thromb. 1994;14:1792-1798.
23. Salonen E-M, Jauhiainen M, Zardi L, Vaheri A, Ehnholm C. Lipoprotein(a) binds to fibronectin and has serine proteinase activity capable of cleaving it. EMBO J. 1989;8:4035-4040. [Medline] [Order article via Infotrieve]
24. Edelberg JM, Gonzalez-Gronow M, Pizzo SV. Lipoprotein a inhibits streptokinase-mediated activation of human plasminogen. Biochemistry. 1989;28:2370-2374. [Medline] [Order article via Infotrieve]
25. Kluft C, Jie AF, Los P, de Wit E, Havekes L. Functional analogy between lipoprotein(a) and plasminogen in the binding to the kringle 4 binding protein, tetranectin. Biochem Biophys Res Commun. 1989;161:427-433. [Medline] [Order article via Infotrieve]
26.
Loscalzo J, Weinfeld M, Fless GM, Scanu AM.
Lipoprotein(a), fibrin binding, and plasminogen
activation. Arteriosclerosis. 1990;10:240-245.
27.
Wu TP, Padmanabhan K, Tulinsky A, Mulichak AM.
The refined structure of the
-aminocaproic acid complex of human
plasminogen kringle 4. Biochemistry. 1991;30:10589-10594. [Medline]
[Order article via Infotrieve]
28.
LoGrasso PV, Cornell-Kennon S, Boettcher BR.
Cloning, expression, and characterization of human apolipoprotein(a)
kringle IV37. J Biol Chem. 1994;269:21820-21827.
29. Scanu AM, Miles LA, Pfaffinger D, Fless GM, Jackson E, Hoover-Plow JL, Brunck T, Plow EF. Rhesus monkey Lp(a) binds to lysine-Sepharose and U937 monocytoid cells less efficiently than human Lp(a): evidence for a dominant role of kringle 437. J Clin Invest. 1993;91:283-291.
30.
Scanu AM, Pfaffinger D, Lee JC, Hinman J. A
single point mutation (Trp72
Arg) in human apo(a) kringle 4-37
associated with a lysine binding defect in Lp(a). Biochim
Biophys Acta. 1994;1227:41-45. [Medline]
[Order article via Infotrieve]
31. Guevara J Jr, Knapp RD, Honda S, Northrup SR, Morrisett JD. A structural assessment of the apo[a] protein of human lipoprotein[a]. Proteins: Struct Funct Gen. 1992;12:188-199.
32. Scanu AM, Edelstein C. Kringle-dependent structural and functional polymorphism of apolipoprotein(a). Biochim Biophys Acta. 1995;1256:1-12. [Medline] [Order article via Infotrieve]
33. Howard GC, Pizzo SV. Biology of disease: lipoprotein(a) and its role in atherothrombotic disease. Lab Invest. 1993;69:373-386. [Medline] [Order article via Infotrieve]
34. Miles LA, Plow EF. Lp(a): an interloper into the fibrinolytic system? Thromb Haemost. 1990;63:331-335. [Medline] [Order article via Infotrieve]
35. Armstrong VW, Harrach B, Robenek H, Helmhold M, Walli AK, Seidel D. Heterogeneity of human lipoprotein Lp[a]: cytochemical and biochemical studies on the interaction of two Lp[a] species with the LDL receptor. J Lipid Res. 1990;31:429-441. [Abstract]
36. Karmansky I, Shnaider H, Palant A, Gruener N. Lysine-binding species of lipoprotein(a) in coronary artery disease. Eur J Clin Invest. 1994;24:360-366. [Medline] [Order article via Infotrieve]
37. Scanu AM. Identification of mutations in human apolipoprotein(a) kringle 4-37 from the study of the DNA of peripheral blood lymphocytes: relevance to the role of lipoprotein(a) in atherothrombosis. Am J Cardiol. 1995;75:58B-61B. [Medline] [Order article via Infotrieve]
38. Kraft HG, Haibach C, Lingenhel A, Brunner C, Trommsdorff M, Kronenberg F, Muller HJ, Utermann G. Sequence polymorphism in kringle IV 37 in linkage disequilibrium with the apolipoprotein(a) size polymorphism. Hum Genet. 1995;95:275-282. [Medline] [Order article via Infotrieve]
39. Koschinsky ML, Tomlinson JE, Zioncheck TF, Schwartz K, Eaton DL, Lawn RM. Apolipoprotein(a): expression and characterization of a recombinant form of the protein in mammalian cells. Biochemistry. 1991;30:5044-5051. [Medline] [Order article via Infotrieve]
40. Mulichak AM, Tulinsky A, Ravichandran KG. Crystal and molecular structure of human plasminogen kringle 4 refined at 1.9-Å resolution. Biochemistry. 1991;30:10576-10588. [Medline] [Order article via Infotrieve]
41.
