Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1996;16:1416-1423

This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moriyama, K.
Right arrow Articles by Arakawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moriyama, K.
Right arrow Articles by Arakawa, K.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1996;16:1416-1423.)
© 1996 American Heart Association, Inc.


Articles

A Cysteine-Containing Truncated Apo A-I Variant Associated With HDL Deficiency

Kengo Moriyama; Jun Sasaki; Yoichi Takada; Akira Matsunaga; Jun Fukui; John J. Albers; Kikuo Arakawa

the Department of Internal Medicine (K.M., J.S., Y.T., A.M., K.A.), Fukuoka (Japan) University, School of Medicine; Sasebo General Hospital (J.F.), Nagasaki, Japan; and the Department of Medicine (J.J.A.), University of Washington, Northwest Lipid Research Laboratories, Seattle.

Correspondence to Jun Sasaki, MD, Department of Internal Medicine, Fukuoka University, School of Medicine, 45-1, 7-chome Nanakuma, Jonan-Ku, Fukuoka, 814-80, Japan.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
We identified a 50-year-old Japanese woman with a novel mutation in the apolipoprotein (apo) A-I gene causing high-density lipoprotein (HDL) deficiency. The patient had extremely low HDL cholesterol and apo A-I levels (0.14 mmol/L and 0.8 mg/dL, respectively) but no evidence of coronary heart disease. However, she had bilateral xanthomas of the Achilles tendon, elbow, and knee joint as well as corneal opacities. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis of serum followed by immunoblotting revealed that the patient's apo A-I had a lower molecular weight (24 000) than normal apo A-I. A partial gene duplication encompassing 23 nucleotides was found by DNA sequence analysis, resulting in a tandem repeat of bases 333 to 355 from the 5' end of exon 4. This tandem repeat caused a frameshift mutation with premature termination after amino acid 207. The frameshift gives rise to a predicted protein sequence that contains two cysteines. We designated this mutant as apo A-ISasebo. Apo A-ISasebo formed heterodimers with apo A-II and apo E in the patient's plasma and was associated with both the low-density lipoprotein and HDL fractions. The patient's cholesterol esterification rate and lecithin-cholesterol acyltransferase activity were reduced to about 30% of normal, although specific enzyme activity was unaffected, suggesting that it remained functionally normal. In addition, cholesteryl ester transfer activity was reduced to about half of normal. Thus, apo A-ISasebo was associated with complex derangements of lipoprotein metabolism.


Key Words: genetics • lipoproteins • apo E • apo A-II • atherosclerosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Apo A-I is a single polypeptide chain composed of 243 amino acid residues and has a molecular weight of 28 000.1 2 The apo A-I gene has been localized to chromosome 11 (11q 13-qter), where it forms part of a cluster with the apo C-III and apo A-IV genes.3 4 5 Apo A-I plays an important role in nascent HDL, since it promotes the efflux of cholesterol from tissues6 and serves as a cofactor for LCAT.7 The plasma HDL cholesterol concentration shows an inverse correlation with the risk of CHD,8 9 10 11 12 but the mechanism underlying the protective effect of HDL remains poorly understood. Several HDL deficiency syndromes have been studied in attempts to clarify the cardioprotective effect of this lipoprotein. A number of kindreds with hereditary analphalipoproteinemia are known to have defects of the apo A-I gene13 14 15 16 17 18 19 20 21 22 23 that result in the virtual absence of plasma HDL. In some other kindreds, the molecular defect either does not involve the apo A-I gene24 25 or is yet to be identified.26 27 28 29 Despite the almost complete absence of HDL in some kindreds, there is marked variation in the susceptibility to premature CHD. Possible reasons for this include the small number of individuals studied in each kindred, associated deficiencies of other apolipoproteins,14 15 16 17 and abnormal circulating apo A-I variants.19 20 Therefore, it is necessary to investigate individuals with isolated apo A-I deficiency to minimize potential confounding factors. In this article, we report a patient with a structural mutation of the apo A-I gene that caused isolated apo A-I deficiency associated with multiple xanthomas, corneal opacities, and partial LCAT deficiency.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Proband
The proband was a 50-year-old Japanese woman who was found to have a very low plasma HDL cholesterol level on testing at Sasebo General Hospital. She first noted the presence of xanthomas when she was 9 years old. She had no history of diabetes mellitus, hypertension, or any symptoms suggesting coronary or vascular insufficiency. There was no history of cigarette smoking or alcohol use. On physical examination, she was 152 cm tall and weighed 57.5 kg (body mass index, 24.9 kg/m2). She had bilateral upper palpebral xanthomas as well as xanthomas on elbows, neck, knees, and Achilles tendons. She also had corneal opacities, but funduscopic examination revealed no retinal angiosclerosis. The fasting glucose, glycosylated hemoglobin, serum electrolytes, liver function parameters, serum protein electrophoresis, and thyroid function data were all within normal limits. Both the resting electrocardiogram and the double Master two-step test were normal. Echocardiography revealed no structural or wall motion abnormalities.

The pedigree of the proband's family is shown in Fig 1Down. Neither her mother (I 2) nor her three children (III 1, III 2, and III 3) had corneal opacities or xanthomas. Her two brothers (II 1 and II 2) and younger sister (II 4) also had xanthomas by history. Her brother (II 1) died suddenly of unknown causes when he was 55 years old.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Pedigree of the apo A-ISasebo family. Arrow indicates the proband.

Plasma Lipoprotein Characterization
Blood was collected into tubes containing Na2 EDTA after a 12-hour fast. Lipoproteins were isolated by sequential ultracentrifugation to obtain the following density fractions: VLDL (density, <1.019 g/mL), LDL (1.019 to 1.063 g/mL), and HDL (1.063 to 1.21 g/mL).30 Plasma cholesterol and triglyceride concentrations were determined by enzymatic methods.30 HDL cholesterol was quantified by the heparin-manganese precipitation method.30 Apo A-II, B, C-II, C-III, and E concentrations were measured by single radial immunodiffusion,31 and the ELISA was performed as described in "ELISA for Apo A-I." The plasma Lp(a) was determined by ELISA (Terumo Medical Co).32 The apo E phenotype was determined by isoelectric focusing followed by immunoblotting, as described previously.33 The apo E genotype was determined using Hha I digestion of the apo E gene after amplification by PCR, as described previously.33 Gender- and age- matched normolipidemic healthy volunteers were used as normal control subjects.

ELISA for Apo A-I
The ELISA for apo A-I was based on the assay developed by Koren et al.34 Microtiter plates (Dynatech Laboratories Inc) were first coated with 100 µL of a rabbit anti-human apo A-I antibody (50 µg/mL) by incubation for 18 hours at 25°C. After the coating buffer was removed, 300 µL of 5% (wt/vol) bovine serum albumin in 10 mmol/L PBS (pH 7.4) was added, and incubation was done overnight at 4°C. Then calibrators, controls, and samples (100 µL) were added to the blocked wells and incubated for 18 hours at 4°C, after which the wells were washed four times with 300 µL of PBS containing 0.1% Tween 20. Next, 100 µL of horseradish peroxidase–labeled rabbit anti-human apo A-I (The Binding Site Ltd) diluted 5000-fold in phosphate buffer was added to each well, and incubation was done for 5 hours at 25°C. The wells were washed, color was developed by adding o-phenylenediamine, and a standard curve was generated by plotting the absorbance at 492 nm versus the apo A-I concentration.

Electroimmunoblot Analysis
Isoelectric focusing–gel electrophoresis was performed by the one-step screening method,35 after which apo A-I was identified by immunoblotting.36 SDS-PAGE of serum was performed according to the standard technique.37 To identify mutant apo A-I heterodimers, SDS-PAGE under nonreduced conditions was also done. After electroblotting onto nitrocellulose membranes (Hybond-ECL, Amersham Life Science), an anti–apo A-I monoclonal antibody (O.E.M. Concepts Inc) and an anti–apo A-II monoclonal antibody (Shybayagi Co) were bound to the immobilized antigens. ECL Western blotting detection reagents (Amersham Life Science) were used for visualization.

DNA Amplification by PCR
Genomic DNA was isolated from 100 µL of peripheral blood according to a previously described method.36 Synthetic oligonucleotide primers were produced with a DNA synthesizer (model 380B, Applied Biosystems, Inc) by the phosphoramide method according to the manufacturer's instructions. The PCR was performed by using a modification of the protocol published by Perkin-Elmer Cetus Instruments. The reaction mixture consisted of 20 µL of genomic DNA, 10 µL of 10x reaction buffer (100 mmol/L Tris-HCl [pH 8.3], 500 mmol/L KCl, 15 mmol/L MgCl2, and 0.1% [wt/vol] gelatin), 16 µL of 1.25 mmol/L dNTPs (dATP, dCTP, dTTP, and dGTP), and 20 pmol of each primer in a volume of 100 µL. The mixture was incubated at 95°C for 10 minutes and centrifuged briefly, after which 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus) was added, and the mixture was layered under 100 µL of mineral oil. Fig 2Down shows a diagram of the apo A-I gene with the locations and directions of the three pairs of primers used in the PCR: 1 and 2 (255 bp), 3 and 4 (508 bp), and 5 and 6 (762 bp). Amplification was performed by 35 cycles of denaturation at 94°C for 1 minute, annealing at 60°C for 2 minutes, and extension at 72°C for 1.5 minutes in a Perkin-Elmer Cetus Thermocycler (model PJ 1000).



View larger version (8K):
[in this window]
[in a new window]
 
Figure 2. Oligonucleotide primers for PCR amplification and diagram of the apo A-I gene with the locations and directions of the PCR primers indicated by arrows below the bar. Hatched and open boxes represent exons and introns, respectively. Primers are as follows: 1 (20-mer), 5'-GCTTGCTGTTTGCCCACTCT-3'; 2 (23-mer), 5'-GGGCAAGGCCTGAACCTTGAGCT-3'; 3 (22-mer), 5'-TCACCTGGCTGCAATGAGTGGG-3'; 4 (24-mer), 5'-TCAACATCATCCCACAGGCCTCT-3'; 5 (23-mer), 5'-GTGTACTGGAAATGCTAGGCCAC-3'; and 6 (23-mer), 5'-TCGTTTATTCTGAGCACCGGGAAT-3'.

DNA Sequence Analysis
The PCR-amplified DNA was purified with Geneclean (Bio 101), and a 1-µL aliquot of the first reaction mixture was reamplified as described above with a 100:1 ratio of the same primers.38 Then the single-stranded DNA from the second PCR was sequenced by the dideoxynucleotide chain termination method using Sequenase (United States Biochemical Co). Regions with strong secondary structures were sequenced after being subcloned into the vectors pUC118 and pUC119, with 12 clones being sequenced by the above-mentioned method. All sequences were determined on both strands, and the region containing the mutation was sequenced in duplicate with separately amplified DNAs.

Identification of the Apo A-I Mutation
PCR was performed to identify the apo A-I mutation in the proband's family. Genomic DNA was amplified with two oligonucleotide primers: 5' GCCCTACCTGGACGACTTC 3' (bases 1841 to 1859) and 5' TCAGGAAGCTGACCTTGAAGCTC 3' (bases 2216 to 2238). Nucleotide numbers are based on the published sequence for apo A-I DNA.39 The PCR was performed for 35 cycles using Taq DNA polymerase (Perkin-Elmer Cetus) under the following conditions: 30 seconds at 96°C, 30 seconds at 65°C, and 1 minute at 72°C. Then PCR products were purified using Geneclean (Bio 101) and sequenced as described above. A 5 µL aliquot of the purified PCR product was subjected to electrophoresis on 5% agarose gel and visualized with ethidium bromide staining.

Plasma Distribution of Apo A-ISasebo
Plasma from normal control subjects and the proband (200 µL) was subjected to chromatography on a Superose 6HR10/30 column (Pharmacia Fine Chemicals) equilibrated with PBS containing 1 mmol/L EDTA and 0.02% NaN3 (pH 7.4) and eluted at a flow rate of 0.5 mL/min. Fifty fractions of 0.5 mL were collected, and the cholesterol content of each fraction was measured enzymatically.30 Electrophoresis of lipoproteins from plasma density fractions was performed using 12.5% SDS-polyacrylamide gels,37 and the distributions of normal apo A-I and apo A-ISasebo were visualized with an ECL Western blotting (Amersham Life Science).

Nondenaturing Gradient PAGE
The HDL particle size was determined by nondenaturing gradient PAGE using precast 4% to 30% gels (Pharmacia LKB Biotechnology).40 Plasma with a density of <1.20 g/mL was obtained by centrifugation at 100 000 rpm for 4 hours (Beckman TL-100 ultracentrifuge). To visualize the particles, 10 to 15 mg of protein was applied to the gel. Protein was stained with 0.05% Coomassie brilliant blue G-250, and the gel was scanned with a Personal Densitometer SI (Molecular Dynamics, Inc). The gel was calibrated with a standard protein mixture (HMW calibration kit, Pharmacia LKB Biotechnology) consisting of thyroglobulin (hydrated particle size, 17.0 nm), ferritin (12.2 nm), lactate dehydrogenase (8.16 nm), and bovine serum albumin (7.1 nm). HDL particle size was calculated from the calibration curve of the peak migration distance versus that of the standard.

Determination of LCAT Activity and CER
Serum LCAT activity was determined with proteoliposomes used as a substrate, as described previously.41 Egg yolk phosphatidylcholine/cholesterol liposomes were prepared by ethanol injection. Each assay mixture contained 2.25 nmol of 7{alpha}-[3H]cholesterol (22 Ci/mmol) (Du Pont-New England Nuclear) and 4.5 µg of purified human apo A-I. The molar ratio of cholesterol to phosphatidylcholine was 1:6. The esterification rate was measured by incubation of plasma (0.039 mL) with a mixture of 0.7 mmol/L EDTA, 4 mmol/L ß-mercaptoethanol, and 1% bovine serum albumin (essentially fatty acid free) for 2 hours at 37°C in a final volume of 0.0625 mL. The reaction was stopped by addition of 0.625 mL of a chloroform/methanol (2:1) mixture, followed by incubation for 2 hours at room temperature in order to extract the lipids. Labeled cholesterol ester was separated by thin-layer chromatography on silica gel plates (E. Merck) using a mobile phase consisting of petroleum ether/diethyl ether/acetic acid (20:0.6:0.2), and the radioactivity was counted by liquid scintillation spectrometry.

The CER was defined as the rate of esterification of cholesterol contained within the endogenous lipoproteins of plasma and was comparable to the total plasma LCAT activity. Plasma was equilibrated with 7{alpha}-[3H]cholesterol at 4°C in a precooled 24-well plate42 43 and then incubated for 18 hours at 4°C to achieve radiolabeling. The radiolabeled plasma was then incubated for 6 hours at 37°C, and the reaction was stopped by adding 0.45 mL of a chloroform/methanol mixture (2:1 [vol/vol]). Labeled cholesterol and cholesteryl ester were separated by thin-layer chromatography, as described above, and the radioactivity associated with cholesterol and cholesteryl ester was determined with a liquid scintillation counter.

LCAT Mass
The LCAT mass was measured by radioimmunoassay using a polyclonal antibody and 125I-labeled LCAT, as described previously.44

Measurement of CETP Activity
Plasma CETP activity was analyzed by the method of Tollefson and Albers.45 Radiolabeled HDL3 was prepared from the plasma fraction (density, >1.125 g/mL) isolated from a normolipidemic control subject by incubation with [14C]cholesterol (58.0 mCi/mmol) (Du Pont-New England Nuclear) for 18 hours at 37°C. The [14C]cholesterol ester/HDL3 substrate was then isolated at a density of 1.21 g/mL by ultracentrifugation (40 000 rpm for 40 hours at 4°C). The contents of the upper one third of each tube were harvested by slicing the tube, and the solution was dialyzed. The reisolated HDL3 contained >90% of the radioactivity in the cholesteryl ester fraction, as determined by thin-layer chromatography. CETP activity was measured using a 10 µL aliquot of plasma with 50 µg of radiolabeled HDL3 and 250 µg of acceptor lipoproteins (density, <1.060 g/mL plasma fraction). The mixture was diluted to a final volume of 600 µL with 150 mmol/L NaCl and 10 mmol/L Tris-HCl (pH 7.4) and incubated for 18 hours at 37°C. Then 0.125 mL of heparin/MgCl2 reagent was added to aliquots of the mixture, and 750 µL of each supernatant (HDL) was transferred to 20-mL plastic counting vials. After 6 mL of scintillant (Insta-gel, Packard Instrument Co Inc) was added, the samples were counted in a liquid scintillation counter.

Statistical Analysis
Lipoprotein, apolipoprotein, and lipid values of control subjects and heterozygous members of the kindred were analyzed for significant differences with the paired t test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Lipoprotein Analysis
Table 1Down summarizes the serum lipoprotein and apolipoprotein concentrations in the proband, her mother, her sons, and her daughter. The proband had severe deficiency of HDL cholesterol and apo A-I. Her mother, her daughter, and her two sons had reduced plasma total cholesterol concentrations and plasma HDL concentrations (47% to 62% of the level in normal control subjects), and their plasma apo A-I concentrations were about 50% of normal. The proband also had a markedly reduced plasma apo A-II concentration, whereas the other family members had slightly reduced plasma apo A-II levels. Both the proband and the other family members had reduced plasma apo C-II concentrations. The mean values of total cholesterol, HDL cholesterol, apo A-I, and apo C-II concentrations in her mother, her sons, and her daughter were significantly lower compared with normal control values. No blood samples from the proband's two brothers (II 1 and II 2) and younger sister (II 4) were available to analyze their serum lipoprotein and apolipoprotein concentrations.


View this table:
[in this window]
[in a new window]
 
Table 1. Lipoprotein and Apolipoprotein Concentrations of the Proband's Family

Electroimmunoblot Analysis
Agarose gel electrophoresis of plasma from the proband showed the complete absence of an {alpha}-migrating band (data not shown). Isoelectric focusing of plasma at a pH gradient of 4 to 6 followed by immunoblotting revealed no detectable apo A-I band in the proband. In contrast, samples from her mother, daughter, and two sons showed bands of proapo A-I (A-I 2) and apo A-I 4 and A-I 5 (Fig 3Down). SDS-PAGE of serum followed by immunoblotting showed that the proband's apo A-I had a lower molecular weight (24 000) than native apo A-I and that the other family members exhibited apo A-I at both normal and lower molecular weights (Fig 4Down).



View larger version (65K):
[in this window]
[in a new window]
 
Figure 3. Isoelectric focusing–gel electrophoresis of plasma followed by immunoblotting was performed at pH 4 to 6. Lanes are as follows: 1, normal control; 2, proband (II 3); 3, husband; 4, daughter (III 1); 5, son 1 (III 2); 6, son 2 (III 3); and 7, mother (I 2).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 4. SDS-PAGE of serum, followed by immunoblotting with a rabbit anti-human apo A-I polyclonal antibody. Lanes are as follows: 1, normal control; 2, apo A-ISasebo homozygote (proband, II 3); and 3, apo A-ISasebo heterozygote.

DNA Sequence Analysis
Each DNA sequence encompassing an exon and exon-intron boundary of the apo A-I gene was amplified with the primers shown in Fig 2Up. The amplified DNAs were used to generate single-stranded DNA from the second PCR or were cloned in vectors pUC118 and pUC119. Amplified DNA of exon 4 was cloned in both vectors, with 12 independent clones being isolated and sequenced. A partial gene duplication encompassing 23 nucleotides was found in all 12 clones, which produced a tandem repeat of bases 333 to 355 from the 5' end of the exon 4 (Fig 5Down). The tandem repeat generated a frameshift and a stop codon (TGA) at amino acid position 208 (Fig 6Down). No other substitutions were found.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 5. Nucleotide sequence of a portion of the sense strand from exon 4 of a normal subject (left lanes) and the proband (right lanes). The bold bar indicates a tandem duplication of 23 nucleotides in the apo A-ISasebo allele. The dotted line indicates the portion of the native apo A-I sequence that matches the tandem duplication in apo A-ISasebo.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. Diagram of the portion of the apo A-I gene showing the 23-nucleotide insertion, leading to a frameshift mutation and premature termination in exon 4. The amino acid sequences of a section of exon 4 from a normal subject and the proband are illustrated, and the inserted nucleotides are indicated by a bar. Numbers on top of the sequence indicate the amino acid residues of native apo A-I.

Determination of the Apo A-ISasebo Status
Fig 7Down shows representative agarose gel electrophoresis patterns of the PCR products from the proband with apo A-ISasebo (lane 2) and her family members (lanes 3 to 6). The PCR product of the proband had a band with a higher molecular weight (421 bp) than that of the normal control subject (398 bp), whereas PCR products from the other family members had bands of both the higher and normal molecular weights. Sequence analysis of the abnormal band in samples from the family members revealed a 23-nucleotide partial gene duplication that produced a tandem repeat of bases 333 to 355 from the 5' end of exon 4, as described above. These results indicated that the proband was homozygous and her family members were heterozygous for the apo A-ISasebo mutation. No blood samples from the proband's two brothers (II 1 and II 2) and younger sister (II 4) were available to determine the apo A-ISasebo status.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 7. Agarose gel electrophoresis of the PCR products from a normal control (lane 1), the apo A-ISasebo proband (II 3, lane 2), her daughter (III 1, lane 3), her sons (III 2 and III 3, lanes 4 and 5, respectively), and her mother (I 2, lane 6). M represents a molecular weight marker, {phi}X174/HinfI digest.

Detection of Apo A-ISasebo/Apo A-II and Apo A-ISasebo/Apo E Complexes
Apo A-ISasebo contained 207 instead of 243 amino acids, with residues 162 to 207 differing from the sequence of normal apo A-I. The molecular weights of normal apo A-I and apo A-ISasebo were 28 000 and 24 000, respectively, on the basis of the results of immunoblotting. Apo A-ISasebo was found to contain two cysteine residues that were absent from normal apo A-I (Fig 6Up), and cysteine residues can mediate association with other cysteine-containing proteins. To investigate whether the mutant apo A-I formed complexes with other proteins, SDS-PAGE under nonreduced conditions was followed by immunoblotting with an anti–apo A-I monoclonal antibody, and proteins of a higher molecular weight were identified (Fig 8ADown). The molecular weight of the thicker band was consistent with an apo A-ISasebo/apo A-II/apo A-II heterotrimer, whereas the less intense band just underneath it was consistent with an apo A-ISasebo/apo A-II heterodimer, neither of which was observed in bands from normal control subjects. SDS-PAGE under nonreduced conditions followed by immunoblotting with an anti–apo E antibody showed that specimens from the homozygous proband contained a band consistent with an apo A-ISasebo/apo E heterodimer that was not observed in normal control subjects (Fig 8BDown).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 8. Characterization of apo A-ISasebo by SDS-PAGE under nonreduced conditions, followed by immunoblotting with anti–apo A-I (left lanes) and anti–apo A-II (right lanes) monoclonal antibodies (A) and an anti–apo E polyclonal antibody (B). An amount of applied serum sample in the proband was about 100 times that in normal control. Lanes are as follows: 1, normal control; 2, proband (apo A-ISasebo homozygote). Native apo A-I (A-I), apo A-ISasebo (A-ISasebo), apo A-ISasebo/apo A-II/apo A-II heterotrimer (A-ISasebo/A-II/A-II), apo A-ISasebo/apo A-II heterodimer (A-ISasebo/A-II), apo A-II homodimer (A-II), apo A-ISasebo/apo E heterodimer (A-ISasebo/E), and apo E monomer (E) are indicated by the arrows. A-ISasebo/A-II/A-II, A-ISasebo/A-II, and A-ISasebo/E were observed in the proband's plasma but not in the plasma of the normal subject.

Plasma Distribution of Apo A-ISasebo
Because the plasma concentration of apo A-ISasebo was very low but present in the proband, the distribution of this mutant apo A-I in the various lipoprotein fractions was determined. As shown in Fig 9Down, apo A-I from a normal control subject was mainly associated with the HDL fraction, whereas apo A-ISasebo was found in both the LDL and HDL fractions. This shift of apo A-ISasebo into the LDL fraction could have important metabolic consequences.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 9. Plasma distribution of normal apo A-I and apo A-ISasebo. The graph shows gel filtration elution profiles. Open and closed circles denote samples from normal subject and apo A-ISasebo proband, respectively. In the inset, each lipoprotein fraction was subjected to SDS-PAGE followed by immunoblotting with an anti–apo A-I monoclonal antibody. Data were representative of three experiments.

Nondenaturing Gradient PAGE
Gradient gel electrophoresis of HDL particles separated by ultracentrifugation followed by scanning with a Personal Densitometer SI (Molecular Dynamics, Inc) is shown in Fig 10Down. In the homozygous proband, the HDL fraction could barely be observed. In the heterozygous family members, the HDL particle size was smaller than in the normal control subject.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 10. HDL particle size profiles. Densitometric scanning was performed after nondenaturing 4% to 30% PAGE of HDL isolated from the proband homozygous for apo A-ISasebo (top), a heterozygous family member (center), and a normal subject (bottom). The HDL subpopulation intervals are shown below the scan profile.

LCAT Activity, LCAT Mass, CER, and CETP Activity
Table 2Down shows the LCAT activity, LCAT mass, CER, and CETP activity in plasma from the proband (homozygote), four family members (heterozygotes), and normolipidemic healthy Japanese subjects. In the proband, the LCAT activity and the CER were reduced to about 30% of the control values; the LCAT mass was 37% of that in the normal control subjects. In the four family members, the LCAT activity and LCAT mass were reduced to about 70% of normal, and the CER was reduced to half of normal.


View this table:
[in this window]
[in a new window]
 
Table 2. Cholesterol Esterification Rate, LCAT Activity, LCAT Mass, and CETP Activity of the Proband's Family

Plasma CETP activity data for the proband, her family members, and normolipidemic healthy Japanese subjects are also shown in Table 2Up. In the proband, CETP activity was reduced to about half of the control level. However, the four family members showed only a slight decrease of CETP activity.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We identified a Japanese family with a novel 23-bp insertion in the apo A-I gene, which we designated as apo A-ISasebo. The homozygous proband had markedly decreased but detectable levels of apo A-I and HDL cholesterol, whereas the other family members (who were heterozygous for the defect) had intermediate apo A-I and HDL cholesterol levels. These findings suggest that the genetic trait was transmitted in an autosomal-dominant fashion.

LCAT activity for the proband (homozygote) was reduced to about 30% of normal, and it was about 70% of normal in the heterozygous family members. In addition, the proband had a CER that was about 25% of normal. However, the magnitude of these differences suggests that the markedly reduced serum apo A-I and HDL cholesterol concentrations found in the proband are not the result of familial LCAT deficiency.41 46 47 48 Clinically, the proband showed no hyperplastic orange tonsils, splenomegaly, or relapsing neuropathy, which are the major clinical signs of Tangier disease.29

On physical examination, the proband of apo A-ISasebo had corneal opacities and extensive xanthomas. Although genotypes were not yet examined, her two brothers (II 1 and II 2) and younger sister (II 4) also had xanthomas. Previous reports have indicated that there is some heterogeneity in the phenotype of apo A-I deficiency. Patients with apo A-I deficiency as a result of a 1-base insertion in exon 3 of the apo A-I gene22 or patients with apo A-I Q[-2]x23 have both corneal opacities and xanthomas like the proband, but a patient with a 1-base deletion (G at position 202) developed only corneal opacities,19 and a nonsense mutation caused CHD and xanthomas in another patient.18 Possible explanations for this heterogeneity may include the influence of environmental factors and/or interactions with other unknown genetic defects.

Most patients with apo A-I deficiency, including our proband, do not show an increased susceptibility to the development of CHD, despite previous epidemiological evidence that the plasma HDL concentration is inversely correlated with the risk of CHD.8 9 10 11 12 Although our patient had a slightly elevated Lp(a) concentration (49 mg/dL), her serum LDL cholesterol level was near the median value in age- and sex-matched normal Japanese individuals. No other known risk factors for CHD were present in this patient. The serum LDL cholesterol concentrations reported in other patients with apo A-I deficiency vary widely over the range from 3.8 to 5.2 mmol/L. Nondenaturing gradient PAGE revealed that the heterozygous relatives of our proband had HDL particles that were smaller than normal. If the proband also had small HDL particles, this could provide a possible explanation for the lack of CHD, along with enhanced catabolism of mutant apo A-I. This hypothesis is supported by a recent report that the fractional catabolic rates of recombinant carboxy-terminal truncation mutants are much faster than those of recombinant intact apo A-I and native human apo A-I.49 The reason for the absence of CHD in most of the patients with apo A-I deficiency is still not clear.

Some other genetic disorders also cause severe HDL deficiency.13 14 15 16 The biochemical profiles and clinical manifestations of combined apo A-I/apo C-III deficiency and apo A-I/apo C-III/apo A-IV deficiency resemble those of our proband, except for the presence of CHD. However, it is unclear why the addition of apo C-III and/or apo A-IV deficiency to apo A-I deficiency leads to an increase of CHD.

The mechanism leading to HDL deficiency in association with apo A-ISasebo was analyzed. The smaller molecular weight (24 000) apo A-I demonstrated by SDS-PAGE was compatible with the findings of DNA sequence analysis. The 46 amino acids of apo A-ISasebo created by the 23-bp insertion (amino acid residues 162 to 207) are not part of native apo A-I, and this insertion could cause significant alterations of protein conformation that could destabilize and inactivate the apo A-I molecule. Apo A-IMilano is associated with a low HDL cholesterol level50 51 52 and features the substitution of a cysteine for arginine at amino acid 173, a change that introduces a cysteine into a protein previously devoid of this residue. Apo A-IMilano forms homodimers as well as apo A-IMilano/apo A-II and apo A-IMilano/apo E complexes,53 and in vivo studies have revealed hypercatabolism of this mutant apo A-I.54 Mutant apo A-I/apo A-II heterodimers have also been observed in apo A-I deficiency.19 Thus, the formation of apo A-ISasebo/apo A-II/apo A-II, apo A-ISasebo/apo A-II, and apo A-ISasebo/apo E complexes, as noted in our family, could significantly alter HDL metabolism; it is still unclear just how these complexes are metabolized in the plasma. Moreover, the distribution of apo A-ISasebo into the LDL size range, which were likely to be HDL1 particles, was found. This shift of apo A-ISasebo into the LDL fraction could have important metabolic consequences, including apo A-ISasebo/apo E heterodimer formation.

The LCAT activity, LCAT mass, and CER were reduced in our proband, and similar findings have been reported in individuals with apo A-I/C-III deficiency15 and other types of apo A-I deficiency.19 One of the mechanisms underlying a reduced LCAT mass could be that apo A-I plays an important role in LCAT production and/or stability of the substrate for LCAT. A subclass of small HDL particles is reported to be the preferred substrate for LCAT.55 The apo A-ISasebo mutation was associated with a decrease in the number and size of HDL particles, and the reduced number of HDL particles may have provided a poor substrate for LCAT.

The CETP activity in our proband with apo A-ISasebo was about half of normal. In contrast, the transfer of preexisting and newly formed cholesteryl ester from HDL to apo B–containing lipoproteins is reported to be accelerated in apo A-I/apo C-III deficiency.56 This discrepancy may be due to different methods of determining CETP activity, but the specific CETP activity in apo A-ISasebo and the mechanism by which a decrease occurs remain to be determined.

In conclusion, we found that isolated apo A-I deficiency caused by a structural mutation in the apo A-I gene was associated with xanthomas, corneal opacities, and partial LCAT and CETP deficiency. Characterization of the molecular defect in this patient may help to provide a better understanding of apo A-I structure-function relationships and the clinical manifestations in patients with apo A-I deficiency.


*    Selected Abbreviations and Acronyms
 
bp = base pair(s)
CER = cholesterol esterification rate
CETP = cholesteryl ester transfer protein
CHD = coronary heart disease
ECL = enhanced chemiluminescence
ELISA = enzyme-linked immunosorbent assay
LCAT = lecithin-cholesterol acyltransferase
PAGE = polyacrylamide gel electrophoresis
PBS = phosphate-buffered saline
PCR = polymerase chain reaction
SDS = sodium dodecyl sulfate


*    Acknowledgments
 
This study was partly supported by grants from the Ministry of Health and Welfare (No. 00627437 to Dr Sasaki) and from the National Institutes of Health (HL-30086 to Dr Albers). We wish to thank Drs Yoshio Misumi and Shigenori Ogata (Fukuoka University) for their helpful technical advice. We also wish to thank Kayo Nishi for excellent technical assistance and Yuki Hashimoto for manuscript preparation.

Received March 4, 1996; revision received May 3, 1996;
*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Mahley RW, Innerarity TL, Rall SC, Weisgraber KH. Plasma lipoproteins: apolipoprotein structure and function. J Lipid Res.. 1984;25:1277-1294.[Abstract]

2. Brewer HB, Fairwell T, LaRue A, Ronan R, Houser A, Bronzert TJ. The amino acid sequence of human apo A-I, an apolipoprotein isolated from high density lipoproteins. Biochem Biophys Res Commun.. 1978;80:623-630.[Medline] [Order article via Infotrieve]

3. Bruns GAP, Karathanasis SK, Breslow JL. Human apolipoprotein A-I/C-III complex is located on chromosome 11. Arteriosclerosis.. 1984;4:97-102.[Abstract/Free Full Text]

4. Karathanasis SK. Apolipoprotein multigene family and tandem organization of human apolipoprotein A-I, C-III and A-IV genes. Proc Natl Acad Sci U S A.. 1985;82:6374-6378.[Abstract/Free Full Text]

5. Karathanasis SK, Zannis VI, Breslow JL. Isolation and characterization of the human apolipoprotein A-I gene. Proc Natl Acad Sci U S A.. 1983;80:6147-6151.[Abstract/Free Full Text]

6. Stein O, Stein Y. The removal of cholesterol from Landschutzascites cells by high-density lipoprotein. Biochim Biophys Acta.. 1973;326:232-244.[Medline] [Order article via Infotrieve]

7. Fielding CJ, Shore VG, Fielding P. A protein cofactor of lecithin:cholesterol acyltransferase. Biochem Biophys Res Commun.. 1972;46:1493-1498.[Medline] [Order article via Infotrieve]

8. Castelli WP. Cholesterol and lipids in the risk of coronary artery disease: the Framingham Heart Study. Can J Cardiol. 1988;4(suppl A):5A-11A.

9. Brunner D, Weisbort J, Meshulam N, Schwartz S, Gross J, Saltz-Rennert H, Altman S, Loebl K. Relationship of serum total cholesterol and high density lipoprotein cholesterol percentage to the incidence of definite coronary events: twenty year follow-up of Donolo-Tel Aviv prospective coronary artery disease study. Am J Cardiol.. 1987;59:1271-1276.[Medline] [Order article via Infotrieve]

10. Gordon DJ, Probstfield JL, Garrison RJ, Neaton JD, Castelli WP, Knobe JD, Jacobs DR Jr, Bangdiwala S, Taylor HA. High-density lipoprotein cholesterol and cardiovascular disease: four prospective American studies. Circulation.. 1989;79:8-15.[Abstract/Free Full Text]

11. Assmann G, Schulte H, Funke H, von Eckardstein A, Seedorf U. The prospective cardiovascular Munster (PROCAM) study: identification of high-risk individuals for myocardial infarction and the role of high-density lipoprotein. In: Miller NE, ed. High Density Lipoproteins and Atherosclerosis II. Amsterdam, Netherlands: Excerpta Medica. 1989;826:51-65.

12. Manninen V, Tenkanen L, Koskinen P, Huttunen JK, Mantari M, Heinonen OP, Frick MH. Joint effects of serum triglyceride and LDL cholesterol and HDL cholesterol concentrations on coronary heart disease risk in the Helsinki study. Circulation.. 1992;85:37-45.[Abstract/Free Full Text]

13. Norum RA, Lakier JB, Goldstein S, Angel A, Goldberg RB, Block WD, Noffze DK, Dolphin PJ, Edelglass J, Bogorad DD, Alaupovic P. Familial deficiency of apolipoproteins A-I and C-III and precocious coronary artery disease. N Engl J Med.. 1982;306:1513-1519.[Abstract]

14. Karathanasis SK, Ferris E, Haddad EA. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis. Proc Natl Acad Sci U S A.. 1987;84:7198-7202.[Abstract/Free Full Text]

15. Schaefer EJ, Ordovas JM, Law SW, Ghiselli G, Kashyap ML, Srivastava LS, Heaton WH, Albers JJ, Connor WE, Lindgren FT, Lemeshev Y, Segrest JP, Brewer HB Jr. Familial apolipoprotein A-I and C-III deficiency variant II. J Lipid Res.. 1985;26:1089-1101.[Abstract]

16. Ordovas JM, Cassidy DK, Civeira F, Bisgaier C, Schaefer EJ. Familial apolipoprotein A-I, C-III, and A-IV deficiency and premature atherosclerosis due to deletion of a gene complex on chromosome 11. J Biol Chem.. 1989;264:16339-16342.[Abstract/Free Full Text]

17. Hiasa Y, Maeda T, Mori H. Deficiency of apolipoproteins A-I and C-III and severe coronary heart disease. Clin Cardiol.. 1986;9:349-352.[Medline] [Order article via Infotrieve]

18. Matsunaga T, Hiasa Y, Yanagi H, Maeda T, Hatori N, Yamakawa K, Yamanouchi Y, Tanaka I, Obara T, Hamaguchi H. Apolipoprotein A-I deficiency due to a codon 84 nonsense mutation of the apolipoprotein A-I gene. Proc Natl Acad Sci U S A.. 1991;88:2793-2797.[Abstract/Free Full Text]

19. Funke H, von Eckardstein A, Pritchard PH, Karas M, Albers JJ, Assmann GA. A frameshift mutation in the human apolipoprotein A-I gene causes high density lipoprotein deficiency, partial lecithin:cholesterol-acyltransferase deficiency, and corneal opacities. J Clin Invest.. 1991;87:371-376.

20. Deeb SS, Cheung MC, Reng R, Wolf AC, Stern R, Albers JJ, Knopp RH. A mutation in the human apolipoprotein A-I gene. J Biol Chem.. 1991;266:13654-13660.[Abstract/Free Full Text]

21. Schmitz G, Lackner KJ. High density lipoprotein deficiency with xanthomas: a defect in apo A-I synthesis? In: Crepaldi G, ed. Atherosclerosis. Amsterdam, the Netherlands; Elsevier Science Publishing Co; 1989;7:399-403.

22. Lackner KJ, Dieplinger H, Nowicka G, Schmitz G. High density lipoprotein deficiency with xanthomas: a defect in reverse cholesterol transport caused by a point mutation in the apolipoprotein A-I gene. J Clin Invest.. 1993;92:2262-2273.

23. Ng DS, Leiter LA, Vezina C, Connelly PW, Hegele RA. Apolipoprotein A-I Q[-2]x causing isolated apolipoprotein A-I deficiency in a family with analphalipoproteinemia. J Clin Invest. 1994;93:223-229.

24. Carlson LA, Philipson B. Fish-eye disease: a new familial condition with massive corneal opacities and dyslipoproteinemia. Lancet.. 1979;2:921-924.

25. Breslow JL. Familial disorders of high density lipoprotein metabolism. In: Scriver CR, Beaudet AL, Sly WS, Vale D, eds. The Metabolic Basis of Inherited Disease. 6th ed. New York, NY: McGraw-Hill Publishing Co; 1989:1251-1266.

26. Bekaert ED, Alaupovic P, Knight-Gibson CS, Laux MJ, Pelachyk JM, Norum RA. Characterization of apo A- and apo B-containing lipoprotein particles in a variant of familial apo A-I deficiency with planar xanthoma: the metabolic significance of LP-A-II particles. J Lipid Res.. 1991;32:1587-1599.[Abstract]

27. Gustafson A, McConathy WJ, Alaupovic P, Curry MD, Persson B. Identification of lipoprotein families in a variant of human plasma apolipoprotein A deficiency. Scand J Clin Lab Invest.. 1977;39:377-387.

28. Cheung MC, Mendez AJ, Wolf AC, Knopp RH. Characterization of apolipoprotein A-I- and A-II-containing lipoproteins in a new case of high density lipoprotein deficiency resembling Tangier disease and their effects on intracellular cholesterol efflux. J Clin Invest.. 1993;91:522-529.

29. Assmann G, Schmitz G, Brewer HB Jr. Familial high density lipoprotein deficiency: Tangier disease. In: Scriver CR, Beaudet AL, Sly WS, Vale D, eds. The Metabolic Basis of Inherited Disease. 6th ed. New York, NY: McGraw-Hill Publishing Co; 1989:1267-1282.

30. Sasaki J, Arakawa K. Effect of nifedipine on serum lipids, lipoproteins, and apolipoproteins in patients with essential hypertension. Curr Ther Res.. 1987;41:845-851.

31. Goto Y, Akanuma Y, Harano Y. Determination by the SRID method of normal values of serum apolipoproteins (A-I, A-II, B, C-II, C-III, and E) in normolipidemic healthy Japanese subjects. J Clin Biochem Nutr.. 1986;1:73-88.

32. Matsunaga A, Handa K, Mori T, Moriyama K, Hidaka K, Yuki M, Sasaki J, Arakawa K. Effects of niceritrol on levels of serum lipids, lipoprotein (a), and fibrinogen in patients with primary hypercholesterolemia. Atherosclerosis.. 1992;94:241-248.[Medline] [Order article via Infotrieve]

33. Moriyama K, Sasaki J, Matsunaga A, Arakawa F, Takada Y, Araki K, Kaneko S, Arakawa K. Apolipoprotein E1 Lys-146->Glu with type III hyperlipoproteinemia. Biochim Biophys Acta.. 1992;1128:58-64.[Medline] [Order article via Infotrieve]

34. Koren E, Puchois P, McConathy WJ, Fesmire JD, Alaupovic P. Quantitative determination of human plasma apolipoprotein A-I by a non-competitive enzyme-linked immunosorbent assay. Clin Chim Acta.. 1985;147:85-95.[Medline] [Order article via Infotrieve]

35. Takada Y, Sasaki J, Ogata S, Nakanishi T, Ikehara Y, Arakawa K. Isolation and characterization of human apolipoprotein A-I Fukuoka (Glu110->Lys). Biochim Biophys Acta.. 1990;1043:169-176.[Medline] [Order article via Infotrieve]

36. Takada Y, Sasaki J, Seki M, Ogata S, Teranishi Y, Arakawa K. Characterization of a new human apolipoprotein A-I Yame by direct sequencing of polymerase chain reaction-amplified DNA. J Lipid Res.. 1991;32:1275-1280.[Abstract]

37. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature.. 1970;227:680-685.[Medline] [Order article via Infotrieve]

38. Gyllensten UB, Erlich HA. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acad Sci U S A.. 1988;85:7652-7656.[Abstract/Free Full Text]

39. Shoulders CC, Kornblihtt AR, Munro BS, Baralle FE. Gene structure of human apolipoprotein A1. Nucleic Acids Res.. 1983;11:2827-2837.[Abstract/Free Full Text]

40. Nichols AV, Blanche PJ, Gong EL. Gradient gel electrophoresis of human plasma high density lipoproteins. In: Lewis LA, ed. Handbook of Electrophoresis. Boca Raton, Fla: CRC Press Inc; 1983;3:29-47.

41. Moriyama K, Sasaki J, Arakawa F, Takami N, Maeda E, Matsunaga A, Takada Y, Midorikawa K, Yanase T, Yoshino G, Marcovina SM, Albers JJ, Arakawa K. Two novel point mutations in the lecithin-cholesterol acyltransferase (LCAT) gene resulting in LCAT deficiency: LCAT (G873 deletion) and LCAT (Gly344->Ser). J Lipid Res.. 1995;36:2329-2343.[Abstract]

42. Stokke KT, Norum KR. Determination of lecithin: cholesterol acyltransferase in human blood plasma. Scand J Clin Lab Invest.. 1971;27:21-27.[Medline] [Order article via Infotrieve]

43. Lacko AG, Rutenberg HL, Soloff LA. Recovery of labeled cholesterol and cholesterol esters from thin layer chromatograms. Clin Chim Acta.. 1972;39:506-510.[Medline] [Order article via Infotrieve]

44. Albers JJ, Adolphson JL, Chen CH. Radioimmunoassay of human lecithin: cholesterol acyltransferase. J Clin Invest.. 1981;67:141-146.

45. Tollefson JH, Albers JJ. Isolation, characterization, and assay of plasma lipid transfer proteins. Methods Enzymol.. 1986;129:797-816.[Medline] [Order article via Infotrieve]

46. Gotoda T, Yamada N, Murase T, Sakuma M, Murayama N, Shimano H, Kanzaki K, Albers JJ, Yazaki Y, Akanuma Y. Differential phenotypic expression by three mutant alleles in familial lecithin: cholesterol acyltransferase deficiency. Lancet.. 1991;338:778-781.[Medline] [Order article via Infotrieve]

47. Klein HG, Lohse P, Pritchard PH, Bojanovski D, Schmidt H, Brewer HB Jr. Two different allelic mutations in the lecithin-cholesterol acyltransferase gene associated with fish eye syndrome. J Clin Invest.. 1992;89:499-506.

48. Klein HG, Lohse P, Duverger N, Albers JJ, Rader DJ, Zech LA, Fojo SS, Brewer HB Jr. Two different allelic mutations in the lecithin-cholesterol acyltransferase (LCAT) gene resulting in classic LCAT deficiency: LCAT (tyr83->stop) and LCAT (tyr156->asn). J Lipid Res.. 1993;34:49-58.[Abstract]

49. Schmidt HH-J, Remaley AT, Stonik JA, Roman R, Wellmann A, Thomas F, Zech LA, Brewer HB Jr, Hoeg JM. Carboxyl-terminal domain truncation alters apolipoprotein A-I in vivo catabolism. J Biol Chem.. 1995;270:5469-5475.[Abstract/Free Full Text]

50. Franceschini G, Sirtori CR, Capurso A, Weisgraber KH, Mahley RW. A-IMilano apoprotein. J Clin Invest.. 1980;66:892-900.

51. Weisgraber KH, Bersot TP, Mahley RW, Franceschini G, Sirtori CR. A-IMilano apoprotein. J Clin Invest.. 1980;66:901-907.

52. Weisgraber KH, Rall SC, Bersot TP, Mahley RW. Apolipoprotein A-IMilano. J Biol Chem.. 1983;258:2508-2513.[Free Full Text]

53. Franceschini G, Frosi TG, Manzoni C, Gianfranceschi G, Sirtori CR. High density lipoprotein-3 heterogeneity in subjects with the apo-A-IMilano variant. J Biol Chem.. 1982;257:9926-9930.[Abstract/Free Full Text]

54. Ghiselli G, Summerfield JA, Schaffer EJ, Sirtori CR, Jones EA, Brewer HB Jr. Abnormal catabolism of apolipoprotein A-IMilano, a cause of high density lipoprotein deficiency. J Clin Res.. 1982;30:393a. Abstract.

55. Norum KR, Gjone E, Glomset JA. Familial lecithin: cholesterol acyltransferase deficiency, including fish eye disease. In: Scriver CR, Beaudet AL, Sly WS, Vale D, eds. The Metabolic Basis of Inherited Disease. 6th ed. New York, NY: McGraw-Hill Publishing Co; 1989:1181-1194.

56. Subbaiah PV, Norum RA, Bagdade JD. Effect of apolipoprotein activators on the specificity of lecithin:cholesterol acyltransferase: determination of cholesteryl esters formed in A-I/C-III deficiency. J Lipid Res.. 1991;32:1601-1609.[Abstract]




This article has been cited by other articles:


Home page
J Am Coll CardiolHome page
G. K. Hovingh, A. Brownlie, R. J. Bisoendial, M. P. Dube, J. H.M. Levels, W. Petersen, R. P.F. Dullaart, E. S.G. Stroes, A. H. Zwinderman, E. de Groot, et al.
A novel apoA-I mutation (L178P) leads to endothelial dysfunction, increased arterial wall thickness, and premature coronary artery disease
J. Am. Coll. Cardiol., October 6, 2004; 44(7): 1429 - 1435.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Altilia, L. Pisciotta, R. Garuti, P. Tarugi, A. Cantafora, L. Calabresi, J. Tagliabue, S. Maccari, F. Bernini, I. Zanotti, et al.
Abnormal splicing of ABCA1 pre-mRNA in Tangier disease due to a IVS2 +5G>C mutation in ABCA1 gene
J. Lipid Res., February 1, 2003; 44(2): 254 - 264.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
T. Oka, S. Yamashita, T. Kujiraoka, M. Ito, M. Nagano, Y. Sagehashi, T. Egashira, M. N. Nanjee, K.-i. Hirano, N. E. Miller, et al.
Distribution of human plasma PLTP mass and activity in hypo- and hyperalphalipoproteinemia
J. Lipid Res., August 1, 2002; 43(8): 1236 - 1243.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Han, J. Sasaki, A. Matsunaga, H. Hakamata, W. Huang, M. Ageta, T. Taguchi, T. Koga, M. Kugi, S. Horiuchi, et al.
A Novel Mutant, ApoA-I Nichinan (Glu235->0), Is Associated With Low HDL Cholesterol Levels and Decreased Cholesterol Efflux From Cells
Arterioscler Thromb Vasc Biol, June 1, 1999; 19(6): 1447 - 1455.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Matsunaga, J. Sasaki, H. Han, W. Huang, M. Kugi, T. Koga, S. Ichiki, T. Shinkawa, and K. Arakawa
Compound Heterozygosity for an Apolipoprotein A1 Gene Promoter Mutation and a Structural Nonsense Mutation With Apolipoprotein A1 Deficiency
Arterioscler Thromb Vasc Biol, February 1, 1999; 19(2): 348 - 355.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
W. Huang, J. Sasaki, A. Matsunaga, H. Nanimatsu, K. Moriyama, H. Han, M. Kugi, T. Koga, K. Yamaguchi, and K. Arakawa
A Novel Homozygous Missense Mutation in the Apo A-I Gene With Apo A-I Deficiency
Arterioscler Thromb Vasc Biol, March 1, 1998; 18(3): 389 - 396.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moriyama, K.
Right arrow Articles by Arakawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moriyama, K.
Right arrow Articles by Arakawa, K.