Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Arteriosclerosis, Thrombosis, and Vascular Biology. 1996;16:517-522

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vega, G. L.
Right arrow Articles by Grundy, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vega, G. L.
Right arrow Articles by Grundy, S. M.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1996;16:517-522.)
© 1996 American Heart Association, Inc.

Articles

Hypercholesterolemia With Cholesterol-Enriched LDL and Normal Levels of LDL–Apolipoprotein B

Effects of the Step I Diet and Bile Acid Sequestrants on the Cholesterol Content of LDL

Gloria Lena Vega; Scott M. Grundy

From the Center for Human Nutrition and the Departments of Clinical Nutrition, Internal Medicine, and Biochemistry of the University of Texas Southwestern Medical Center at Dallas and the Veterans Affairs Medical Center, Dallas, Tex.


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Abstract One form of hypercholesterolemia is characterized by high levels of LDL cholesterol and normal levels of LDL–apolipoprotein (apo) B. The reason for hypercholesterolemia, therefore, is enrichment of LDL particles with cholesterol. We have reported previously that about one third of patients with primary moderate hypercholesterolemia have this lipoprotein pattern and have no apparent abnormality in LDL–apo B metabolism. The current study was designed to determine whether the combination of the Step I Diet (30% of total calories as fat, <10% saturated fatty acids, and <300 mg per day cholesterol) with or without cholestyramine therapy will correct the hypercholesterolemia in patients of this type. Ten hypercholesterolemic men of this type were identified and recruited into the study. Their LDL cholesterol levels were >=160 mg/dL and LDL–apo B levels were <120 mg/dL (LDL cholesterol/apo B ratio >1.60). For patient selection, subjects were challenged with a high fat diet (40% of total calories as fat, 18% saturated fatty acids, and 400 mg per day cholesterol) for 6 weeks to confirm persistence of a high LDL cholesterol/apo B ratio. Thereafter, they were started on a Step I Diet, and lipoprotein analyses were repeated. Finally, cholestyramine (16 g per day) was added to the Step I Diet. The Step I Diet alone significantly reduced the LDL cholesterol/apo B ratios and produced a trend toward lowering LDL cholesterol levels. Cholestyramine therapy further reduced LDL cholesterol levels and maintained a normal LDL cholesterol/apo B ratio. The present investigation thus confirms the existence of a form of moderate hypercholesterolemia that arises from a defect in LDL composition. In addition, it demonstrates that the combination of the Step I Diet and cholestyramine therapy corrects this defect and normalizes LDL levels and LDL composition.


Key Words: cholesterol-enriched LDL • high fat diet • low fat diet • bile acid sequestrant • hypercholesterolemia


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Hypercholesterolemia is multifactorial in its origin.1 2 Most forms of hypercholesterolemia are characterized by increased plasma concentrations of LDL cholesterol, and in the majority of cases, plasma levels of LDL–apolipoprotein B-100 (apo B) are increased as well.1 Several mechanisms may lead to high levels of LDL–apo B; these include reduced activity of LDL receptors,3 defective apo B that prevents normal binding of LDL to LDL receptors,4 5 6 7 and possibly overproduction of apo B–containing lipoproteins by the liver.1 In addition, we recently described another form of elevated LDL cholesterol in which LDL–apo B levels are not increased.1 This form of hypercholesterolemia is characterized by a high ratio of cholesterol to apo B in LDL particles. The result of this increased ratio is a high LDL cholesterol level, in the hypercholesterolemic range, with an LDL–apo B level in the normal range. The defect presumably represents an alteration in the metabolism of cholesterol and not in apo B metabolism. Our data suggested that about one third of men with primary moderate hypercholesterolemia have this condition,1 and it may be an even more common form of hypercholesterolemia in women.8

One approach to treatment of this form of hypercholesterolemia may be to reduce the LDL cholesterol/apo B ratio rather than to decrease LDL–apo B levels. This approach would be directed toward the primary defect. Two forms of therapy-low fat diets9 and bile acid sequestrants10 11 -have been reported to reduce LDL cholesterol/apo B ratios, and thus they might be the preferred therapy for this type of hypercholesterolemia. For this reason, we identified hypercholesterolemic male patients with relatively normal LDL–apo B levels but increased LDL cholesterol/apo B ratios, and we examined their response in sequence to a reduced fat diet and a bile acid sequestrant. The question under consideration was whether these forms of management will reverse this particular type of hypercholesterolemia resulting from a defect in LDL composition.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Patients
Patients for this study were recruited from the population of subjects attending the lipid clinic at the Veterans Affairs Medical Center, Dallas, Tex. Subjects with hypercholesterolemia were identified either by referral to the clinic or by routine screening for dyslipidemia of the subjects attending the Veterans Affairs Medical Center. In a previous study1 we observed that about one third of patients with hypercholesterolemia have normal levels of LDL–apo B but high levels of LDL cholesterol (LDL cholesterol/apo B ratio >=1.60). In the current study, during routine evaluation of hypercholesterolemia, adult men with persistent hypercholesterolemia were identified as having normal LDL–apo B levels and elevated LDL cholesterol. Ten such patients were identified who agreed to participate in the study. Their ages ranged from 45 to 69 years (57.2±6.8 years), and body mass indexes (BMI) ranged from 20.2 to 30.4 kg/m2 (mean BMI=25.8±2.5 kg/m2). There were four smokers; two had a history of coronary heart disease documented by a myocardial infarction. Four patients had hypertension that was controlled by medication throughout the study. Hypercholesterolemia was defined as plasma levels of LDL cholesterol >=160 mg/dL, with plasma triglycerides <200. These definitions are consistent with National Cholesterol Education Program criteria.12 According to these criteria, and by convention, "LDL" represents the lipoprotein fraction of density range 1.0063 to 1.063 g/mL and includes true LDL (d=1.019 to 1.063 g/mL) and IDL. Additionally, patients were selected to have an elevated LDL cholesterol/apo B ratio. This type of hypercholesterolemia was defined as an LDL cholesterol to apo B ratio >=1.60 and an LDL–apo B <120 mg/dL; this definition is based on data for normal LDL composition obtained in a previous investigation.1 The LDL cholesterol–to–apo B ratio used was derived from true LDL (d=1.019 to 1.063 g/mL). Exclusion criteria included unstable angina, clinically severe coronary heart disease, endocrine disorders, liver or renal dysfunction, and treatment with hypolipidemic agents for at least 2 months before recruitment.

Experimental Design
This study was designed as a single-blind, sequential intervention study that consisted of three phases. The first phase lasted 6 weeks. The diet of this phase was composed of 40% of total calories as fat (18% saturates), 45% carbohydrate, and 15% protein with a daily dietary cholesterol intake of about 400 mg per day (high fat diet).1 After 6 weeks, patients had measurement of levels of plasma lipids, lipoprotein cholesterol, and LDL–apo B for 5 consecutive days. The ratio of LDL cholesterol/apo B also was determined. Upon completion of this phase, the subjects were started on the American Heart Association Step I Diet and concomitantly 16 g per day of placebo for a bile acid sequestrant (cholestyramine [Questran Lyte]). Questran Lyte (placebo and active drug) was donated for the study by Bristol-Myers Squibb Co. The second phase lasted 8 weeks. During this phase, the Step I Diet was used. This diet consisted of 30% of total calories as fat (10% saturated fatty acids, 10% monounsaturates, and 10% polyunsaturates), 55% carbohydrate, and 15% protein with a daily cholesterol intake <300 mg. During the last week of the second phase, subjects had daily measurements of plasma levels of lipids, lipoprotein cholesterol, and LDL–apo B. These measurements were carried out daily for 5 consecutive days. The third phase of study consisted of treatment with 16 g per day of active bile acid sequestrant (Questran Lyte) and continuation of the Step I Diet. The third phase also lasted 8 weeks; during the last week, measurements of lipoproteins were repeated. Throughout the study, subjects were evaluated regularly every fourth week and encouraged to maintain adherence to the diet and drug or placebo. They were counseled by a dietitian on diet adherence and maintenance of constant body weight. The average coefficient of variation for the weight during the study was 3%.

The ratios of LDL cholesterol to apo B in normolipidemic subjects studied with the same baseline diet and clinical conditions were included for comparison with hypercholesterolemic patients. These control subjects had similar ages and BMI to the hypercholesterolemic patients in this study, and they have been described previously.1 All subjects gave informed written consent for participation in the study. The protocol was approved by the Institutional Review Board for Investigation in Humans at the Veterans Affairs Medical Center, Dallas, Tex.

Procedures
Twenty milliliters of blood was collected each time after a 12-hour fast. Blood was drawn by venipuncture into tubes containing disodium EDTA at a concentration of 1 mg/mL. Plasma was separated shortly after blood collection at 4°C and stored at the same temperature for analysis. Preservatives were added to the plasma samples as follows: gentamicin sulfate (0.005%), chloramphenicol (0.005%), sodium azide (0.01%), and Trasylol (100 IU/mL). Levels of plasma total cholesterol and triglyceride were measured enzymatically,13 14 and HDL cholesterol was measured after precipitation of apo B–containing lipoproteins with the use of 0.55 mmol/L phosphotungstic acid and 25 mmol/L magnesium chloride.15 Cholesterol in VLDL+IDL (d<1.019 g/mL) and LDL was measured as follows: 4 mL of plasma was adjusted to a density of 1.019 g/mL as detailed previously.16 VLDL+IDL isolation was carried out by ultracentrifugation for 18 hours at 39 000 rpm. The top 2 mL was collected quantitatively; total cholesterol was measured in the fractions of density less than and greater than 1.019 g/mL. Recoveries of cholesterol were >96%. VLDL+IDL cholesterol (d<1.019 g/mL) was normalized for recoveries, and absolute concentration of LDL cholesterol was estimated as the difference between total plasma cholesterol and the sum of HDL and VLDL+IDL cholesterol (d<1.019 g/mL).

Levels of apo B in LDL and VLDL+IDL were determined by a modification of the Lowry-Folin procedure as detailed elsewhere.16 17 Briefly, LDL (d=1.019 to 1.063 g/mL) was isolated from the plasma infranatant of density 1.019 g/mL. Total cholesterol was measured enzymatically, and apolipoprotein was measured chemically.16 17 The ratio of LDL cholesterol/apo B was calculated. Absolute concentrations of apo B in LDL were calculated as the product of the ratio of cholesterol/apo B in isolated LDL and the absolute concentration of LDL cholesterol. Levels of apo B in VLDL+IDL were measured by precipitating apo B using a final concentration of 50% isopropyl alcohol, delipidating the precipitate with 100% alcohol, and redissolving apo B with 1.5 mol/L sodium deoxycholic acid and 0.1N NaOH.16 18 Protein content was measured chemically using the modification of Markwell et al19 of the procedure of Lowry et al.20 Total apo B was calculated as the sum of VLDL+IDL–apo B and LDL–apo B.

The coefficients of variation for the enzymatic method for cholesterol quantitation and for the chemical method of quantifying apo B were <=3.0%. The latter method was standardized in our laboratory as follows. First, the standard for the Markwell modification19 of the Lowry-Folin procedure20 is bovine serum albumin obtained from the National Institute of Standards and Technology.17 Second, for direct measurement of apo B in LDL and VLDL+IDL, a chromogenicity factor of 1 was used for reasons detailed previously17 ; third, levels of apo B measured by the chemical method and with immunochemical methods for apo B give similar values with a high correlation coefficient.17

The current study required the isolation of LDL (d=1.019 to 1.063 g/mL) to determine the ratio of LDL cholesterol to apo B in the lipoprotein of these patients. It was also necessary to determine the physiological coefficients of variation of these ratios in the patients selected for study. These coefficients were determined over a period of 5 days during each of the three phases of study.

Patients were tested for familial defective apo B-100 (FDB-3500 mutation) by gene amplification and cleavage with Msp I.21 Briefly, genomic DNA was extracted from whole blood by phenol-chloroform extraction and ethanol precipitation. Two primers were used during the polymerase chain reaction. Primer 1 was 5' CCAACACTTACTTGAATTCCAAGAGCACCC 3', and primer 2 was 5' CTGTGCTCCCAGAGGGAATATATGCGTTGG 3'. These primers were obtained from the Cardiology Department of the University of Texas Southwestern Medical Center at Dallas. The digestion products were electrophoresed on a nondenaturing gel of 12% acrylamide. Two DNA markers were used for estimation of the size of the digestion products-Lambda C1 857-Dral and Msp/puc 18. The bands were visualized under UV light after treatment of the gels with ethidium bromide. All patients showed a single band of 120 bp. Subjects heterozygous for the glutamine for arginine mutation would be expected to have two bands of 149 and 120 bp, respectively, while the homozygous case would have only one band of 149 bp.21

Statistical Analysis
Data are expressed as mean±SD. Comparison of means was made by repeated measures ANOVA with a Bonferroni adjustment for multiplicity of treatments. An {alpha} of 0.05/3 (0.0167) was considered statistically significant. Coefficients of physiological variation were determined for the ratios of LDL cholesterol/apo B, and these coefficients were also compared by repeated measures ANOVA.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowReferences
 
Table 1Down shows group mean levels of plasma total cholesterol, triglycerides, and HDL cholesterol for the three periods. The Step I Diet produced a trend toward a reduction in total cholesterol levels compared with the high fat diet, but the change was not statistically significant. However, the combination of the Step I Diet plus cholestyramine gave a significant decrease of 15%. Triglyceride levels and HDL cholesterol levels did not change on either therapeutic regimen.


View this table:
[in this window]
[in a new window]
  		Table 1. Levels of Plasma Cholesterol, Triglyceride, and HDL Cholesterol

Effects of therapy on LDLs are presented in Table 2Down. Individual responses for LDL cholesterol and LDL–apo B levels and the ratios of LDL cholesterol/apo B are shown also. None of the current hypercholesterolemic patients were found to have FDB-3500. In the current patients, the mean LDL cholesterol levels were markedly increased compared with the control group, but LDL–apo B levels were only modestly higher. The result was a striking increase in LDL cholesterol/apo B ratios. This higher ratio, and not a higher LDL–apo B level, was the predominant cause of hypercholesterolemia in this group. Several patients had reductions in both LDL cholesterol and apo B on the Step I Diet, but the responses were inconsistent. With the Step I Diet, a trend toward reduction of LDL cholesterol level was noted, but again the decrease was not statistically significant. Furthermore, no change was observed in LDL–apo B concentrations on the Step I Diet alone. Addition of cholestyramine to the Step I Diet resulted in a significant decrease in both LDL cholesterol and LDL-apo B concentration. On this combination, levels approached those of a group of normal men of similar age (control group) that were previously reported.1


View this table:
[in this window]
[in a new window]
  		Table 2. LDL Cholesterol and LDL–Apo B Concentrations and LDL Cholesterol/Apo B Ratios

The ratios of LDL cholesterol/apo B were fairly constant for multiple determinations for each individual during each of the phases of study. The average coefficients of physiological variation ranged from 2% to 4% during the study. As shown in Table 2Up, the Step I Diet gave a striking decrease in mean LDL cholesterol/apo B ratios, and this response was maintained and enhanced somewhat by the addition of cholestyramine. Most of the patients had a definite decrease in ratio on the Step I Diet, and several showed a further decrease on the addition of cholestyramine. On the combined therapy, the mean LDL cholesterol/apo B ratio approached that of the control group.

Effects of the Step I Diet with and without cholestyramine on other lipid and apolipoprotein variables are given in Table 3Down. Combined diet plus drug therapy produced significant decreases in non-HDL cholesterol levels, total apo B levels, and non-HDL cholesterol/total apo B ratios. These changes could be explained almost entirely by changes in the LDL fraction because VLDL+IDL cholesterol and VLDL+IDL–apo B levels, and VLDL+IDL cholesterol/apo B ratios were unaltered by diet and drug therapy.


View this table:
[in this window]
[in a new window]
  		Table 3. Lipoprotein Cholesterol and Cholesterol Ratios


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowReferences
 
An increase in LDL cholesterol/apo B ratios with normal apo B level represents a unique form of hypercholesterolemia.1 2 The etiology of this condition is not clear and may be multifactorial in origin. At least three possibilities can be considered: (1) newly secreted apo B–containing lipoproteins may have an increased cholesterol content, most likely core cholesterol esters; (2) circulating LDL particles may represent an accumulated subpopulation of LDL particles that are enriched with cholesterol esters and are slowly removed via the LDL receptor pathway; and (3) an increased activity of cholesteryl ester transfer protein in some individuals may result in enrichment of LDL particles with cholesterol esters. The first possibility has never been documented in humans, but high cholesterol diets in primates result in secretion of cholesterol-enriched lipoproteins.22 23 Second, our investigations have shown that patients having LDL particles that bind abnormally to LDL receptors and are slowly removed exhibit LDL particles that are enriched with cholesterol.4 24 And third, some patients with hypercholesterolemia have an increased activity of cholesteryl ester transfer protein that could lead to an increased LDL cholesterol/apo B ratio.25

It is uncertain whether this form of hypercholesterolemia is as atherogenic as other forms in which LDL–apo B concentrations are concomitantly increased. Only two of the current patients had existing coronary heart disease. This is an important question because if hypercholesterolemia resulting from a high LDL cholesterol/apo B ratio does not enhance atherogenicity, many patients might be unnecessarily treated with cholesterol-lowering drugs. This question seems particularly important for women, in whom this form of hypercholesterolemia seems particularly common.8 In our view, prospective studies that include measurements of LDL (1.019 to 1.063 g/mL) compositions are needed to resolve this issue. Recently it has been reported that patients having coronary heart disease frequently have "large" LDL particles,26 but whether these "large" LDL, which may include IDL-like remnant lipoproteins, are common in patients with a high LDL cholesterol/apo B ratios remains to be determined.

In healthy normolipidemic men, about 15% of the variation in LDL cholesterol levels can be explained by variation in LDL cholesterol/apo B ratios; the remainder of the variation is due to LDL–apo B levels.16 LDL cholesterol/apo B ratios for individuals on a given diet are relatively constant, as shown in the current study. The average coefficient of variation for the ratios of current patients based on multiple determinations ranged from 2% to 4% during each phase of the study. Several workers likewise have shown that LDL physicochemical properties are relatively constant within individuals.27 28 29 Indeed, the particle composition might be expected to be more constant than the levels of apo B because particle composition reflects the steady state of a number of metabolic processes. These include the actions of lipid transfer proteins and lipolytic enzymes. In contrast, levels of LDL–apo B are more subject to hemodynamic factors, and these are more variable from day to day.

The primary aim of this study was to determine whether the combination of the Step I Diet and cholestyramine will reverse an elevated LDL cholesterol/apo B ratio. The effects of the Step I Diet alone were tested first. A low fat diet has been reported to be associated with relatively low LDL cholesterol/apo B ratios in epidemiological studies30 and to lower LDL cholesterol/apo B ratios in a clinical trial.9 The results of the current study documented that reduction in intake of saturated fatty acids and replacement with carbohydrate significantly lowered LDL cholesterol/apo B ratios. In fact, LDL–apo B levels were reduced little if any by the low fat diet; this finding is consistent with both epidemiological studies30 and a clinical trial.9 Previous investigations thus suggested that low fat diets reduced the cholesterol content of LDL particles more than they lowered the LDL–apo B levels. This action was particularly noticeable in our current patients with high LDL cholesterol/apo B ratios, but it may be a general mechanism whereby low fat diets lower LDL cholesterol concentrations. Previous studies31 32 have shown that low fat diets variably reduce LDL cholesterol levels in patients with moderate hypercholesterolemia. In the present study, the Step I Diet inconsistently reduced LDL cholesterol levels. In a few patients, LDL–apo B levels rose somewhat; in contrast, there was a consistent reduction in LDL cholesterol/apo B ratios.

This decrease in ratio contrasts with that which results from replacement of saturated fatty acids with unsaturated fatty acids, either polyunsaturated or monounsaturated fatty acids. An early report33 raised the possibility that the primary action of polyunsaturated fats for lowering LDL cholesterol levels is to reduce the LDL cholesterol/apo B ratio and not to lower LDL–apo B levels. Subsequent investigations34 35 demonstrated clearly that replacement of saturated fatty acids with unsaturated fatty acids reduces LDL–apo B levels as well as LDL cholesterol levels. This parallel decline most likely reflects an increase in the LDL receptor–mediated clearance of LDL brought about by the use of unsaturated fatty acids.36

How might the decrease in LDL cholesterol/apo B ratios result from the use of a low fat diet? In our view, the most likely mechanism is the substitution of triglycerides for cholesterol esters in the core of newly secreted apo B–containing lipoproteins. The rise in triglyceride levels commonly observed on low fat diets supports this mechanism.37 38 In other words, it seems probable that the number of lipoprotein particles secreted by the liver is not reduced during the low fat diet. The lack of decrease in LDL–apo B levels is in accord with this possibility. Thus, while the magnitude of the reduction of LDL cholesterol levels by low fat, high carbohydrate diets and high unsaturated fat diets may be similar in many patients,38 39 the mechanism for this lowering may be different. In the case of hypercholesterolemia caused by an increased LDL cholesterol/apo B ratio, a low fat diet may be the preferable approach because it will correct the primary abnormality. As indicated in the present and previous studies, some patients fail to demonstrate a lowering of LDL cholesterol levels, most likely because of an inconsistent response in LDL–apo B concentrations.

Previous investigations10 11 also reveal that bile acid sequestrants can modify LDL composition by decreasing the cholesterol content of LDL particles. In the current study, this trend was further noted. In several patients, cholestyramine therapy caused a reduction in the LDL cholesterol/apo B ratio beyond that produced by the low fat diet (Table 2Up). Since bile acid sequestrants are known to enhance VLDL-triglyceride secretion rates40 41 and triglyceride levels18 42 in some patients, a portion of their action may be to replace cholesterol esters with triglycerides in lipoproteins destined for secretion. However, bile acid sequestrants almost certainly increase the activity of LDL receptors as well43 ; in the current study this latter action was suggested by a decrease in LDL–apo B levels as well as LDL cholesterol. In contrast to bile acid sequestrants, treatment of patients having moderate hypercholesterolemia with HMG CoA reductase inhibitors causes a lowering of both LDL–apo B and LDL cholesterol levels with little change in LDL composition.8 44 This finding suggests that the predominant mechanism of statins in patients with moderate hypercholesterolemia is to enhance the activity of LDL receptors and not to change the cholesterol content of newly secreted lipoproteins.

In summary, the present investigation confirms the existence of a type of moderate hypercholesterolemia in which the defect consists primarily of an increase in LDL cholesterol/apo B ratios; plasma levels of LDL–apo B are relatively normal. Treatment of these patients with a low fat diet tended to normalize LDL cholesterol levels by normalizing LDL cholesterol/apo B ratios; little reduction in LDL–apo B levels was noted. Addition of bile acid sequestrants further reduced LDL cholesterol/apo B in some patients but produced a lowering of LDL–apo B levels as well. The combination of a low fat diet and a bile acid sequestrant may be particularly efficacious for this form of hypercholesterolemia, especially because it appears to reverse the underlying cause of the high LDL cholesterol levels.

Although the current study extends our previous report defining the existence of hypercholesterolemia caused by cholesterol-enriched LDL particles and demonstrates an effective therapeutic approach to the condition, several important questions remain to be answered. The mechanisms underlying this form of hypercholesterolemia have not been defined. Neither have the mechanisms whereby the defect is corrected by the combination of a low fat diet and cholestyramine therapy been determined. A particularly important question is the relative atherogenicity of this type of hypercholesterolemia compared with those in which the number of LDL particles is increased. Thus, considering the relatively high frequency of hypercholesterolemia resulting from cholesterol-enriched LDL particles, further investigation is needed to resolve these questions.


*    Acknowledgments
 
This work was supported by the Department of Veterans Affairs; National Institutes of Health grants HL-29252, GM2178-27, and MO-IRR00633; unrestricted grants from Bristol-Myers Squibb, New Brunswick, NJ, and Merck & Co Inc, West Point, Pa; and the Southwestern Medical Foundation and the Moss Heart Foundation, Dallas, Tex. The authors express their appreciation for the excellent technical assistance of Biman Pramanik, Hahn Nguyen Tran, Han Tron, and Long Nguyen. The assistance of Marjorie Whelan, RN; Kathleen Gray, RN; Terri Shamway, RN; Sheryl Davis, RD; Sally Seubert, RN, MS; Regina Strowd, RN; and the clinical staff of the metabolic unit of the Veterans Affairs Medical Center also is greatly acknowledged. Questran Lyte and placebo for the study were kindly provided by the Bristol-Myer Squibb Co.


*    Footnotes
 
Reprint requests to Gloria Lena Vega, PhD, Center for Human Nutrition, Department of Clinical Nutrition, 5323 Harry Hines Blvd, Dallas, TX 75235-9052.

Received August 9, 1995; accepted January 3, 1996.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Vega GL, Denke MA, Grundy SM. Metabolic basis of primary hypercholesterolemia. Circulation. 1991;84:118-128. [Abstract/Free Full Text]
  2. Grundy SM. Multifactorial etiology of hypercholesterolemia: implications for prevention of coronary heart disease. Arterioscler Thromb. 1991;11:1619-1635. [Abstract/Free Full Text]
  3. Goldstein JL, Brown MS. Familial hypercholesterolemia. In: Stanbury JB, Wyngaarden JB, Fredrickson DS, Goldstein JL, Brown MS, eds. The Metabolic Basis of Inherited Disease. 5th ed. New York, NY: McGraw-Hill; 1983:672-713.
  4. Vega GL, Grundy SM. In vivo evidence for reduced binding of low density lipoproteins to receptors as a cause of primary moderate hypercholesterolemia. J Clin Invest. 1986;78:1410-1414.
  5. Innerarity TL, Weisgraber KH, Arnold KS, Mahley RW, Krauss RM, Vega GL, Grundy SM. Familial defective apolipoprotein B-100: low density lipoprotein binding. Proc Natl Acad Sci U S A. 1987;84:6919-6923. [Abstract/Free Full Text]
  6. Soria LF, Ludwig EH, Clarke HR, Vega GL, Grundy SM, McCarthy BJ. Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci U S A. 1990;86:587-591.
  7. Innerarity TL, Mahley RW, Weisgraber KH. Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia. J Lipid Res. 1990;31:1337-1349. [Abstract]
  8. Arca M, Vega GL, Grundy SM. Hypercholesterolemia in postmenopausal women: metabolic defects and response to low-dose lovastatin. JAMA. 1994;271:453-459. [Abstract]
  9. Dreon DM, Vranizan KM, Krauss RM, Austin MA, Wood PD. The effects of polyunsaturated fat vs monounsaturated fat on plasma lipoproteins. JAMA. 1990;263:2462-2466. [Abstract]
  10. Witztum J, Schonfeld G, Weideman SW, Geise WE, Dillingham MA. Bile sequestrant therapy alters the composition of low density and high density lipoproteins. Metabolism. 1979;28:221-229. [Medline] [Order article via Infotrieve]
  11. Young SG, Witztum JL, Carew TE, Krauss RW, Lindgren FT. Colestipol-induced changes in LDL composition and metabolism, II: studies in humans. J Lipid Res. 1989;30:225-238. [Abstract]
  12. Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. National Cholesterol Education Program: second report of the expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult Treatment Panel II). Circulation. 1994;89:1329-1445.
  13. Roeschlau P, Bernt E, Gruber W. Enzymatic determination of total cholesterol in serum. J Clin Chem Clin Biochem. 1974;12:226-227.
  14. Wahlefeld AW. Triglyceride determination after enzymatic hydrolysis. In: Bergmeyer HU, ed. Methods of Enzymatic Analysis. Vol 4, 2nd ed. New York, NY: Academic Press; 1974:1831-1835.
  15. Assmann G, Schriewer H, Schmitz G, Hagele E-O. Quantification of high-density lipoprotein cholesterol by precipitation with phosphotungstic acid/MgCl2. Clin Chem. 1983;29:2026-2030. [Abstract/Free Full Text]
  16. Abate N, Vega GL, Grundy SM. Variability in cholesterol content and physical properties of lipoproteins containing apolipoprotein B-100. Atherosclerosis. 1993;104:159-171. [Medline] [Order article via Infotrieve]
  17. Vega GL, Grundy SM. Quantitation of apolipoprotein B by chemical methods. In: Gianturco S, Bradley W, eds. Methods of Enzymology. Vol 263. San Diego, Calif: Academic Press Inc; 1996.
  18. Miller NE, Clifton-Bligh P, Nestel PJ. Effects of colestipol, a new bile-acid sequestering resin on cholesterol metabolism in man. J Lab Clin Med. 1973;81:876-890. [Medline] [Order article via Infotrieve]
  19. Markwell MAK, Haas SM, Tolbert NE, Bieber LL. Protein determination in membrane and lipoprotein samples: manual and automated procedures. In: Methods in Enzymology. New York, NY: Academic Press; 1981:296-303.
  20. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265-275. [Free Full Text]
  21. Hansen PS, Rudiger N, Tybjaerg-Hansen A, Faergeman O, Gregersen N. Detection of the apoB-3500 mutation (glutamine for arginine) by gene amplification and cleavage with MspI. J Lipid Res. 1991;32:1229-1233.[Abstract]
  22. Rudel LL, Pitts LL, Nelson CA. Characterization of plasma low density lipoproteins in nonhuman primates fed dietary cholesterol. J Lipid Res. 1977;18:211-222. [Abstract]
  23. Johnson FL, St. Clair RW, Rudel LL. Effects of the degree of saturation of dietary fat on the hepatic production of lipoproteins in the African green monkey. J Lipid Res. 1985;26:403-417. [Abstract]