Graham FL, Smiley J, Russell WC, Nairn R.
Characteristics of a human cell line transformed by DNA from human
adenovirus type 5. J Gen Virol. 1977;36:59-74.
42.
Plow EF, Collen D. Immunochemical
characterization of a low affinity lysine binding site within
plasminogen. J Biol Chem. 1981;256:10864-10869.
43. Miles LA, Plow EF. Topography of the high-affinity lysine binding site of plasminogen as defined with a specific antibody probe. Biochemistry. 1986;25:6926-6933. [Medline] [Order article via Infotrieve]
44. Fless GM, Snyder ML, Scanu AM. Enzyme-linked immunoassay for Lp(a). J Lipid Res. 1989;30:651-662. [Abstract]
45. Silberman SR, Armentrout MA, Vella FA, Saha AL. Macra(TM) Lp(a) for quantitation of human lipoprotein(a) by enzyme linked immunoassay. Clin Chem. 1990;36:961.
46. Taddei-Peters WC, Butman BT, Jones GR, Venetta TM, Macomber PF, Ransom H. Quantification of lipoprotein(a) particles containing various apolipoprotein(a) isoforms by a monoclonal anti-apo(a) capture antibody and a polyclonal anti-apolipoprotein B detection antibody sandwich enzyme immunoassay. Clin Chem. 1993;39:1382-1389. [Abstract]
47. Hoover-Plow JL, Miles LA, Fless GM, Scanu AM, Plow EF. Comparison of the lysine binding functions of lipoprotein(a) and plasminogen. Biochemistry. 1993;32:13681-13687. [Medline] [Order article via Infotrieve]
48.
McCance SG, Menhart N, Castellino FJ. Amino acid
residues of the kringle-4 and kringle-5 domains of human
plasminogen that stabilize their interactions with
omega-amino acid ligands. J Biol Chem. 1994;269:32405-32410.
49. Phillips ML, Lembertas AV, Schumaker VN, Lawn RM, Shire SJ, Zioncheck TF. Physical properties of recombinant apolipoprotein(a) and its association with LDL to form an Lp(a)-like complex. Biochemistry. 1993;32:3722-3728. [Medline] [Order article via Infotrieve]
50. Huby T, Doucet C, Dieplinger H, Chapman J, Thillet J. Structural domains of apolipoprotein(a) and its interaction with apolipoprotein B-100 in the lipoprotein(a) particle. Biochemistry. 1994;33:3335-3341. [Medline] [Order article via Infotrieve]
51. Fless GM, Snyder ML, Furbee JW Jr, Garcia-Hedo M-T, Mora R. Subunit composition of lipoprotein(a) protein. Biochemistry. 1994;33:13492-13501. [Medline] [Order article via Infotrieve]
52.
Koschinsky ML, Côté GP, Gabel B, Van der
Hoek YY. Identification of the cysteine residue in
apolipoprotein(a) that mediates extracellular coupling with
apolipoprotein B-100. J Biol Chem. 1993;268:19819-19825.
53.
Ernst A, Helmhold M, Brunner C, Petho-Schramm A,
Armstrong VW, Müller HJ. Identification of two
functionally distinct lysine-binding sites in kringle 37 and in
kringles 32-36 of human apolipoprotein(a). J
Biol Chem. 1995;270:6227-6234.
54. Leerink CB, Duif PF, Gimpel JA, Kortlandt W, Bouma BN, van Rijn HJM. Lysine-binding heterogeneity of Lp(a): consequences for fibrin binding and inhibition of plasminogen activation. Thromb Haemost. 1992;68:185-188. [Medline] [Order article via Infotrieve]
55. Sattler W, Kostner GM, Waeg G, Esterbauer H. Oxidation of lipoprotein Lp(a): a comparison with low-density lipoproteins. Biochim Biophys Acta. 1991;1081:65-74. [Medline] [Order article via Infotrieve]
56.
Harpel PC, Chang VT, Borth W. Homocysteine and
other sulfhydryl compounds enhance the binding of lipoprotein(a) to
fibrin: a potential biochemical link between thrombosis, atherogenesis,
and sulfhydryl compound metabolism. Proc Natl
Acad Sci U S A. 1992;89:10193-10197.
57. Dousset N, Dousset JC, Taus M, Ferretti G, Curatola G, Solera ML, Valdiguie P. Effect of desialylation on low density lipoproteins: comparative study before and after oxidative stress. Biochem Mol Biol Int. 1994;32:555-563. [Medline] [Order article via Infotrieve]
58. Natarajan MK, Fong BS, Angel A. Enhanced binding of phospholipase-A2-modified low density lipoprotein by human adipocytes. Biochem Cell Biol. 1990;68:1243-1249. [Medline] [Order article via Infotrieve]
59. Cohen JC, Chiesa G, Hobbs HH. Sequence polymorphisms in the apolipoprotein(a) gene: evidence for dissociation between apolipoprotein(a) size and plasma lipoprotein(a) levels. J Clin Invest. 1993;91:1630-1636.
60.
Schreiner PJ, Morrisett JD, Sharrett AR, Patsch W,
Tyroler HA, Wu K, Heiss G. Lipoprotein(a) as a risk factor for
preclinical atherosclerosis. Arterioscler
Thromb Vasc Biol. 1995;13:826-833.
61.
Desmarais RL, Sarembock IJ, Ayers CR, Vernon SM, Powers
ER, Gimple LW. Elevated serum lipoprotein(a) is a risk factor
for clinical recurrence after coronary balloon
angioplasty. Circulation. 1995;91:1403-1409.
62.
Terres W, Tatsis E, Pfalzer B, Beil FU, Beisiegel U,
Hamm CW. Rapid angiographic progression of coronary
artery disease in patients with elevated lipoprotein(a).
Circulation. 1995;91:948-950.
63.
Bostom AG, Gagnon DR, Cupples LA, Wilson PW, Jenner JL,
Ordovas JM, Schaefer EJ, Castelli WP. A prospective
investigation of elevated lipoprotein(a) detected by electrophoresis
and cardiovascular disease in women: the Framingham
Heart Study. Circulation. 1994;90:1688-1695.
64.
Lackner C, Cohen JC, Hobbs HH. Molecular
definition of the extreme size polymorphism in
apolipoprotein(a). Hum Mol Genet. 1993;2:933-940.
65. Geroldi D, Bellotti V, Buscaglia P, Bonetti G, Gazzaruso C, Caprioli A, Fratino P. Characterization of apo(a) polymorphism by a modified immunoblotting technique in an Italian population sample. Clin Chim Acta. 1993;221:159-169. [Medline] [Order article via Infotrieve]
66.
Marcovina SM, Albers JJ, Gabel B, Koschinsky ML, Gaur
VP. Effect of the number of apolipoprotein(a) kringle 4 domains
on immunochemical measurements of lipoprotein(a). Clin
Chem. 1995;41:246-255.
67. Trieu VN, McConathy WJ. The binding of animal low-density lipoproteins to human apolipoprotein(a). Biochem J. 1995;309:899-904.
68. Frank S, Krasznai K, Durovic S, Lobentanz EM, Dieplinger H, Wagner E, Zatloukal K, Cotten M, Utermann G, Kostner GM, Zechner R. High-level expression of various apolipoprotein(a) isoforms by `transferrinfection': the role of kringle IV sequences in the extracellular association with low-density lipoprotein. Biochemistry. 1994;33:12329-12339. [Medline] [Order article via Infotrieve]
69. Edelstein C, Mandala M, Pfaffinger D, Scanu AM. Determinants of lipoprotein(a) assembly: a study of wild-type and mutant apolipoprotein(a) phenotypes isolated from human and rhesus monkey lipoprotein(a) under mild reductive conditions. Biochemistry. 1995;34:16483-16492. [Medline] [Order article via Infotrieve]
70. Lawn RM, Wade DP, Hammer RE, Chiesa G, Verstuyft JG, Rubin EM. Atherogenesis in transgenic mice expressing human apolipoprotein(a). Nature. 1992;360:670-672.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
T. Huby, V. Afzal, C. Doucet, R. M. Lawn, E. L. Gong, M. J. Chapman, J. Thillet, and E. M. Rubin Regulation of the Expression of the Apolipoprotein(a) Gene: Evidence for a Regulatory Role of the 5' Distal Apolipoprotein(a) Transcription Control Region Enhancer in Yeast Artificial Chromosome Transgenic Mice Arterioscler. Thromb. Vasc. Biol., September 1, 2003; 23(9): 1633 - 1639. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ogorelkova, H. G. Kraft, C. Ehnholm, and G. Utermann Single nucleotide polymorphisms in exons of the apo(a) kringles IV types 6 to 10 domain affect Lp(a) plasma concentrations and have different patterns in Africans and Caucasians Hum. Mol. Genet., April 1, 2001; 10(8): 815 - 824. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Lawn, K. Schwartz, and L. Patthy Convergent evolution of apolipoprotein(a) in primates and hedgehog PNAS, October 28, 1997; 94(22): 11992 - 11997. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |