Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1996;16:656-664

This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoover-Plow, J. L.
Right arrow Articles by Plow, E. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoover-Plow, J. L.
Right arrow Articles by Plow, E. F.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1996;16:656-664.)
© 1996 American Heart Association, Inc.


Articles

A Quantitative Immunoassay for the Lysine-Binding Function of Lipoprotein(a)

Application to Recombinant Apo(a) and Lipoprotein(a) in Plasma

Jane L. Hoover-Plow; Nataya Boonmark; Pamela Skocir; Richard Lawn; Edward F. Plow

From the Joseph J. Jacobs Center for Thrombosis and Vascular Biology, Cleveland Clinic Foundation, Cleveland, Ohio, and the Department of Cardiovascular Medicine (N.B., R.L.), Stanford University, Stanford, Calif.

Correspondence to Jane Hoover-Plow, Department of Molecular Cardiology, Joseph J. Jacobs Center for Thrombosis and Vascular Biology/FF20, Cleveland Clinic Foundation, 9500 Euclid Ave, Cleveland, OH 44195.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Apo(a), the unique apoprotein of lipoprotein(a) (Lp[a]), can express lysine-binding site(s) (LBS). However, the LBS activity of Lp(a) is variable, and this heterogeneity may influence its pathogenetic properties. An LBS-Lp(a) immunoassay has been developed to quantitatively assess the LBS function of Lp(a). Lp(a) within a sample is captured with an immobilized monoclonal antibody specific for apo(a), and the captured Lp(a) is reacted with an antibody specific for functional LBS. The binding of this LBS-specific antibody is then quantified by using an alkaline phosphatase–conjugated disclosing antibody. The critical LBS-specific antibody was raised to kringle 4 of plasminogen. When applied to plasma samples, the LBS activity of Lp(a) ranged from 0% to 100% of an isolated reference Lp(a); the signal corresponded to the percent retention of Lp(a) on a lysine-Sepharose column but did not correlate well with total Lp(a) levels in plasma. Mutation of residues in the putative LBS in the carboxy-terminal kringle 4 repeat (K4-37) in an eight-kringle apo(a) construct resulted in marked but not complete loss of activity in the LBS-Lp(a) immunoassay. These data suggest that this kringle is the major but not the sole source of LBS activity in apo(a). The LBS-Lp(a) immunoassay should prove to be a useful tool in establishing the role of the LBS in the pathogenicity of Lp(a).


Key Words: lipoprotein(a) • lysine-binding site • recombinant apo(a) • functional immunoassay


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Lp(a) is similar to LDL with respect to lipid composition and the presence of an apoB moiety.1 2 Distinguishing Lp(a) from LDL is the presence of apo(a) within Lp(a). The primary structure of apo(a) strongly resembles plasminogen.3 Plasminogen contains five kringle domains, each composed of 80 to 90 amino acids organized into a triple-looped structure by three internal disulfide bonds.4 The homology of the kringles of apo(a) with plasminogen, especially K4 and K5, is extremely high. Human apo(a) contains multiple and variable numbers of plasminogen K4-like kringles and one copy of K5.5

The kringles of plasminogen, including K4 and K5, function as LBS. The LBS of plasminogen recognize lysines, primarily carboxy-terminal lysines.6 7 This activity is responsible for the binding of plasminogen to lysine-Sepharose and, more importantly, for the interaction of plasminogen and plasmin with substrates,8 9 inhibitors,10 and cellular receptors.11 12 Lp(a) also binds to lysine-Sepharose,3 several cell types, including hepatocytes,13 14 monocytes,15 16 17 and endothelial cells,18 19 and extracellular matrices20 21 and matrix proteins.22 23 These interactions can be inhibited, at least in part, by lysine and lysine analogues.18 19 21 In addition, Lp(a) can also interfere with certain functions of plasminogen that are mediated by the LBS.15 19 24 25 26 These data indicate that one or more of the kringles of apo(a) has LBS activity. On the basis of the crystal structure of K4 of plasminogen,27 the LBS is composed of a trough lined by three aromatic residues, flanked on one end by two anionic (Asp, Asp) residues and at the other end by two cationic (Lys, Arg) residues. The sequence of apo(a) shows that its final kringle 4 repeat, K4-37 (nomenclature of McLean et al5 ), has the appropriate residues to form an LBS. This prediction has been experimentally supported by using mutated recombinant K4-3728 and by showing that naturally occurring apo(a) with a single amino acid substitution in K4-37 lacks LBS function.29 30 On the basis of their amino acid sequences, other apo(a) kringles are predicted to be lower-affinity LBS, to be nonfunctional, or to have a relaxed specificity.31 32

The pathogenicity of Lp(a) as a risk factor for cardiovascular disease may depend on its LBS,26 33 34 which imparts unique functions to Lp(a) not shared with LDL, including a potential to interfere with fibrinolysis. However, the LBS function of Lp(a) varies within the population.30 35 36 This variability is due at least in part to amino acid polymorphisms in K4-37,37 38 but other heterogeneities in Lp(a) structure,1 such as the lipid and carbohydrate composition or the overall organization of the particle, may also influence LBS function.

The current approach to measure the LBS function of Lp(a) is to use lysine-Sepharose chromatography.30 35 36 This approach is cumbersome, requires relatively large samples, and does not discriminate graded variations in LBS activity. Accordingly, the purpose of the present study was to develop a less cumbersome and more accurate assay to quantify the LBS function of Lp(a). An immunoassay that can assess the LBS function of Lp(a) in a small amount of plasma has been developed that can quantify the effects of enzymatic, chemical, and mutational modifications of Lp(a) on LBS. Ultimately, this assay will permit an examination of the relationship of size, concentration, and LBS activity of Lp(a) in plasma samples from patients with atherosclerotic cardiovascular disease.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
Reference Lp(a), LDL, and Glu-plasminogen are routinely isolated from donor plasma.11 16 Plasma samples containing Lp(a) with amino acid substitutions within K4-3730 were kindly provided by Dr Angelo Scanu, University of Chicago, Chicago, Ill. Monoclonal antibodies against LDL apoB-100 were generous gifts from Dr Linda Curtiss, Department of Immunology, Scripps Research Institute, La Jolla, Calif, and apo(a) monoclonal antibodies, a generous gift of Dr Gunther Fless, Department of Medicine, University of Chicago. Lp(a) polyclonal antibodies from sheep were purchased from Immuno AG, and the MACRA Lp(a) kit was from Strategic Diagnostics; tissue-type plasminogen activator (Activase) was from Genentech; high-molecular-weight urokinase, crystalline BSA, and DL-lysine were from Calbiochem; EACA and gelatin (type B from bovine skin endotoxin) were from Sigma Chemical Co; aprotinin was from FBA Pharmaceuticals; and Tween 20 was from Fisher. All chemicals were of reagent grade.

Construction of Apo(a) cDNA Expression Plasmid
The expression plasmid pCMha8, containing eight K4-like domains as well as the K5-like and protease-like domains, was constructed from the apo(a) cDNA expression plasmid pRK5ha17, which has been described by Koschinsky et al.39 Briefly, plasmid pRK5ha17 was partially digested with HindIII, which cleaves in 12 positions (1113, 1455, 1797, 2139, 2823, 3165, 3507, 3849, 4191, 4533, and 4875) in the apo(a) cDNA sequence and position 7890 in the 3' untranslated region.5 The resulting fragments, which eliminated most repeated kringles but retained the K4-32–' untranslated region, were isolated and relegated. After transformation, a clone that eliminated nine repeated kringles was isolated. The resulting construct, which encoded the 5' untranslated region, the signal sequence, the first two K4-like repeats, and a fusion kringle containing 149 bp of the third K4-like domain and 341 bp of K4-32, followed by the K4-33–K4-37, K5-like, and protease-like domain and 67 bp of the 3' untranslated sequence, was confirmed by DNA sequencing.

Site Direct Mutagenesis
Substitution mutants were prepared by using a unique site-elimination mutagenesis kit (Pharmacia Biotech Inc) according to the manufacturer's suggestions. Briefly, 5'GAATCCAGCGGCCCCTTGG3', a complementary oligonucleotide (Lysmuta) consisting of 3-bp mutant sequences that changed amino acid Asp at positions 55 and 57 in K4-37 of the r-apo(a) to Ala and Ala, was synthesized to eliminate the two negatively charged residues of the lysine-binding pocket.40 The mutation sequences also introduced a unique Not I recognition site. This primer was annealed to heat-denatured plasmid pCMha8 together with a second oligonucleotide (Xhomuta), 5'GGTTCTATCCATTGAATTCTAGATCTCGTCGACCCTG3', which eliminates a unique Xho I site from the vector backbone. The annealed primers were extended and ligated with T4 polymerase and T4 ligase. After digestion with Xho I to linearize wild-type plasmids, the mixture was used to transform repair-deficient Escherichia coli strain BMH71-18MutS. Plasmid DNA prepared from a culture of the transformed cells was subjected to a second round of Xho I digestion and transformation to become further enriched with mutated plasmids. Mutants were identified by Not I digestion and confirmed by DNA sequencing. The resulting plasmid was designated pCMha8Lysmuta.

Cell Culture and Transfection
The 293 cells (human embryonic kidney41 ) were cultured in 60-mm dishes with Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Transfection experiments were performed by using lipofectin (Life Technologies, Inc). Plasmids pCMha8 and pCMha8Lysmuta were purified by using ion-exchange columns (Qiagen Inc). The 293 cells were seeded at 0.75x106 cells per 60-mm dish, and transfection was performed when the cells attained 40% to 60% confluence. For each dish, 10 µg of either plasmid DNA was mixed with 1.5 mL Opti-MEM medium (GIBCO/BRL) in a polystyrene tube, and 1.5 mL Opti-MEM containing 70 µg lipofectin (GIBCO/BRL) was added. The lipofectin/DNA complexes were allowed to form for 15 minutes at room temperature and added to the dishes after washing the monolayers twice with Puck's saline A (GIBCO/BRL). After 5 hours, the medium was replaced by 5 mL Opti-MEM, and incubation was continued for 24 hours. The medium was harvested, adjusted to 1 mmol/L phenylmethylsulfonyl fluoride, centrifuged for 10 minutes at 4000g to remove cell debris, and concentrated from 50 to 1 mL by using Centriprep 100 concentrator (Amicon Inc). The concentrated medium was analyzed by using reducing sodium dodecyl sulfate–polyacrylamide gel electrophoresis and subsequent immunoblotting. The concentrated medium containing the r-apo(a) was added directly to the LBS-Lp(a) assay. The concentrations of r-apo(a) were determined by using the MACRA Lp(a) assay kit.

LBS-Lp(a) Assay
To identify an antibody specific for LBS, 96-well microtiter plates were coated with 20 µg/mL Lp(a) or plasminogen in PBS (150 mmol/L NaCl and 10 mmol/L phosphate buffer, pH 7.4) and incubated overnight at 4°C. Plates were washed four times with buffer I (PBS, 1 g/L BSA, 0.2 g/L sodium azide, 0.5 g/L Tween 20, and 10 U/L aprotinin) and coated with 30 g/L gelatin in PBS at 200 µL/well for 60 minutes at 23°C. Plates were incubated at 37°C to melt the gelatin, which was removed by aspiration. A 100-µL aliquot of a candidate antibody was added to wells at increasing dilutions in the presence or absence of 200 mmol/L EACA and incubated for 2 hours at 37°C. Plates were washed four times with 200 µL per well of buffer I. To each well was added 100 µL alkaline phosphatase–conjugated secondary antibody (raised against mouse or rabbit IgG) that was diluted in 100 mmol/L Tris, 100 mmol/L NaCl, 5 mmol/L MgCl2, and 0.5 g/L Tween 20, pH 7.5, and incubated for 1 hour at 37°C. Plates were washed four times with 200 µL buffer I, and 100 µL p–nitrophenyl phosphate at 1 mg/mL in buffer (in mmol/L: Tris-HCl 100, NaCl 100, and MgCl2 5, pH 9.5) was added to each well. The reaction was stopped with 1 mmol/L NaOH after 10 minutes at room temperature, and the absorbance of individual wells was read at 405 nm by using a spectrophotometer.

The antibody ultimately identified as detecting the LBS of Lp(a) was raised in rabbits against the K4 of plasminogen.42 The anti-K4 antibodies were immunopurified by applying the initial antiserum to a plasminogen-Sepharose column (4 mg plasminogen/mL) and eluting the desired antibody with 200 mmol/L EACA.43 The immunopurified antibody was then used in the assays at 0.06 to 0.6 mg/L.

To identify the Lp(a) capture antibody, candidate antibodies were absorbed onto microtiter wells overnight at 4°C. The wells were washed four times with buffer I and coated with 30 g/L gelatin as described above. Various dilutions of reference Lp(a), negative and positive Lp(a) serum diluted in PBS, purified kringle-containing proteins diluted in PBS with 3 g/L BSA, and medium containing r-apo(a) were added to the antibody-coated wells and incubated for 1 hour at 37°C. The wells were then washed four times with buffer I, and the LBS antibody identified above was added at the selected dilution in 100 µL. After 2 hours at 37°C the plates were washed four times with buffer I, and the secondary disclosing antibody was added as described above.

Quantification of Plasma Lp(a)
The concentration of Lp(a) in plasma samples was determined by using an established method44 45 or a commercial assay [MACRA Lp(a) kit] using the kit standards and the isolated reference Lp(a) standard. Both assays are specific for Lp(a) in the presence of plasminogen, high triglyceride levels or high cholesterol, and Lp(a) quantification is not affected by apo(a) size.44 46 The specificity of the apo(a) antibodies used in these assays has been described.44 45


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Antisera Selection and Assay Development
The initial objective of these studies was to develop an immunoassay to measure the LBS activity of Lp(a). The critical reagent for such an assay is an antibody that reports on the functional status of the LBS. To identify the appropriate reagent, the capacity of EACA, a lysine analogue that interacts with LBS with high affinity, to interfere with the binding of candidate antibodies to immobilized Lp(a) was examined. A total of 10 antibodies, including both polyclonal antisera and monoclonal antibodies, were screened for LBS specificity. Of the five antibodies to apo(a)/Lp(a) tested, all reacted with Lp(a) (Table 1Down). Of these, the binding of one Lp(a) antibody was affected by EACA, but even this reagent exhibited a substantial reaction with Lp(a) in the presence of the lysine analogue. The two apoB monoclonal antibodies tested both reacted with immobilized Lp(a), but their binding was minimally influenced by EACA. The two antisera to the kringle regions of plasminogen did cross-react with Lp(a). The antiserum to the K1-3 (the elastase degradation product I) region of plasminogen showed a strong cross-reaction with Lp(a), but this interaction was not inhibited by EACA. In contrast, an antiserum raised to the K4 region of plasminogen, the elastase degradation product II, not only reacted well with Lp(a), but its binding was substantially reduced in the presence of EACA (Table 1Down); the reactivity of this antiserum with plasminogen in an EACA-sensitive interaction is consistent with a previous study.42 Table 1Down also shows the result obtained when anti-K4 was immunopurified. For this purpose, the antiserum was passed over a plasminogen-Sepharose column, and a subpopulation of bound antibody was eluted with EACA. The EACA sensitivity of the immunopurified antibody was accentuated, and its reactivity with Lp(a) was fully blocked by EACA. This immunopurified anti-K4 was employed in subsequent studies.


View this table:
[in this window]
[in a new window]
 
Table 1. Analysis of LBS Activity of Antisera

The reactivity of the immunopurified anti-K4 with the LBS of Lp(a) was evaluated further. The binding of varying concentrations of this antibody to immobilized Lp(a) and plasminogen in the presence or absence of EACA is shown in Fig 1Down. In the absence of EACA, the antibody reacted in a dose-dependent manner with both immobilized Lp(a) and plasminogen. EACA effectively blocked the binding of all antibody concentrations to both target antigens.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Line graph shows interaction of anti-K4 with Lp(a) and plasminogen (PLG). Varying concentrations of the immunopurified antibody (see "Methods") were reacted with Lp(a) or plasminogen in the absence or presence of 200 mmol/L EACA. The Lp(a) and plasminogen were immobilized on microtiter plates at 2 and 22 pmol/well, respectively (2 µg/well). Binding was detected with an alkaline phosphatase–conjugated second antibody.

While the above data indicate that anti-K4 reacts only with unoccupied LBS, this antiserum does not discriminate between the LBS of Lp(a) from plasminogen or other potential LBS-containing proteins. To establish specificity for the LBS of Lp(a), monoclonal antibodies to apo(a) were used to selectively capture Lp(a). For this purpose, the anti-apo(a)-coated microtiter plates provided in commercially available assay kits (MACRA, Strategic Diagnostics, Apo-Tek, PerImmune) for quantifying Lp(a) were employed. The plates from two different suppliers gave similar results. Both capture antibodies from these two kits have been characterized45 46 and are reported not to bind to plasminogen, LDL, VLDL, or HDL. In addition, neither triglycerides, hemoglobin, nor bilirubin interfere with the Lp(a) quantification in these assays. The capture antibody is reported to be insensitive to size polymorphism. Lp(a) or other kringle-containing proteins were added to these plates followed by anti-K4 and then the disclosing reagents. In this configuration, Lp(a) (6.7 mg/L protein) gave a positive signal (absorbance=1.1), but plasminogen, at its plasma concentrations of 200 mg/L (30 000-fold above the test Lp[a] concentration), reacted poorly (absorbance<0.2). Other kringle-containing proteins at their approximate plasma concentrations, urokinase (100 ng/L) and tissue-type plasminogen activator (100 ng/L), also gave minimal signals (absorbance<0.2). Furthermore, the LBS activity of the isolated Lp(a) was not altered when assayed in the presence of various plasma proteins (Table 2Down). The absorbance for the LBS activity of the Lp(a) plus the other proteins was 97% to 108% of the reference Lp(a) alone.


View this table:
[in this window]
[in a new window]
 
Table 2. Plasma Proteins Added to Reference Lp(a)

Further evidence for the appropriate specificity of the assay with anti-apo(a) as a capturing reagent and anti-K4 as an LBS reporter is provided in the analysis shown in Fig 2Down. When a constant concentration of isolated Lp(a) was added to various dilutions of an Lp(a)-negative plasma, the same signal was obtained at all plasma dilutions. A number of plasma samples, including hyperlipidemic plasma, have been tested in a similar manner (Table 3Down). The LBS activity of isolated Lp(a) (20 µg/mL) added in varying dilutions to either normolipidemic or hyperlipidemic plasma was similar (coefficient of variation=8%). Thus, the naturally occurring plasma proteins with kringles, including plasminogen, did not interfere with the assay. EACA blocked binding at all dilutions, indicating that the LBS of the captured Lp(a) must be unoccupied for reaction with the anti-K4. In addition, these data also demonstrate the feasibility of measuring the LBS status of Lp(a) within plasma samples.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Bar graph shows immunoassay of the LBS activity of Lp(a) in human plasma. A purified Lp(a) (fully retained on lysine-Sepharose columns) was added to various dilutions of Lp(a)-negative plasma; the sample was added to microtiter wells coated with anti-apo(a). After 1 hour, anti-K4 was added to the wells at 0.6 mg/L with ({square}) or without ({blacksquare}) 200 mmol/L EACA. The colorimetric reaction was developed after an additional 2 hours.


View this table:
[in this window]
[in a new window]
 
Table 3. Variation of LBS Activity of Reference Lp(a) in the Presence of Plasma Dilutions

The final configuration and format of the LBS-Lp(a) immunoassay used to quantify the LBS function of Lp(a) are summarized in Fig 3Down. Step 1 entails a 1-hour incubation of the Lp(a)-containing sample, such as plasma, in microtiter wells coated with anti-apo(a) as a capturing antibody. Step 2 involves a 2-hour incubation with the immunopurified anti-K4. In step 3 the disclosing antibody is added, and after 1 hour the colorimetric reaction is developed by the addition of substrate.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Top, Format for the LBS-Lp(a) immunoassay. Step 1: Lp(a) is captured with an immobilized monoclonal antibody specific for apo(a); step 2: immunopurified K4 antibody is added to the captured Lp(a); step 3: binding of the antibody is quantified with an alkaline phosphatase disclosing antibody (anti-rabbit IgG). Bottom, Line graph shows dose response of the reference standard Lp(a) in the LBS-Lp(a) immunoassay. The Lp(a) was a single isoform of Mr=0.96x106 that was introduced into the assay at 1-21 nmol/L (1-20 mg/L).

By using this configuration, varying concentrations of a single-isoform Lp(a) were added to the assay. This particular Lp(a) is completely retained on lysine-Sepharose columns.1 47 A dose-response curve was obtained with evidence of saturation at Lp(a) concentrations >5 mg/L (Fig 3Up, bottom). In subsequent experiments, this Lp(a) was used as a reference standard. The LBS activity within unknown samples was quantified relative to this reference Lp(a) as: percent reference Lp(a)=[absorbance of unknown (5 mg/L)x100]÷absorbance reference standard (5 mg/L). The dilution of the test sample required to obtain 5 mg/L Lp(a) was determined by using the MACRA Lp(a) assay kit. Specific applications of the LBS-Lp(a) immunoassay using this protocol are described below.

LBS Activity of Purified Lp(a)
Two Lp(a) preparations from different donors were introduced into the LBS-Lp(a) immunoassay at 5 µg/mL in the presence of varying concentrations of lysine and EACA (Fig 4Down). The two lysine analogues produced similar dose-dependent inhibition of antibody binding to the two Lp(a) isoforms (Fig 4Down). The average IC50 values for the two donors were 0.5 and 3.7 mmol/L for EACA and lysine, respectively. These values are in excellent agreement with those obtained for these compounds in an earlier lysine-bead assay47 (1.3 and 3.8 mmol/L for EACA and lysine, respectively). Thus, the LBS-Lp(a) immunoassay appears to accurately report on the relative affinity of the LBS for lysine analogs.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Line graphs show effect of lysine analogues on the LBS-Lp(a) immunoassay. Lp(a) preparations from two different donors were introduced into the LBS-Lp(a) in the presence of varying concentrations of lysine (LYS) or EACA. Each Lp(a) preparation is a different single isoform: A, Mr=1.04x106; B, Mr=1.13x106.

LBS Function of Lp(a) in Plasma
The LBS-Lp(a) immunoassay was used to assess plasma samples containing Lp(a) with established defects in LBS activity, ie, the Lp(a) isolated from these plasma samples showed minimal retention on lysine-Sepharose columns. The three samples used, kindly provided by Dr Angelo Scanu, included two plasma samples with Lp(a) particles having the Trp->Arg substitution at position 72 of K4-37, a substitution known to markedly diminish the LBS function of Lp(a).29 30 The LBS activity of these plasma samples was quantified relative to the reference Lp(a) as described above (Table 4Down). The two patients with the Trp->Arg substitution showed extremely low activity in the LBS-Lp(a) immunoassay [0% and 5.7% of the reference standard Lp(a)]. Rhesus monkey Lp(a), which also has the Trp->Arg mutation at K4-37, has low binding to lysine-Sepharose columns30 and lysine-bead assays47 and low LBS activity (13%) as well. Another plasma sample known to have low reactivity with lysine-Sepharose (8%) but lacking the Trp->Arg mutation also exhibited low LBS-Lp(a) activity (6.7%). As discussed by Scanu et al,30 the sample with low LBS activity but lacking the Trp->Arg mutation may have another mutation of one or more amino acids critical for LBS activity.48 In a wild-type plasma sample prepared in identical fashion, another patient yielded an LBS-Lp(a) activity of 98.6%, indicating that other Lp(a) particles in plasma could approach the functional activity of the reference Lp(a) standard.


View this table:
[in this window]
[in a new window]
 
Table 4. LBS Activity of Plasma Samples in the LBS-Lp(a) Immunoassay

Next, the relationship between LBS activity and total Lp(a) levels was assessed in a panel of 29 plasma samples (Fig 5Down). LBS-Lp(a) activities extended from undetectable levels (0%) to levels similar to and slightly exceeding the reference standard (defined as 100%). The relationship between LBS activity and the Lp(a) concentration in this group of samples was not well correlated; the correlation coefficient (R2) was only .476. Thus, the LBS-Lp(a) immunoassay reported on a distinct property of Lp(a).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. Plasma samples were diluted to 5 mg/L on the basis of reactivity in a commercial Lp(a) assay. LBS activity was determined in the LBS-Lp(a) immunoassay. The signal obtained for the reference standard Lp(a) in the assay was assigned a value of 100%; other values are expressed as a percentage of the reference standard. Scatterplot shows the total Lp(a) protein level versus the LBS activity measured in the LBS-Lp(a) immunoassay.

r-Apo(a)
To test the prediction that K4-37 contains the most prominent LBS of apo(a), this site was destroyed by changing the two key anionic residues of the LBS (Asp 55 and 57) to alanine by in vitro mutagenesis. The wild-type and the mutated K4-37 were expressed in an r-apo(a) with eight K4-like domains followed by a single K5 and a protease domain; Western blotting of the wild-type and mutant r-apo(a) was performed (Fig 6Down). The two r-apo(a) reacted similarly with the apo(a) antibody used and were of similar electrophoretic mobility. The culture media containing the wild-type and mutated r-apo(a) were concentrated and introduced into the LBS-Lp(a) assay in the presence or absence of EACA (Fig 7Down). As controls, conditioned medium from 293 cells after 24 hours and concentrated (fourfold) conditioned medium were tested for interference in the LBS assay. Adding 5 µg/mL of the reference Lp(a) to these samples at varying dilutions (from zero to 1:243) did not change the LBS activity of the Lp(a). The coefficient of variation was within the experimental error (medium, 6%; conditioned medium, 6%; and concentrated conditioned medium, 3%). Nonspecific binding determined in the presence of 100 mmol/L EACA was subtracted. In the absence of EACA, the signal obtained with wild-type r-apo(a) was 1.9-fold higher than with the mutant r-apo(a). At 1 mmol/L EACA, the signal obtained with the wild-type r-apo(a) was reduced by 63%. The signal obtained with mutant r-apo(a) was reduced by 41%. Thus, LBS function was substantially but not fully abolished in the mutant r-apo(a).




View larger version (80K):
[in this window]
[in a new window]
 
Figure 6. Top, Structures of the mutant and wild-type r-apo(a). The recombinant apoproteins were composed of eight repeats, one K5, and a protease domain. The mutant contained alanine substitutions for two aspartic acids in the last K4 repeat, which corresponds to K4-37 in the nomenclature of McLean et al.5 Lower left, Immunoblot analysis of the wild-type and mutant r-apo(a). Following transient transfection of 293 cells with wild-type (pCMha8) and mutant (pCMha8Lysmuta) apo(a) expression plasmids, culture medium was concentrated and analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis under reducing conditions and subsequently immunoblotted by using an antibody specific for apo(a). Wild-type and mutant r-apo(a) migrate to the same position, corresponding to Mr=2x105.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 7. Bar graph shows LBS activity of the wild-type and mutant r-apo(a). Values are mean±SE of 11-14 determinations made in duplicate of six isolations. Absorbance with 100 mmol/L EACA was subtracted from absorbance in the presence of 0 ({square}) or 1 ({blacksquare}) mmol/L EACA.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In this study, an immunoassay that reports on the functional status of the LBS of Lp(a) has been developed and applied to assess the LBS function of apo(a) and Lp(a). The critical reagent in the development of the LBS-Lp(a) immunoassay is anti-K4, which only reacted with functionally available LBS. This antibody, elicited to K4 of plasminogen, reacts with the functional LBS of K4 but not with K1-3 of plasminogen42 ; and this same requirement for functional LBS applies for its reactivity with Lp(a). To establish the specificity of the assay for the LBS of Lp(a), an initial immunocapture step with a specific anti-apo(a) was employed. Failure of Lp(a) to react in the LBS-Lp(a) immunoassay arose either from occupancy of the LBS [lysine analogues blocked reactivity of Lp(a)] or ablation of LBS function by LBS modifications [mutations in the LBS of Lp(a)]. It is noteworthy that addition of Lp(a) to normolipidemic, hyperlipidemic, or hemolyzed plasma did not block the reactivity of Lp(a) in the assay. This observation does not exclude the possibility that certain plasma samples may contain substances, eg, tetranectin,25 that interact with the LBS, but it does indicate that the LBS of Lp(a) can be available and reactive in a plasma milieu. Ultimately the assay of plasma samples at several dilutions to assign an LBS activity may be desirable to minimize potential interfering factors.

When varying concentrations of lysine or EACA were introduced into the LBS-Lp(a) immunoassay, they produced a dose-dependent inhibition of signal. The concentrations of lysine and EACA required for 50% inhibition in the LBS-Lp(a) immunoassay were very similar to those required47 for blocking the binding of isolated Lp(a) to lysine-Sepharose beads. This similarity suggests that the LBS-Lp(a) immunoassay can be used to determine the relative affinity of the LBS of Lp(a) for lysine analogues. Blockade of the LBS of Lp(a) may be a useful therapeutic approach to limiting the pathogenetic effects of Lp(a). The LBS-Lp(a) immunoassay should provide a useful approach for screening various lysine-LBS inhibitors for potency and determining their consistency among Lp(a) samples from different patients. The LBS-Lp(a) immunoassay should also provide a method for screening the effects of modifications of the Lp(a) particle on LBS activity. While several studies49 50 51 indicate that the apo(a) portion of Lp(a) extends away from the apoB-100 and lipid core, apoB is closely associated with the lipid core. The apo(a) is attached to apoB via a disulfide linkage at K4-36.52 The K4-37 kringle is located close to the kringle, as are K4-32 to K4-35, which, according to Ernst et al,53 may also have LBS activity and be important for the assembly of the Lp(a) particle. These kringles near the attachment point of apoB to apo(a) may have variable LBS activity in different Lp(a) particles depending on the size and content of the lipid core or modification of the apoproteins. Detergent53 or low salt concentration29 influences LBS activity, supporting the potential for variable LBS function. Taken together, our data indicate that K4-37 is the primary determinant of the LBS activity of Lp(a). However, other factors, such as the exposure of secondary LBS in other kringles, changes in the organization of the lipoprotein particle, or the association of plasma proteins, may influence LBS function. It appears that the LBS-Lp(a) assay can faithfully report on such variations in the LBS function of Lp(a).

The LBS-Lp(a) immunoassay was applied to a small panel of plasma samples. LBS activity ranged from 0% to 100% of the reference Lp(a). The binding of Lp(a) from different individuals to a lysine-Sepharose column varies from 40% to 80%, 17% to 91%, and 30% to 70%.35 36 54 The explanation for these ranges of LBS activity could be one or more of the following. Mutations in K4-37 may reduce or abolish LBS activity; other kringles with or without mutations may have some LBS function53 ; in vivo modifications (eg, oxidation,55 reduction,54 56 sialyation/desialyation,57 or lipid composition and degradation58 ) of Lp(a) may influence LBS activity; and kringle number may influence the accessibility of some kringles, ie, Lp(a) size may influence LBS activity.59 Limited correlation was found in the samples studied between the Lp(a) concentrations in these plasmas and LBS activity. Thus, the LBS-Lp(a) immunoassay may report on a distinct property of Lp(a) independent of its plasma concentration. Nearly 20 retrospective and prospective studies have confirmed that Lp(a) is a major risk factor for coronary heart disease and stroke.60 61 62 63 Karmansky et al36 compared two groups of patients, one with moderate and one with severe coronary artery disease, and found that the LBS activity of Lp(a) was nearly threefold higher in the severe coronary artery disease patients. Not all subjects with high Lp(a) levels have high LBS activity (Table 1Up), just as size is not an absolute predictor of concentration.64 65 A good test for the usefulness of the LBS-Lp(a) assay would be to analyze a population in which high a Lp(a) level is not a risk factor compared with a population in which high Lp(a) is a risk factor. Studies are now under way to determine the relationship between the signal in the LBS-Lp(a) immunoassay and pathogenesis in such well-characterized panels of clinical specimens. One interesting possibility is that the LBS-Lp(a) immunoassay will help to identify those patients with elevated Lp(a) levels who are at particularly high risk for the development of coronary disease. As a cautionary caveat, the signal obtained with plasma samples in the LBS-Lp(a) immunoassay is critically dependent on the input concentration of Lp(a). The heterogeneity among individual Lp(a) samples can influence their quantification in the initial Lp(a) assays.66 Thus, further development and use of the LBS-Lp(a) immunoassay must be closely coordinated with development of reliable assays for Lp(a) quantification.

The LBS-Lp(a) immunoassay was used to characterize the LBS activity of a wild-type and mutant r-apo(a). On the basis of initial sequencing, wild-type K4-37 was predicted to have a functional LBS. This supposition has been supported by molecular modeling,29 31 by characterization of Lp(a) particles containing naturally occurring substitutions within this LBS, and by expression and analyses of this recombinant kringle. The mutant r-apo(a) contained two substitutions at the critical aspartic acid residues in the LBS of K4-37 and should have diminished LBS activity.48 Consistent with these predictions, the mutant r-apo(a) showed a significant decrease in reactivity in the LBS-Lp(a) immunoassay relative to wild-type r-apo(a). Nevertheless, the LBS-Lp(a) activity of the mutant r-apo(a) was not fully lost. Assembly of apo(a) into LDL requires LBS activity and is inhibited by EACA.49 67 68 While our study was in progress, Ernst et al53 reported that r-apo(a) may contain two LBSs, one associated with K4-37 and a second within the K4-32–K4-36 region, and suggested that this second LBS is not expressed within the intact Lp(a) particle. Edelstein et al69 have shown that apo(a) from rhesus monkeys binds LDL particles to form Lp(a); this incorporation is EACA-sensitive. Nevertheless, rhesus monkey Lp(a), which has a nonfunctional LBS in K4-37 due to a point substitution,29 does not have an exposed LBS. Thus, the existence of two LBS in apo(a), with only the one in K4-37 being available in the intact human Lp(a) particle, provides one possible explanation for our data and is consistent with recent reports. Transgenic mice that express human apo(a) or Lp(a) are more susceptible to diet-induced atherosclerosis than control animals.70 The in vivo effects of mutant r-apo(a), either as free apo(a) or incorporated into Lp(a) particles, should be very informative in terms of assessing the contributions of the two potential LBS (K4-37 and K4-32–K4-36) to the pathogenesis of Lp(a). The analyses of these mice to determine whether Lp(a) particles are formed, and, if so, whether the particles have LBS function, should resolve the contributions of the two LBS to Lp(a) assembly.


*    Selected Abbreviations and Acronyms
 
BSA = bovine serum albumin
EACA = {varepsilon}-aminocaproic acid
LBS = lysine-binding site(s)
Lp(a) = lipoprotein(a)
PBS = phosphate-buffered saline
r-apo(a) = recombinant apo(a)


*    Acknowledgments
 
This work was supported in part by National Institutes of Health grant HL 18577 and the American Heart Association, Northeast Ohio Affiliate. We wish to thank Brian Lowry for excellent technical assistance and Jane Rein and Gene Lazuta for preparation of the manuscript.

Received June 23, 1995; accepted December 19, 1995.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Fless GM, Rolih CA, Scanu AM. Heterogeneity of human plasma lipoprotein(a): isolation and characterization of the lipoprotein subspecies and their apoproteins. J Biol Chem. 1984;259:11470-11478. [Abstract/Free Full Text]

2. Utermann G. The mysteries of lipoprotein(a). Science. 1989;246:904-910. [Abstract/Free Full Text]

3. Eaton DL, Fless GM, Kohr WJ, McLean JW, Xu Q-T, Miller CG, Lawn RM, Scanu AM. Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen. Proc Natl Acad Sci U S A. 1987;84:3224-3228. [Abstract/Free Full Text]

4. Sottrup-Jensen L, Claeys H, Zajdel M, Petersen TE, Magnusson S. The primary structure of human plasminogen: isolation of two lysine-binding fragments and one `mini' plasminogen (MW 38,000) by elastase-catalyzed-specific limited proteolysis. In: Davidson JF, Rowan RM, Samama MM, Desnoyers PC, eds. Progress in Chemical Fibrinolysis and Thrombolysis, III. New York, NY: Raven Press; 1978:191-209.

5. McLean JW, Tomlinson JE, Kuang W-J, Eaton DL, Chen EY, Fless GM, Scanu AM, Lawn RM. cDNA sequence of human apolipoprotein(a) is homologous to plasminogen. Nature. 1987;330:132-137. [Medline] [Order article via Infotrieve]

6. Skoza L, Tse AO, Semar M, Johnson AJ. Comparative activities of amino acid and polypeptide inhibitors on natural and synthetic substrates. Ann N Y Acad Sci. 1968;146:659-672. [Medline] [Order article via Infotrieve]

7. Winn ES, Hu S-P, Hochschwender SM, Laursen RA. Studies on the lysine-binding sites of human plasminogen: the effect of ligand structure on the binding of lysine analogs to plasminogen. Eur J Biochem. 1980;104:579-586. [Medline] [Order article via Infotrieve]

8. Lucas MA, Fretto LJ, McKee PA. The binding of human plasminogen to fibrin and fibrinogen. J Biol Chem. 1983;258:4249-4256. [Free Full Text]

9. Knudsen BS, Silverstein RL, Leung LLK, Harpel PC, Nachman RL. Binding of plasminogen to extracellular matrix. J Biol Chem. 1986;261:10765-10771. [Abstract/Free Full Text]

10. Wiman B, Collen D. On the kinetics of the reaction between human antiplasmin and plasmin. Eur J Biochem. 1978;84:573-578. [Medline] [Order article via Infotrieve]

11. Miles LA, Dahlberg CM, Plow EF. The cell-binding domains of plasminogen and their function in plasma. J Biol Chem. 1988;263:11928-11934. [Abstract/Free Full Text]

12. Miles LA, Dahlberg CM, Plescia J, Felez J, Kato K, Plow EF. Role of cell-surface lysines in plasminogen binding to cells: identification of alpha-enolase as a candidate plasminogen receptor. Biochemistry. 1991;30:1682-1691. [Medline] [Order article via Infotrieve]

13. Kostner GM. Interaction of Lp(a) and of apo(a) with liver cells. Arterioscler Thromb. 1993;13:1101-1109. [Abstract/Free Full Text]

14. Snyder ML, Hay RV, Whitington PF, Scanu AM, Fless GM. Binding and degradation of lipoprotein(a) and LDL by primary cultures of human hepatocytes. Arterioscler Thromb. 1994;14:770-779. [Abstract/Free Full Text]

15. Miles LA, Fless GM, Levin EG, Scanu AM, Plow EF. A potential basis for the thrombotic risks associated with lipoprotein(a). Nature. 1989;339:301-303. [Medline] [Order article via Infotrieve]

16. Snyder ML, Polacek D, Scanu AM, Fless GM. Comparative binding and degradation of lipoprotein(a) and low density lipoprotein by human monocyte derived macrophages. J Biol Chem. 1992;267:339-346. [Abstract/Free Full Text]

17. Haberland ME, Fless G, Scanu AM, Fogelman AM. Malondialdehyde modification of lipoprotein(a) produces avid uptake by human monocyte-macrophages. J Biol Chem. 1992;2670:4143-4151.

18. Miles LA, Fless GM, Scanu AM, Baynham P, Sebald MT, Skocir P, Curtiss LK, Levin EG, Hoover-Plow JL, Plow EF. Interaction of Lp(a) with plasminogen binding sites on cells. Thromb Haemost. 1995;73:458-465. [Medline] [Order article via Infotrieve]

19. Hajjar KA, Gavish D, Breslow JL, Nachman RL. Lipoprotein(a) modulation of endothelial cell surface fibrinolysis and its potential role in atherosclerosis. Nature. 1989;339:303-305. [Medline] [Order article via Infotrieve]

20. Tabas I, Li Y, Brocia RW, Xu SW, Swenson TL, Williams KJ. Lipoprotein lipase and sphingomyelinase synergistically enhance the association of atherogenic lipoproteins with smooth muscle cells and extracellular matrix. J Biol Chem. 1993;268:20419-20432. [Abstract/Free Full Text]

21. Miles LA, Sebald MT, Fless GM, Scanu AM, Hoover-Plow JL, Plow EF. Interaction of lipoprotein(a) [Lp(a)] with the extracellular matrix. Blood. 1993;82:1785a. Abstract.

22. Van der Hoek YY, Sangrar W, Côté GP, Kastelein JJP, Koschinsky ML. Binding of recombinant apolipoprotein(a) to extracellular matrix proteins. Arterioscler Thromb. 1994;14:1792-1798. [Abstract/Free Full Text]

23. Salonen E-M, Jauhiainen M, Zardi L, Vaheri A, Ehnholm C. Lipoprotein(a) binds to fibronectin and has serine proteinase activity capable of cleaving it. EMBO J. 1989;8:4035-4040. [Medline] [Order article via Infotrieve]

24. Edelberg JM, Gonzalez-Gronow M, Pizzo SV. Lipoprotein a inhibits streptokinase-mediated activation of human plasminogen. Biochemistry. 1989;28:2370-2374. [Medline] [Order article via Infotrieve]

25. Kluft C, Jie AF, Los P, de Wit E, Havekes L. Functional analogy between lipoprotein(a) and plasminogen in the binding to the kringle 4 binding protein, tetranectin. Biochem Biophys Res Commun. 1989;161:427-433. [Medline] [Order article via Infotrieve]

26. Loscalzo J, Weinfeld M, Fless GM, Scanu AM. Lipoprotein(a), fibrin binding, and plasminogen activation. Arteriosclerosis. 1990;10:240-245. [Abstract/Free Full Text]

27. Wu TP, Padmanabhan K, Tulinsky A, Mulichak AM. The refined structure of the {epsilon}-aminocaproic acid complex of human plasminogen kringle 4. Biochemistry. 1991;30:10589-10594. [Medline] [Order article via Infotrieve]

28. LoGrasso PV, Cornell-Kennon S, Boettcher BR. Cloning, expression, and characterization of human apolipoprotein(a) kringle IV37. J Biol Chem. 1994;269:21820-21827. [Abstract/Free Full Text]

29. Scanu AM, Miles LA, Pfaffinger D, Fless GM, Jackson E, Hoover-Plow JL, Brunck T, Plow EF. Rhesus monkey Lp(a) binds to lysine-Sepharose and U937 monocytoid cells less efficiently than human Lp(a): evidence for a dominant role of kringle 437. J Clin Invest. 1993;91:283-291.

30. Scanu AM, Pfaffinger D, Lee JC, Hinman J. A single point mutation (Trp72->Arg) in human apo(a) kringle 4-37 associated with a lysine binding defect in Lp(a). Biochim Biophys Acta. 1994;1227:41-45. [Medline] [Order article via Infotrieve]

31. Guevara J Jr, Knapp RD, Honda S, Northrup SR, Morrisett JD. A structural assessment of the apo[a] protein of human lipoprotein[a]. Proteins: Struct Funct Gen. 1992;12:188-199.

32. Scanu AM, Edelstein C. Kringle-dependent structural and functional polymorphism of apolipoprotein(a). Biochim Biophys Acta. 1995;1256:1-12. [Medline] [Order article via Infotrieve]

33. Howard GC, Pizzo SV. Biology of disease: lipoprotein(a) and its role in atherothrombotic disease. Lab Invest. 1993;69:373-386. [Medline] [Order article via Infotrieve]

34. Miles LA, Plow EF. Lp(a): an interloper into the fibrinolytic system? Thromb Haemost. 1990;63:331-335. [Medline] [Order article via Infotrieve]

35. Armstrong VW, Harrach B, Robenek H, Helmhold M, Walli AK, Seidel D. Heterogeneity of human lipoprotein Lp[a]: cytochemical and biochemical studies on the interaction of two Lp[a] species with the LDL receptor. J Lipid Res. 1990;31:429-441. [Abstract]

36. Karmansky I, Shnaider H, Palant A, Gruener N. Lysine-binding species of lipoprotein(a) in coronary artery disease. Eur J Clin Invest. 1994;24:360-366. [Medline] [Order article via Infotrieve]

37. Scanu AM. Identification of mutations in human apolipoprotein(a) kringle 4-37 from the study of the DNA of peripheral blood lymphocytes: relevance to the role of lipoprotein(a) in atherothrombosis. Am J Cardiol. 1995;75:58B-61B. [Medline] [Order article via Infotrieve]

38. Kraft HG, Haibach C, Lingenhel A, Brunner C, Trommsdorff M, Kronenberg F, Muller HJ, Utermann G. Sequence polymorphism in kringle IV 37 in linkage disequilibrium with the apolipoprotein(a) size polymorphism. Hum Genet. 1995;95:275-282. [Medline] [Order article via Infotrieve]

39. Koschinsky ML, Tomlinson JE, Zioncheck TF, Schwartz K, Eaton DL, Lawn RM. Apolipoprotein(a): expression and characterization of a recombinant form of the protein in mammalian cells. Biochemistry. 1991;30:5044-5051. [Medline] [Order article via Infotrieve]

40. Mulichak AM, Tulinsky A, Ravichandran KG. Crystal and molecular structure of human plasminogen kringle 4 refined at 1.9-Å resolution. Biochemistry. 1991;30:10576-10588. [Medline] [Order article via Infotrieve]

41. Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol. 1977;36:59-74. [Abstract/Free Full Text]

42. Plow EF, Collen D. Immunochemical characterization of a low affinity lysine binding site within plasminogen. J Biol Chem. 1981;256:10864-10869. [Free Full Text]

43. Miles LA, Plow EF. Topography of the high-affinity lysine binding site of plasminogen as defined with a specific antibody probe. Biochemistry. 1986;25:6926-6933. [Medline] [Order article via Infotrieve]

44. Fless GM, Snyder ML, Scanu AM. Enzyme-linked immunoassay for Lp(a). J Lipid Res. 1989;30:651-662. [Abstract]

45. Silberman SR, Armentrout MA, Vella FA, Saha AL. Macra(TM) Lp(a) for quantitation of human lipoprotein(a) by enzyme linked immunoassay. Clin Chem. 1990;36:961.

46. Taddei-Peters WC, Butman BT, Jones GR, Venetta TM, Macomber PF, Ransom H. Quantification of lipoprotein(a) particles containing various apolipoprotein(a) isoforms by a monoclonal anti-apo(a) capture antibody and a polyclonal anti-apolipoprotein B detection antibody sandwich enzyme immunoassay. Clin Chem. 1993;39:1382-1389. [Abstract]

47. Hoover-Plow JL, Miles LA, Fless GM, Scanu AM, Plow EF. Comparison of the lysine binding functions of lipoprotein(a) and plasminogen. Biochemistry. 1993;32:13681-13687. [Medline] [Order article via Infotrieve]

48. McCance SG, Menhart N, Castellino FJ. Amino acid residues of the kringle-4 and kringle-5 domains of human plasminogen that stabilize their interactions with omega-amino acid ligands. J Biol Chem. 1994;269:32405-32410. [Abstract/Free Full Text]

49. Phillips ML, Lembertas AV, Schumaker VN, Lawn RM, Shire SJ, Zioncheck TF. Physical properties of recombinant apolipoprotein(a) and its association with LDL to form an Lp(a)-like complex. Biochemistry. 1993;32:3722-3728. [Medline] [Order article via Infotrieve]

50. Huby T, Doucet C, Dieplinger H, Chapman J, Thillet J. Structural domains of apolipoprotein(a) and its interaction with apolipoprotein B-100 in the lipoprotein(a) particle. Biochemistry. 1994;33:3335-3341. [Medline] [Order article via Infotrieve]

51. Fless GM, Snyder ML, Furbee JW Jr, Garcia-Hedo M-T, Mora R. Subunit composition of lipoprotein(a) protein. Biochemistry. 1994;33:13492-13501. [Medline] [Order article via Infotrieve]

52. Koschinsky ML, Côté GP, Gabel B, Van der Hoek YY. Identification of the cysteine residue in apolipoprotein(a) that mediates extracellular coupling with apolipoprotein B-100. J Biol Chem. 1993;268:19819-19825. [Abstract/Free Full Text]

53. Ernst A, Helmhold M, Brunner C, Petho-Schramm A, Armstrong VW, Müller HJ. Identification of two functionally distinct lysine-binding sites in kringle 37 and in kringles 32-36 of human apolipoprotein(a). J Biol Chem. 1995;270:6227-6234. [Abstract/Free Full Text]

54. Leerink CB, Duif PF, Gimpel JA, Kortlandt W, Bouma BN, van Rijn HJM. Lysine-binding heterogeneity of Lp(a): consequences for fibrin binding and inhibition of plasminogen activation. Thromb Haemost. 1992;68:185-188. [Medline] [Order article via Infotrieve]

55. Sattler W, Kostner GM, Waeg G, Esterbauer H. Oxidation of lipoprotein Lp(a): a comparison with low-density lipoproteins. Biochim Biophys Acta. 1991;1081:65-74. [Medline] [Order article via Infotrieve]

56. Harpel PC, Chang VT, Borth W. Homocysteine and other sulfhydryl compounds enhance the binding of lipoprotein(a) to fibrin: a potential biochemical link between thrombosis, atherogenesis, and sulfhydryl compound metabolism. Proc Natl Acad Sci U S A. 1992;89:10193-10197. [Abstract/Free Full Text]

57. Dousset N, Dousset JC, Taus M, Ferretti G, Curatola G, Solera ML, Valdiguie P. Effect of desialylation on low density lipoproteins: comparative study before and after oxidative stress. Biochem Mol Biol Int. 1994;32:555-563. [Medline] [Order article via Infotrieve]

58. Natarajan MK, Fong BS, Angel A. Enhanced binding of phospholipase-A2-modified low density lipoprotein by human adipocytes. Biochem Cell Biol. 1990;68:1243-1249. [Medline] [Order article via Infotrieve]

59. Cohen JC, Chiesa G, Hobbs HH. Sequence polymorphisms in the apolipoprotein(a) gene: evidence for dissociation between apolipoprotein(a) size and plasma lipoprotein(a) levels. J Clin Invest. 1993;91:1630-1636.

60. Schreiner PJ, Morrisett JD, Sharrett AR, Patsch W, Tyroler HA, Wu K, Heiss G. Lipoprotein(a) as a risk factor for preclinical atherosclerosis. Arterioscler Thromb Vasc Biol. 1995;13:826-833. [Abstract/Free Full Text]

61. Desmarais RL, Sarembock IJ, Ayers CR, Vernon SM, Powers ER, Gimple LW. Elevated serum lipoprotein(a) is a risk factor for clinical recurrence after coronary balloon angioplasty. Circulation. 1995;91:1403-1409. [Abstract/Free Full Text]

62. Terres W, Tatsis E, Pfalzer B, Beil FU, Beisiegel U, Hamm CW. Rapid angiographic progression of coronary artery disease in patients with elevated lipoprotein(a). Circulation. 1995;91:948-950. [Abstract/Free Full Text]

63. Bostom AG, Gagnon DR, Cupples LA, Wilson PW, Jenner JL, Ordovas JM, Schaefer EJ, Castelli WP. A prospective investigation of elevated lipoprotein(a) detected by electrophoresis and cardiovascular disease in women: the Framingham Heart Study. Circulation. 1994;90:1688-1695. [Abstract/Free Full Text]

64. Lackner C, Cohen JC, Hobbs HH. Molecular definition of the extreme size polymorphism in apolipoprotein(a). Hum Mol Genet. 1993;2:933-940. [Abstract/Free Full Text]

65. Geroldi D, Bellotti V, Buscaglia P, Bonetti G, Gazzaruso C, Caprioli A, Fratino P. Characterization of apo(a) polymorphism by a modified immunoblotting technique in an Italian population sample. Clin Chim Acta. 1993;221:159-169. [Medline] [Order article via Infotrieve]

66. Marcovina SM, Albers JJ, Gabel B, Koschinsky ML, Gaur VP. Effect of the number of apolipoprotein(a) kringle 4 domains on immunochemical measurements of lipoprotein(a). Clin Chem. 1995;41:246-255. [Abstract/Free Full Text]

67. Trieu VN, McConathy WJ. The binding of animal low-density lipoproteins to human apolipoprotein(a). Biochem J. 1995;309:899-904.

68. Frank S, Krasznai K, Durovic S, Lobentanz EM, Dieplinger H, Wagner E, Zatloukal K, Cotten M, Utermann G, Kostner GM, Zechner R. High-level expression of various apolipoprotein(a) isoforms by `transferrinfection': the role of kringle IV sequences in the extracellular association with low-density lipoprotein. Biochemistry. 1994;33:12329-12339. [Medline] [Order article via Infotrieve]

69. Edelstein C, Mandala M, Pfaffinger D, Scanu AM. Determinants of lipoprotein(a) assembly: a study of wild-type and mutant apolipoprotein(a) phenotypes isolated from human and rhesus monkey lipoprotein(a) under mild reductive conditions. Biochemistry. 1995;34:16483-16492. [Medline] [Order article via Infotrieve]

70. Lawn RM, Wade DP, Hammer RE, Chiesa G, Verstuyft JG, Rubin EM. Atherogenesis in transgenic mice expressing human apolipoprotein(a). Nature. 1992;360:670-672.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Huby, V. Afzal, C. Doucet, R. M. Lawn, E. L. Gong, M. J. Chapman, J. Thillet, and E. M. Rubin
Regulation of the Expression of the Apolipoprotein(a) Gene: Evidence for a Regulatory Role of the 5' Distal Apolipoprotein(a) Transcription Control Region Enhancer in Yeast Artificial Chromosome Transgenic Mice
Arterioscler Thromb Vasc Biol, September 1, 2003; 23(9): 1633 - 1639.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Ogorelkova, H. G. Kraft, C. Ehnholm, and G. Utermann
Single nucleotide polymorphisms in exons of the apo(a) kringles IV types 6 to 10 domain affect Lp(a) plasma concentrations and have different patterns in Africans and Caucasians
Hum. Mol. Genet., April 1, 2001; 10(8): 815 - 824.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. M. Lawn, K. Schwartz, and L. Patthy
Convergent evolution of apolipoprotein(a) in primates and hedgehog
PNAS, October 28, 1997; 94(22): 11992 - 11997.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoover-Plow, J. L.
Right arrow Articles by Plow, E. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoover-Plow, J. L.
Right arrow Articles by Plow, E. F.