  24. Vega GL, Grundy SM. Occurrence of species of low-density lipoprotein with defective clearance in patients with primary moderate hypercholesterolemia. J Intern Med. 1992;232:405-413. [Medline] [Order article via Infotrieve]
  25. Tato F, Vega GL, Tall AR, Grundy SM. Relation between cholesterol ester transfer protein activities and lipoprotein cholesterol in patients with hypercholesterolemia and combined hyperlipidemia. Arterioscler Thromb Vasc Biol. 1995;15:112-120. [Abstract/Free Full Text]
  26. Campos H, Roederer GO, Lussier-Cacan S, Davignon J, Krauss RM. Predominance of large LDL and reduced HDL2 cholesterol in normolipidemic men with coronary artery disease. Arterioscler Thromb Vasc Biol. 1995;15:1043-1048. [Abstract/Free Full Text]
  27. Fisher W. Heterogeneity of plasma low density lipoprotein manifestation of physiologic phenomenon in man. Metabolism. 1983;32:283-291. [Medline] [Order article via Infotrieve]
  28. Teng B, Thompson GR, Sniderman AD, Forte TM, Krauss RW, Kwiterovich PO Jr. Composition and distribution of low density lipoprotein fraction in hyperapobetalipoproteinemia, normolipidemia and familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1983;80:6662-6666. [Abstract/Free Full Text]
  29. Shen MM, Krauss RM, Lindgren FT, Forte TM. Heterogeneity of serum low density lipoprotein in normal human subjects. J Lipid Res. 1981;22:236-244. [Abstract]
  30. Campos H, Willett WC, Peterson RM, Siles X, Bailey SM, Wilson PWF, Posner BM, Ordovas JM, Schaefer EJ. Nutrient intake comparisons between Framingham and rural and urban Puriscal, Costa Rica. Arterioscler Thromb. 1991;11:1089-1099. [Abstract/Free Full Text]
  31. Denke MA, Grundy SM. Individual responses to a cholesterol-lowering diet in fifty men with moderate hypercholesterolemia. Arch Intern Med. 1994;154:317-325. [Abstract]
  32. Denke MA. Individual responsiveness to a cholesterol-lowering diet in postmenopausal women with moderate hypercholesterolemia. Arch Intern Med. 1994;154:1977-1982. [Abstract]
  33. Spritz N, Mishkel MA. Effects of dietary fats on plasma lipids and lipoproteins: a hypothesis for the lipid-lowering effect of unsaturated fatty acids. J Clin Invest. 1969;48:78-86.
  34. Vega GL, Groszek E, Wolf R, Grundy SM. Influence of polyunsaturated fats on composition of plasma lipoproteins and apolipoproteins. J Lipid Res. 1982;23:811-822. [Abstract]
  35. Mattson FH, Grundy SM. Comparison of effects of dietary saturated, monounsaturated, and polyunsaturated fatty acids on plasma lipids and lipoproteins in man. J Lipid Res. 1985;26:194-202. [Abstract]
  36. Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res. 1993;34:1637-1659. [Medline] [Order article via Infotrieve]
  37. Knittle JL, Ahrens EH Jr. Carbohydrate metabolism in two forms of hyperglyceridemia. J Clin Invest. 1964;43:485-495.
  38. Grundy SM. Comparison of monounsaturated fatty acids and carbohydrates for lowering plasma cholesterol. N Engl J Med. 1986;314:745-748. [Abstract]
  39. Grundy SM, Florentin L, Nix D, Whelan MF. Comparison of monounsaturated fatty acids and carbohydrates for reducing levels of plasma cholesterol in man. Am J Clin Nutr. 1988;47:965-969. [Abstract/Free Full Text]
  40. Nestel PJ, Grundy SM. Changes in plasma triglyceride metabolism during withdrawal of bile. Metabolism. 1976;25:1259-1268. [Medline] [Order article via Infotrieve]
  41. Beil U, Crouse JR, Einarsson K, Grundy SM. Effects of interruption of the enterohepatic circulation of bile acids on the transport of very low density-lipoprotein triglycerides. Metabolism. 1982;31:438-444. [Medline] [Order article via Infotrieve]
  42. Angelin B, Einarsson K, Hellstrom K, Leijd B. Effects of cholestyramine and chenodeoxycholic acid on the metabolism of endogenous triglyceride in hyperlipoproteinemia. J Lipid Res. 1978;19:1017-1024. [Abstract]
  43. Rudling MJ, Reihner E, Einarsson K, Ewerth S, Angelin B. Low density lipoprotein receptor-binding activity in human tissues: quantitative importance of hepatic receptors and evidence for regulation of their expression in vivo. Proc Natl Acad Sci U S A. 1990;87:3469-3473. [Abstract/Free Full Text]
  44. Grundy SM, Vega GL. Influence of mevinolin on metabolism of low density lipoproteins in primary moderate hypercholesterolemia. J Lipid Res. 1985;26:1464-1475.[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vega, G. L.
Right arrow Articles by Grundy, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vega, G. L.
Right arrow Articles by Grundy, S. M.

ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search
Copyright © 1996 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited.