© 1996 American Heart Association, Inc.
Articles |
Plasma Lipoprotein(a) Levels in Subjects Attending a Metabolic Ward
Discrimination Between Individuals With and Without a History of IschemicStroke
Presented in part at the XIV Congress of the International Society on Thrombosis and Haemostasis, New York, NY, July 4-9, 1993, and published in abstract form (Thromb Haemost. 1993; 69:820).
From the Clinica Medica (G.D.M., E.C., A.P., S.P., M. Mancini), Istituto di Medicina Interna e Malattie Dismetaboliche; the Dipartimento di Biochimica e Biotecnologie Mediche (F.P.M.), Universita' di Napoli; and Unita' di Trombosi e Aterosclerosi (M. Margaglione, G.D.M., E.G., G.V., G.C., M.G.), Istituto Ricovero Cura Carattere Scientifico, "Casa Sollievo della Sofferenza," S. Giovanni Rotondo, Italy.
Correspondence to Giovanni DiMinno, MD, Clinica Medica, Istituto di Medicina Interna e Malattie Dismetaboliche, Via S Pansini, 5, 80131, Napoli, Italy.
 |
Abstract |
|---|
 Top Abstract IntroductionMethods Results Discussion References |
|---|
Abstract In this cross-sectional study we compared the abilities of lipoprotein(a) [Lp(a)], plasminogen activator inhibitor–1 (PAI-1), and tissue plasminogen activator (TPA) to discriminate between individuals with and without a history of stroke from among subjects in a metabolic ward. A total of 210 subjects (108 men and 102 women; mean age, 63.8 years; range, 31 to 86 years) provided plasma and DNA samples for the study. Of these, 51 men and 50 women had a history of ischemic stroke. The 109 subjects without a history of stroke were compared with those with such a history for major risk factors for ischemic events. Mean plasma TPA and PAI-1 levels significantly (P<.001) discriminated among subjects younger than 70 years with a history of stroke. The mean plasma Lp(a) level of stroke subjects (21.9 mg/dL) did not differ significantly from that of control subjects (15.2 mg/dL). However, among individuals <70 years old, Lp(a) plasma levels >50 mg/dL were more common among stroke patients (8 with versus 1 without, P<.01 by
2 test). A molecular
variation in the 5' flanking region of the apo(a) gene that has been
related to elevated Lp(a) plasma levels (G/A-914) was not strongly
correlated with circulating levels of Lp(a), nor did Lp(a) levels
correlate with a polymorphism of the apo(a) gene (G/A-21), which is
strongly linked (P<.001) to the G/A-914 variation. In this
setting, the relation between Lp(a) and cerebral ischemia
appears to be limited to individuals below 70 years with elevated (>50
mg/dL) plasma levels of the lipoprotein.
Key Words: lipoprotein(a) • genotype • fibrinolytic variables • ischemic stroke
|
Introduction |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
In 1963 Berg1 described a genetic variation of a lipoprotein in humans that he called the lipoprotein antigen. Subsequently, observational2 3 and prospective4 studies in patients with hypercholesterolemia have shown that plasma levels of Lp(a) are a stronger discriminator of coronary artery disease than lipoprotein subclass, cigarette smoking, sex, or age. Studies in normolipidemic subjects indicate that high plasma levels of Lp(a) are associated with MI,5 6 coronary stenosis,7 8 reocclusion of aortocoronary bypass vein grafts,9 and cerebral ischemia.10 11 The association between Lp(a) and risk of MI or stroke in the general population has been disputed.12 13 14 15 In vitro studies16 indicate that Lp(a) enhances the endothelial cell synthesis of PAI-1, the main inhibitor of the fibrinolytic system. The impairment of fibrinolysis may be important for the mechanism of the effect of Lp(a).17 We have reported18 raised PAI-1 levels in subjects with a history of cerebral ischemia and have suggested that this may be pathophysiologically important. In the present study we looked at the potential relations between Lp(a), PAI-1, and TPA plasma levels and compared the ability of these three variables to discriminate between individuals with and without a history of stroke among subjects attending a metabolic ward. Circulating levels of Lp(a) are mostly genetically determined.17 However, the interrelationships between the sequence of the apo(a) gene and plasma Lp(a) levels are poorly understood.19 In two subjects, a G/A-914 substitution in the 5' flanking region of the apo(a) gene was related to different plasma concentrations of Lp(a).20 By means of newly developed protocols, we have screened this polymorphic cutting site and a polymorphism strongly linked with such G/A substitution.
|
Methods |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
Subjects
From February through December 1992, 106 consecutive subjects who had survived an ischemic stroke were enlisted for the study. The cerebral ischemic episode had occurred 8 to 12 months before and had been documented by nuclear magnetic resonance imaging and/or computerized tomography scan. Subjects who had experienced more than one episode were enlisted 8 to 12 months after the last event. All stroke individuals were chosen from among subjects who had been attending the metabolic ward of the outpatient clinic of the institution. All had been referred to us from the Divisions of Medicine and Neurology. According to institutional procedures, patients are referred to the metabolic ward because of metabolic abnormalities, previous ischemic episodes, and/or the presence of one or more vascular risk factors. All subjects had been repeatedly instructed to stop smoking and drinking alcohol and to control food intake, and all were highly motivated to follow the advice. All had been on an isocaloric Mediterranean diet for at least 6 months, and none were taking neomycin, niacin, or N-acetylcysteine. All subjects with clinical evidence of cancer or acute or chronic inflammatory disease were excluded from the study. Thus, only 101 stroke individuals (51 men and 50 women) were enlisted for the study. One hundred nine subjects (57 men and 52 women) without a history of stroke were matched with stroke individuals for established risk factors. All the control subjects also attended the metabolic ward, mostly for metabolic abnormalities and/or cardiovascular risk factors; only two had a history of MI, and none had evidence of documented cerebral ischemic events (Table 1
). The selection (inclusion/exclusion)
criteria employed for the control group were entirely comparable to
those for stroke individuals. No difference in risk factors was found
between men and women. A complete clinical summary was obtained for
both case and control subjects, with emphasis on personal and family
history for angina pectoris, MI, ischemic stroke,
peripheral arterial disease, and vascular risk
factors. Positive family history for ischemic complications of
atherosclerosis was defined as the occurrence of stroke
or MI before the age of 55 years for male and 60 years for female
parents and siblings.21 Case and control subjects were
comparable with respect to gender, height, occupation, social class,
high blood pressure, diabetes mellitus (mostly type II), plasma glucose
levels (6.3±3.0 versus 6.4±2.8 mmol/L in stroke and control
subjects,
respectively), average body weight (69.3±9.8 versus 72.0±14.5
kg),
and plasma fibrinogen levels (3.7±0.9 versus 3.6±1.1 g/L). (See
Reference 18 for details.) Mean concentrations of total, HDL, and LDL
cholesterol and triglycerides in stroke
subjects were 1.72±0.40, 0.33±0.09, 1.11±0.34, and
1.41±0.71 g/L,
respectively; in control subjects, the values were 1.68±0.43,
0.32±0.09, 1.11±0.38, and 1.28±0.56 g/L, respectively
(P=NS for all). In contrast (Table 1), there
was a
significant difference in the subjects' ages (mean, 66.2 years, range
38 to 86, versus 61.2 years, range, 31 to 86; P=.002), in
the number of subjects with cardiovascular disease (33
versus 10; P=.001), in ethanol users (27 versus 44;
P=.05), and in the number of subjects with a positive family
history (40 versus 27; P=.03) (all values are stroke and
control subjects, respectively). No quantitative or qualitative
differences in alcohol consumption were found when prestudy data were
compared with those obtained on admission. In contrast, prestudy data
on tobacco use revealed that 26 subjects among stroke patients and 35
among control subjects smoked more than 10 cigarettes/d. Nine stroke
patients had stopped smoking 8 to 12 months before being enlisted
(immediately after the ischemic event). Thus, on admission, 17
stroke and 35 control individuals were current smokers. On admission,
50 stroke patients were using antiplatelet drugs (39 aspirin,
100 or 320 mg/d, and 11 ticlopidine, 500 mg divided into two daily
doses), and 6 were using anticoagulants. None of the control subjects
were specifically using anticoagulants, but 4 used aspirin (100 mg/d).
No evidence of a sustained use of these drugs before the
ischemic event was found in stroke patients. After approval by
the ethics committee, the studies were performed according to the
Principles of the Declaration of Helsinki, and informed consent was
obtained from all subjects.
|
Definitions
Types of stroke were defined based on data from
computerized
tomography and nuclear magnetic resonance imaging according to Anderson
et al.22 With some exceptions (see "undetermined
strokes" below) the scans were performed within 3 to 7 days after
the onset of rapidly developing symptoms and/or signs of focal and
sometimes global loss of cerebral function, with symptoms lasting more
than 24 hours and no apparent cause other than that of vascular origin.
Undetermined stroke events were defined as ischemic events for
which patients had not undergone scans within 28 days from the onset of
the symptoms or in cases in which the original scans could not be
retrieved. Large artery (occlusive) infarctions were defined as stroke
events presumably due to in situ thrombosis of a large- or
medium-sized cerebral artery. Multiple (embolic) stroke episodes
were defined as those for which cerebral imaging showed a hemorrhagic
component to cerebral infarction or when the events occurred in the
presence of clinical data highly suggestive of embolism (eg, acute MI
in the previous 3 months, valvular heart disease, complicated
internal carotid atheroma, or history of
tachyarrhythmia or bradyarrhythmia).
Lacunar infarctions were defined as stroke events with clinical
symptoms that were compatible with one of the five major recognized
lacunar syndromes in the presence of cerebral imaging of occlusion of a
small penetrating cerebral vessel. Boundary-zone infarctions were
marked by "watershed" boundary zones between the territories of
the main cerebral arteries, usually the parietal-occipital regions,
the basal ganglia, the cerebellum, or the spinal cord.
Materials
dNTP, Tris-HCl, KCl, MgCl2, gelatin,
agarose,
Taq polymerase, and mineral oil were from Perkin-Elmer
Cetus. The restriction enzymes Taq I and Bsp 1286
I were from Boehringer Mannheim. Proteinase K, dextran,
Tris-acetate, EDTA, HEPES, ethidium bromide, and sodium
dodecyl sulfate were from Sigma Chemical Co; lymphoprep
(d=1.077) was from Nyegaard. Subjects fasted overnight for
12 to 15 hours, after which 18 mL of blood was drawn from each subject
between 9 and 9:30 AM from the antecubital vein without
venous stasis via a 19-gauge scalp-vein needle. Blood was collected
into sterile tubes containing 2 mL sterile 3.8% trisodium citrate, and
the samples were immediately processed. Total cholesterol,
triglyceride, HDL cholesterol, and plasma
glucose concentrations were detected by using enzymatic
methods21 with commercially available reagents (Roche).
The Friedwald equation (total cholesterol-[HDL
cholesterol-triglycerides/5]) was
employed to calculate LDL cholesterol. Both the reagent and
the apparatus (CoA Data, 2000) for the measurement of
fibrinogen were from Boehringer-Mannheim. Imulyse, for the
measurements of PAI-1 and TPA antigens, was from Biopool-Menarini.
Lp(a) (tintelyze) and APA (anticardiolipin) of the IgG class were
assayed by using enzyme-linked immunosorbent assay methods with
kits from Biopool-Menarini. On the basis of our previous
data,21 APA positivity was defined as the presence in the
sample of >24 GPL IgGxliter units of specific IgG per milliliter.
According to the manufacturer's recommendations, 1 unit of APA
corresponds to the cardiolipin binding activity of 1 µg/mL of an
affinity-purified IgG anticardiolipin preparation from a standard
serum. Normal values for TPA, PAI-1, and Lp(a) are <10 ng/mL, <42
ng/mL, and <30 mg/dL, respectively. All these values were employed as
cutoff points for statistical analyses. For Lp(a), 50 mg/dL
[ie, the mean±2 SD of the Lp(a) plasma level in control
subjects]
was used as a second cutoff value. Reference pooled normal plasma from
apparently drug-free healthy volunteers (29 to 70 years old) was
prepared and stored under the same conditions as the plasma from the
study population. The intra-assay and interassay coefficients of
variation for TPA, PAI-1, and APA were <4.5%; those for Lp(a) were
<10%.
Isolation of DNA and Restriction Fragment Length Polymorphism
Analysis of the Apo(a) 5' Flanking Region
These studies were
performed essentially as described for the
plasma fibrinogen ß gene.21 Only 192 subjects (92
subjects with and 100 without a stroke history) could be
analyzed. No statistically significant differences were found
between these 192 and the other 18 subjects for any of the data
reported in "Results."
Peripheral blood leukocytes were incubated overnight at 37°C in a digestion buffer (100 mmol/L NaCl, 10 mmol/L Tris-HCl, 25 mmol/L EDTA, and 1% sodium dodecyl sulfate) containing 0.1 mg/mL proteinase K. Nucleic acid was isolated by phenol/chloroform extraction and ethanol precipitation. Polymerase chain reaction was performed on 80-µL volume samples in a Perkin Elmer-Cetus thermal cycler. Each sample contained 1.0 µg genomic DNA, 100 mmol/L dNTP, 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 2.5 mmol/L MgCl2, 0.05% W1, 0.001% (wt/vol) gelatin, 2 U Taq polymerase, and 30 pmol of each primer. The sequence (5' through 3') of the primers used for the variation A/G-914 (Taq I) were ACCGCACTCGACCCTATGTTT for the coding strand and GTGCCGAAATGACAACATAAGTG for the noncoding strand of DNA. For the variation A/G-21 (Bsp 1286 I), they were TGACATTGCACTCTCAAATATTTTA for the coding strand and CATATACAAGATTTTGAACTGGGAA for the noncoding strand. The solution was overlaid with 50 µL mineral oil. The initial cycle consisted of steps at 93°C for 3 minutes, 60°C for 1 minute, and 72°C for 3 minutes. The 30 subsequent cycles were at 93°C for 1 minute, 60°C for 1 minute, and 72°C for 3 minutes. Thereafter, 20-µL volumes of the products of the amplifications (522 bp for the A/G-914 variation and 383 bp for the A/G-21 variation) were digested for 4 hours at either 65°C with 1 U/mL of the restriction enzyme Taq I or 37°C with 1 U/mL of the restriction enzyme Bsp 1286 I. The fragments were separated by 2.0% agarose gel electrophoresis in a buffer (40 mmol/L Tris-acetate and 1 mmol/L EDTA, pH 7.7) containing 0.5 µg/mL ethidium bromide and visualized under UV light.
Statistical Analysis
All analyses were performed by using
SPSS/PC, version 2.0, according to the
recommended procedures.23 Since the distributions of
Lp(a), PAI-1, and TPA are highly skewed, the Mann-Whitney U
test was used for statistical comparisons. The Kolmogorov-Smirnov test
was performed in parallel; in each case, it confirmed the results
achieved with the Mann-Whitney U test. The
2 test was employed to evaluate differences in
the proportional distributions. The arithmetic mean of each
variable is reported. Univariate ANOVA was used to
evaluate differences in Lp(a), PAI-1, or TPA concentrations between
subjects with and without a stroke history, between subjects with and
without certain vascular risk factors, between different types of
stroke and, within each genotype, between the molecular
variations and the risk factors. Differences between groups were
evaluated by using Scheffé's test. To evaluate the association
between plasma Lp(a), PAI-1, or TPA concentrations and risk factors,
Spearman's correlation analysis was employed. For continuous
variables the values of quintiles as determined in control subjects
were used. The proportion of the phenotypic variance associated with
each genotype was estimated according to the method of Sing and
Davignon.24 The Hardy-Weinberg equilibrium of observed
polymorphisms was tested by using the 2
goodness-of-fit analysis. The haplotype distribution of
the variations A/G-914 and A/G-21 was calculated by the
maximum-likelihood estimate of disequilibrium. Because of the need
for repeated comparisons of each categorical variable, in each case
significance was established as a probability of <.01. Values are
mean±SD unless otherwise specified.
|
Results |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
As shown in Table 2
, plasma TPA and PAI-1 levels of
stroke subjects were significantly higher than those of control
subjects. The difference remained significant when the data concerning
these two fibrinolytic variables were analyzed according to
the presence of familial risk, hypertension, age <70 years, and
diabetes mellitus (P<.05 by Mann-Whitney U test
for all). Plasma Lp(a) was 21.9±28.9 mg/dL in stroke patients and
15.2±17.1 mg/dL in control subjects. No significant difference was
found in Lp(a) levels between men and women regardless of stroke status
(not shown); the same held true when the data were analyzed
according to major risk factors for cerebral ischemic events
(Table 2). The possibility that the variables that exhibited
significant differences between stroke and control individuals (Table
1
) were associated with major effects on the plasma levels of
TPA,
PAI-1, or Lp(a) was then addressed. This was the case when TPA was
evaluated according to cardiovascular disease and use
of antiplatelet agents (Table 3). No difference
in TPA plasma levels was found in subjects who were taking ticlopidine
versus those who were taking aspirin (10.41±3.69 versus
10.88±2.97
ng/dL, respectively), nor, among aspirin users, between those who were
taking 100 or 320 mg/d. The observations summarized in Table 3
were
further analyzed by using a multiple linear regression
analysis model; only the use of antiplatelet agents
(ß=.122, r2=.179, P<.001)
and circulating levels of PAI-1 (ß=.377, P<.001)
appeared
to account for plasma levels of the TPA antigen. When the
antiplatelet users were excluded from the analysis,
only PAI-1 plasma levels appeared to account for the interindividual
variability of plasma TPA in this setting (ß=.394,
r2=.137, P<.001). In keeping
with this, plasma PAI-1 levels appeared to be affected only by
circulating levels of TPA (ß=.325,
r2=.137, P<.001). In
contrast, none of the variables examined appeared to affect plasma
Lp(a) levels. The possibility that the observations presented
in Table 3 could alter the concepts emerging from Table
2 was also
addressed. Plasma TPA was 11.0±4.3 ng/mL in the 50 stroke patients who
were current antiplatelet users and 9.7±4.2 ng/mL in the 51
stroke patients who were not. Both these figures were significantly
different from each other as well as from the TPA plasma levels of the
109 control individuals (7.3±3.9 ng/mL, P<.001 for all
comparisons).
|
|
The potential associations between Lp(a) and PAI-1 and TPA levels as
well as between Lp(a) and other variables were also
analyzed. Plasma Lp(a) significantly correlated with LDL
cholesterol (P<.03) but not plasma PAI-1, TPA,
HDL cholesterol, or serum triglyceride levels,
familial risk, diabetes mellitus, hypertension, number of previous
ischemic episodes, cardiovascular disease, APA
IgG positivity, cigarette smoking, alcohol consumption, use of
hemostatically active drugs, or body weight, nor did it interact in
identifying stroke subjects. No difference in Lp(a) plasma
concentration was found when the patients' data were stratified
according to types of stroke. By contrast, a significant difference was
found when the levels of TPA and PAI-1 of subjects with stroke events
involving large arteries were compared with those of the 109 control
subjects (Table 4). Lp(a) values by quintiles of age
were all nonsignificant (Table 5), nor was there any
difference in the proportion of individuals whose Lp(a) plasma levels
were >30 mg/dL (22 stroke versus 25 control subjects; Table
6). On the other hand, TPA >10 ng/mL was found in 53
stroke and 21 control individuals, and PAI-1 >43 ng/mL was found in 31
stroke and 15 control individuals (P<.001).18
Potential differences employing a higher cutoff value for Lp(a) (50
mg/dL) were also evaluated. Seventeen of the total 210 subjects
exhibited Lp(a) plasma levels >50 mg/dL; 5 of these 17 were control
subjects (5/109). When the sample was stratified according to age
(above or below 70 years), such a level was more common among stroke
subjects younger than 70 years (8 with versus 1 without,
P<.01 by 2 test) than in those older
than 70 years (4 with versus 4 without, NS). When the sample was
stratified according to types of stroke, 8 individuals with Lp(a) >50
mg/dL belonged to the group with ischemic events of the large
arteries (n=48) and 4 to those with other types of stroke
(n=53). In
spite of the trend, the latter difference was not significant.
|
|
|
The polymerase chain reaction technique was employed to investigate
potential interrelations between genetic variants of the apo(a) gene
and plasma Lp(a) and PAI-1 levels. A G
A substitution at the
-914 apo(a) gene, close to the consensus sequence for the
hepatocyte transcription element constitutive element
binding protein,20 destroys the Taq I
restriction site that includes the point mutation. The allele
containing the polymorphic cutting site was designated as T1, and
the allele that did not contain the alternative site as T2. On the
other hand, a GA substitution at -21 bp of the apo(a) gene
destroys the Bsp 1286 I restriction site that includes the
point mutation. The allele containing the polymorphic cutting
site was designated as B1, and the one that did not contain the
alternative site was designated as B2. The frequencies of the G/A-914
variation were 57.5% for T1 and 42.5% for T2; those of the G/A-21
variation were 85.8% for B1 and 14.2% for B2 (Table 7). No
significant differences were found when the
genotype frequencies were compared with those predicted from
the Hardy-Weinberg equilibrium. Analysis of the whole
population showed a link between the two polymorphic sites
(P<.001). Lp(a) phenotypic variance attributable to the
G/A-914 or G/A-21 variations was always <0.01%. The alleles did
not help discriminate subjects with major risk factors for
ischemic stroke, nor did they correlate with age above or below
70 years or plasma Lp(a), PAI-1, or TPA levels.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
Nagayama et al25 report that serum Lp(a) levels of patients younger than 70 years with atherothrombotic strokes are significantly higher than those of control subjects. In the present study, Lp(a) identified stroke subjects among individuals younger than 70 years when a rather elevated cutoff point (50 mg/dL) was used. Our patients differ in several ways from those of Nagayama et al.25 Most of the people described here are older than the ones evaluated in that report; moreover, their control subjects had no history of hypertension, diabetes mellitus, hyperlipidemia, or other major vascular risk factors. The design of our investigation (a cross-sectional study of subjects attending a metabolic ward) is such that some limitations may have influenced the results. Subjects with and without a history of stroke attend the metabolic ward, and both case and control subjects were comparable with respect to major risk factors for atherosclerosis. An inadvertent bias may have been introduced in the selection of the control subjects that may have diluted the differences between the groups and thus hampered the ability of the study to detect significant differences between case and control subjects. However, clinic-based control subjects have been enlisted in successful studies.5 11 Furthermore, by inference from the data concerning TPA and PAI-1, it is unlikely that any clinically important difference between subjects with and without stroke would remain undetected in this setting. Some interrelationships between Lp(a) levels and other variables related to ischemic events were analyzed in the study by Nagayama et al.25 In agreement with our data, they found no apparent correlation between major risk factors and Lp(a) levels. When our sample was stratified according to types of stroke, 8 individuals with Lp(a) plasma levels >50 mg/dL were found to belong to the group with ischemic events of the large arteries and 4 to those with other types of stroke. The Lp(a) levels of patients with atherothrombotic stroke (large arteries) are higher than those of patients with lacunar events,25 26 but the relations between age <70 years, Lp(a) level, and ischemic stroke among subjects attending a metabolic ward may be limited to individuals with rather elevated plasma levels of this lipoprotein.
Alternative possibilities should be considered to explain the different results of the present study and several retrospective analyses of the predictive value of Lp(a). The apo(a) antigen is variable in size, and antibodies used for its detection may not interact equally well with all apo(a) isoforms. However, the enzyme-linked immunorsorbent assay technique used in this study has been used before.27 28 The inherent potential limitation of the immunologic technique used to determine Lp(a) would apply to the present results to the same extent as to prior studies with positive findings.
Plasma Lp(a) has been reported to be an acute-phase reactant,29 but blood samples from all our subjects were collected 8 to 12 months after the last documented ischemic event. Moreover, the levels of this lipoprotein in our setting were comparable both to those of normal subjects and to those reported by other authors.11 13 14 15
The possibility that our data on TPA and PAI-1 levels in stroke
individuals might be overestimated has also been taken into
consideration. Antiplatelet/anticoagulant medications have been shown
to affect plasma levels of PAI-1 in poststroke subjects.30
In the present study, TPA but not PAI-1 plasma levels were
significantly higher in the 54 subjects who used antiplatelet
agents than in the 156 individuals who did not use such medications.
However, plasma TPA levels were significantly higher in the 51 stroke
cases who were not current antiplatelet users than in the 109
control individuals (9.7±4.2 versus 7.3±3.9 ng/mL,
P<.001). The effects of aspirin on TPA have been related to
the dose: at variance with lower doses, doses of aspirin of 1000 to
1500 mg are reported to affect this fibrinolytic
variable.31 We did not find any difference in TPA
levels in subjects ingesting 100 or 320 mg aspirin in our setting, nor
did we find a difference between subjects ingesting aspirin and those
taking ticlopidine, a drug whose antithrombotic mechanism differs from
that of aspirin.32 Factors such as diabetes mellitus or
hypertension have a major effect on the plasma levels of both TPA and
PAI-1.18 33 In our study, stroke and control subjects
were
matched with respect to the prevalence of diabetes and hypertension.
Differences in the distribution of these two variables were
present in the population analyzed in the reports by Tohgi
et al30 33 and Ozturk et al.33 Table
3 also
shows an association between the presence of
cardiovascular disease and levels of TPA. However, at
variance with the use of antiplatelet agents, the presence of
cardiovascular disease did not significantly account
for plasma levels of TPA antigen in a multiple linear regression
analysis model. Moreover, when antiplatelet users were
excluded from the analysis, the presence of
cardiovascular disease did not significantly account
for the interindividual variability of plasma TPA in this setting.
In a study of 10 regular smokers aged 22 to 25 years, acute cigarette smoking was associated with a 30-minute enhancement of plasma TPA levels, but it appeared to have a limited effect on plasma PAI-1 levels.34 In our population, smoking as well as drinking were more common among control subjects than stroke individuals. Blood was always collected from subjects who claimed that they had not smoked or drunk alcohol in the previous 2 to 3 hours.
The advent of nuclear magnetic resonance imaging and computerized
tomography scans has made it relatively easy to accurately distinguish
hemorrhage from infarction. However, even when accurate
diagnostic information is collected in a standardized
manner, a significant minority of cases of undetermined cerebral
infarcts is reported.35 In the present study, 13 of
101 strokes were defined as undetermined. Our figures agree with the
proportional frequency of this diagnosis that Anderson et
al22 report in the Perth Community Stroke Study. Likewise,
although only a few patients underwent carotid ultrasonography and/or
echocardiography, the frequency of embolic strokes
in our sample is comparable (
20%) to that of population-based
reports.22 Among the other categories of cerebral
infarctions, the frequencies of boundary-zone and lacunar
infarctions are likely to be highly accurate because of the highly
specific criteria used for these diagnoses. As in the present
article, other studies25 26 indicate that Lp(a)
plasma
levels are not elevated in embolic strokes. In addition to
tachyarrhythmia, bradyarrhythmia, and
valvular heart disease, embolic strokes may occur as a
consequence of acute MI or complicated internal carotid
atheromas. The role of Lp(a) in coronary
atherosclerosis is well established.17
Moreover, in 808 subjects randomly selected from stroke and
asymptomatic subjects, Lp(a) levels were an independent
risk factor for carotid atherosclerosis in subjects
younger than 60 years of age.36 Plaque rupture and
fissuring is a major determinant of thrombosis complicating
atherosclerosis. By being involved in
atherosclerosis, Lp(a) may play an indirect role in the
pathogenesis of embolic strokes. Lacunes have long been thought to be
due to occlusions of the cerebral penetrating arteries related to
hypertensive microvascular disease.37 38 However, the
concept of a relation between hypertension and lacunar strokes has been
disputed.37 38 In the present study, no significant
differences were found in the prevalence of hypertension between the
patients with lacunar and other types of stroke. On the other hand, a
limited role is currently attributed to Lp(a) in the pathogenesis of
lacunar ischemia.25 36 Our data support the latter
formulation.
The mechanisms regulating plasma Lp(a) levels are poorly understood. Plasma Lp(a) concentrations vary greatly in the human population, but unlike other lipoproteins, interindividual differences are almost entirely genetically determined.39 In the present study, the G/A-914 substitution in the 5' flanking region of the apo(a) gene that has been related to different plasma concentrations of Lp(a)20 did not appear to contribute to plasma Lp(a) levels. In addition, the allele did not clearly account for the high plasma PAI-1 levels of subjects with a history of ischemic stroke. Much of the data on the association between Lp(a) plasma levels and molecular variations of the apo(a) gene locus may be underestimated, as studies in progress have shown other polymorphisms.17 20 On the other hand, 19% to as much as 70% of the variance of Lp(a) plasma levels can be explained by apo(a) size.39 Variability in apo(a) size may be due to differences in glycosylation. Carbohydrates represent 25% to 40% of the weight of apo(a).16 17 Posttranslational mechanisms, eg, protein removal from the bloodstream, are affected by the degree of glycosylation and might differentially affect the different Lp(a) isoforms.16 17
A strong, long-term relation between impaired fibrinolytic activity
and incidence of ischemic events has been
suggested.40 41 42 43 44 45 46 47 48 49
TPA activates the conversion of
plasminogen to plasmin, thus promoting
fibrinolysis. However, in spite of this, the
association between high levels of TPA and ischemic events has
gained increasing support. Increased levels of TPA have been associated
with coronary artery disease,40 43 48 and
in a
7-year follow-up study,50 TPA antigen has been shown
to be a risk factor for long-term mortality in patients with angina
pectoris and coronary artery stenosis.50 A
large-scale prospective study has shown a predictive power of TPA
antigen on stroke.51 To clarify the apparently paradoxical
association of ischemic events with the plasma levels of a
factor that promotes fibrinolysis, one should consider
that TPA covalently binds to a series of inhibitors of
fibrinolysis, including PAI-1, 
2
antiplasmin, and 2 macroglobulin.18 The
enzymatically active fraction of TPA (ie, TPA activity) is the portion
of this enzyme that is not bound to PAI-1 or to any other
inhibitor.18 Concentrations of TPA antigen
above normal ranges are reported in subjects with high plasma PAI-1
levels.31 There is a negative correlation between TPA
antigen and TPA activity in plasma samples.31 Actually, an
increase in TPA antigen is thought to reflect an inhibitory
effect of PAI-1 on TPA activity.18 Thus, the combined data
are consistent with the concept that TPA levels rise with an
increase in PAI-1 inhibition, so that high levels of either factor
reflect reduced fibrinolysis. The mechanisms that lead
to high levels of TPA in these patients are still a matter of
investigation. TPA and PAI are released from perturbed
endothelial cells.18 Especially when
combined, risk factors may trigger a vascular injury that in turn leads
to inflammatory and proliferative events.18 TPA may be a
marker of preclinical atherosclerosis in apparently
healthy individuals.51 PAI-1 is also known to be released
from activated platelets.31 33 The extent to
which raised levels of fibrinolytic indexes reflect a vascular injury
and/or the effect of platelet activation cannot be ruled out by the
present data. However, in spite of these uncertainties, the
abnormally high levels of fibrin associated with hypofibrinolytic
states may greatly amplify an inflammatory and proliferative
response.18
The present data indicate that among individuals younger than 70 years of age attending a metabolic ward, raised TPA and PAI-1 plasma levels significantly discriminated between subjects with and without a history of stroke. The data also imply that the relationship between Lp(a) and cerebral ischemia is limited to individuals below 70 years of age with elevated plasma levels of the lipoprotein. These findings may help to define new strategies and design new prospective studies in cerebrovascular disease.
|
Selected Abbreviations and Acronyms |
|---|
|
|
Acknowledgments |
|---|
The authors wish to thank Drs Elena Tremoli and Rosanna Scala for helpful suggestions.
Received July 25, 1994; accepted September 18, 1995.
|
References |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
1. Berg K. A new serum type system: the Lp-system. Acta Pathol Scand. 1963;59(suppl 166/167):369-382.
2. Seed M, Hoppichler F, Reaveley D, McCarthy S, Thompson GR, Boerwinkle E, Uteran G. Relation of serum lipoprotein(a) concentration and apolipoprotein(a) phenotype to coronary heart disease in patients with familial hypercholesterolemia. N Engl J Med. 1990;322:1494-1499. [Abstract]
3. Wiklund O, Angelin B, Olofsson SO, Eriksson M, Fager G, Berglund L, Bondjers G. Apolipoprotein(a) and ischemic heart disease in familial hypercholesterolemia. Lancet. 1990;335:1360-1363. [Medline] [Order article via Infotrieve]
4.
Schaefer EJ, Lamon-Fava S, Jenner J, McNamara JR,
Ordovas JM, Davis CE, Abolafia SM, Lippel K, Levy RI.
Lipoprotein(a) levels and risk of coronary heart disease in
men: the Lipid Research Clinics Coronary Primary Prevention
Trial. JAMA. 1994;271:999-1003.
5. Rhoads G, Dahlen G, Berg K, Morton NE, Dannenberg AL. Lp(a) lipoprotein as a risk factor for myocardial infarction. JAMA. 1986;18:2540-2544.
6.
Sandkamp M, Funke H, Shulte H, Kohler E, Assmann
G. Lipoprotein(a) is an independent risk factor for myocardial
infarction at young age. Clin Chem. 1990;36:20-23.
7. Armstrong VW, Cremer P, Eberle E, Manke A, Schulze F, Wieland H, Kreuzer H, Seidel D. The association between serum Lp(a) concentrations and angiographically assessed coronary atherosclerosis. Atherosclerosis. 1986;62:249-257. [Medline] [Order article via Infotrieve]
8.
Dahlen GH, Guyton JR, Arrar M, Farmer JA, Kautz JA,
Gotto AM. Association of level of lipoprotein(a), plasma lipids
and other lipoproteins with coronary artery disease documented
by angiography. Circulation. 1986;74:758-765.
9. Hoff HF, Beck GJ, Skibinski CI, Jurgens G, O'Neil J, Kramer J, Lytle B. Serum Lp(a) level as a predictor of vein graft stenosis after coronary artery bypass surgery in patients. Circulation. 1988;76:1238-1244.
10.
Zenker G, Koltringer P, Noné G, Niederkorn K,
Pfeiffer K, Jurgens J. Lipoprotein(a) as a strong indicator for
cerebrovascular disease. Stroke. 1986;17:942-945.
11. Murai A, Miyahara T, Fujimoto N, Matsuda M, Kameyama M. Lp(a) as a risk factor for coronary heart disease and cerebral infarction. Atherosclerosis. 1986;59:199-204. [Medline] [Order article via Infotrieve]
12. Jauhiainen M, Koskinen P, Ehnholm C, Frick MH, Manttari M, Manninen V, Huttunen JK. Lipoprotein(a) and coronary heart disease risk: a nested case-control study of the Helsinki Heart Study participants. Atherosclerosis. 1991;89:59-67. [Medline] [Order article via Infotrieve]
13.
Ridker PM, Hennekens CH, Stampfer MJ. A
prospective study of lipoprotein(a) and the risk of myocardial
infarction. JAMA. 1993;270:2195-2199.
14. Marburger C, Hambrecht R, Niebauer J, Schoeppenthau M, Scheffler E, Hauer K, Schulter G, Schlierf G. Association between lipoprotein(a) and progression of coronary artery disease in middle-aged men. Am J Cardiol. 1994,73:742-746.
15. Ridker PM, Stampfer MJ, Hennekens CH. Plasma concentrations of lipoprotein(a) and the risk of future stroke. JAMA. 1995;278:1269-1273.
16. Etingin OR, Hajjar DP, Hajjar KA, Harpel PC, Nachman RL. Lipoprotein(a) regulates plasminogen activator inhibitor-1 expression in endothelial cells: a potential mechanism in thrombogenesis. J Biol Chem. 1991;288:2459-2465.
17. Scanu AM, Fless GM. Lipoprotein (a) heterogeneity and biological relevance. J Clin Invest. 1990;85:1709-1715.
18.
Margaglione M, Di Minno G, Grandone E, Vecchione A,
Celentano E, Capucci A, Grilli M, Simone P, Panico S, Mancini M.
Abnormally high circulating levels of tissue plasminogen
activator and plasminogen activator
inhibitor–1 in subjects with a history of ischemic
stroke. Arterioscler Thromb. 1994;14:1741-1745.
19. Cohen JC, Chiesa G, Hobbs HH. Sequence polymorphisms in the apolipoprotein(a) gene. Evidence for dissociation between apoprotein(a) size and plasma lipoprotein(a) levels. J Clin Invest. 1993;91:1630-1636.
20.
Wade DP, Klarke JC, Lindahl GE, Liu AC, Zysow BR, Meer
K, Schwartz K, Lawn RM. 5' control regions of the apoprotein(a)
gene and members of the related plasminogen gene
family. Proc Natl Acad Sci U S A. 1993;90:1369-1373.
21. Margaglione M, Di Minno G, Grandone E, Vecchione G, Celentano E, Cappucci G, Giordano M, Grilli M, Simone P, Fusilli S, Panico S, Mancini M. Raised plasma fibrinogen concentrations in subjects attending a metabolic ward: relation to family history and vascular risk factors. Thromb Haemost. 1995,73:479-483.
22. Anderson CS, Jamrozik KD, Broadhurst RJ, Stewart-Wynne EG. Predicting survival for 1 year among different subtypes of stroke: results from the Perth Community Stroke Study. Stroke. 1994;25:1935-1944. [Abstract]
23. Norusis MJ. SPSS/PC+ Base Manual. Version 2.0. Chicago, Ill: SPSS, Inc; 1988.
24. Sing CF, Davignon J. Role of apoprotein E polymorphism in determining normal plasma lipid and lipoprotein variation. Am J Hum Genet.. 1985;37:268-285. [Medline] [Order article via Infotrieve]
25. Nagayama M, Shinohara Y, Nagayama T. Lipoprotein(a) and ischemic cerebrovascular disease in young adults. Stroke. 1994;25:74-78. [Abstract]
26.
Shintani S, Kikuchi S, Hamaguchi H, Shiigai T.
High serum lipoprotein(a) levels are an independent risk factor for
cerebral infarction. Stroke. 1993;24:965-969.
27. Rosengren A, Wilhelmsen L, Eriksson E, Risberg D, Wedel H. Lipoprotein(a) and coronary heart disease: a prospective case-control study in a general population of middle aged men. BMJ. 1990;301:1248-1251.
28. Hearn JA, De Maio SJ, Roubin GS, Hammarstrom M, Sgoutas D. Predictive value of lipoprotein(a) and other serum lipoproteins in the angiographic diagnosis of coronary artery disease. Am J Cardiol. 1990;66:1176-1180. [Medline] [Order article via Infotrieve]
29. Maeda S, Abe A, Seishima M, Makino K, Noma A, Kamade M. Transient changes of serum lipoprotein(a) as an acute-phase protein. Atherosclerosis. 1989;78:145-150. [Medline] [Order article via Infotrieve]
30.
Tohgi H, Takahashi H, Chiba K, Tamura K.
Coagulation/fibrinolysis system in poststroke patients
receiving antiplatelet medication. Stroke. 1993;24:940-943.
31. Bachmann F. Molecular aspects of plasminogen, plasminogen activators and plasmin. In: Bloom AL, Forbes CD, Thomas DP, Tuddenham EG, eds. Haemostasis and Thrombosis. Edinburgh, Scotland: Churchill Livingstone; 1994:575-614.
32. Di Minno G, Cerbone AM, Mattioli PL, Turco S, Iovine C, Mancini M. Functionally thrombasthenic state in normal platelets following the administration of ticlopidine. J Clin Invest.. 1985;75:328-338.
33. Ozturk S, Bruck D, Feinberg WM. Coagulation-fibrinolysis abnormalities in poststroke patients. Stroke. 1994;25:1702-1703. Letter. [Medline] [Order article via Infotrieve]
34. Kimura S, Nishinaga M, Ozawa T, Shimada K. Thrombin generation as an acute effect of cigarette smoking. Am Heart J.. 1994;128:7-11. [Medline] [Order article via Infotrieve]
35. Sacco RL, Ellenberg JH, Mohr JP, Tatemichi TK, Hier DB, Price TR, Wolf PA. Infarcts of undetermined cause: the NINCDS Stroke Data Bank. Ann Neurol. 1989;25:382-390. [Medline] [Order article via Infotrieve]
36. Jurgens G, Koltringer P. Cerebrovascular disease and Lp(a): its role in atherosclerotic plaque formation and vessel wall elasticity of the carotid arteries. Chem Phys Lipids. 1994;67/68:429-434.
37.
Millikan C, Futrell N. The fallacy of the lacune
hypothesis. Stroke.. 1990;21:1251-1257.
38.
Botet JP, Sentí M, Nogues
X, Prat JR, Roquer J,
D'Olhaberrigue L, Olive J. Lipoprotein and apoprotein profile
in men with ischemic stroke: role of lipoprotein(a),
triglyceride-rich lipoproteins, and apoprotein E
polymorphism. Stroke. 1992;23:1556-1562.
39. Boerwinkle E, Leffert CC, Lin J, Lackner C, Chiesa G, Hobbs HH. Apoprotein(a) gene accounts for greater than 90% of the variation in plasma lipoprotein(a) concentrations. J Clin Invest.. 1992;90:52-60.
40. Hamsten A, Wiman B, De Faire U, Blomback M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator inhibitor in young survivors of stroke or myocardial infarction. N Engl J Med. 1985;313:1557-1563. [Abstract]
41. Paramo JA, Colucci M, Collen D, van de Werf F. Plasminogen activator inhibitor in the blood of patients with coronary artery disease. BMJ. 1985;291:573-574.
42.
Hamsten A, Blomback M, Wiman B, Svensson J, Szamosi A,
De Faire U, Mettinger L. Haemostatic function in myocardial
infarction. Br Heart J. 1986;55:58-66.
43.
Aznar J, Estelles A, Tormo G, Sapena P, Blanch S,
Espana F. Plasminogen activator
inhibitor activity and other fibrinolytic variables in
patients with coronary artery disease. Br Heart
J. 1988;59:535-541.
44. Meade TW, Ruddock V, Stirling Y, Chakrabarti R, Miller GJ. Fibrinolytic activity, clotting factors and long-term incidence of ischaemic heart disease in the Northwick Park Heart Study. Lancet. 1993;342:1076-1079. [Medline] [Order article via Infotrieve]
45. Hamsten A, De Faire U, Walldius G, Dahlen G, Szamosi A, Landou C, Blomback M, Wiman B. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet. 1987;2:3-9. [Medline] [Order article via Infotrieve]
46.
Auwerx J, Bouillon R, Collen D, Gebeors J.
Tissue-type plasminogen activator antigen
and plasminogen activator inhibitor
in diabetes mellitus.
Arteriosclerosis. 1988;8:68-72.
47. Juhan-Vague I, Alessi MC, Joly P, Thiriou W, Vague P, Declerck PJ, Senadimigni A, Collen D. Plasma plasminogen activator inhibitor–1 in angina pectoris: influence of plasma insulin and acute-phase response. Arteriosclerosis. 1989;9:381-387.
48.
ECAT Angina Pectoris Study Group. ECAT angina pectoris
study: baseline associations of hemostatic factors with extent of
coronary arteriosclerosis and other
coronary risk factors in 3000 patients with angina pectoris
undergoing coronary angiography. Eur Heart J. 1993;14:8-17.
49.
Gray RP, Patterson DLH, Yudkin JS.
Plasminogen activator inhibitor
activity in diabetic and nondiabetic survivors of myocardial
infarction. Arterioscler Thromb. 1993;13:415-420.
50.
Jansonn JH, Olofsson BO, Nilsson TK. Predictive
value of tissue plasminogen activator mass
concentration on long-term mortality in patients with
coronary heart disease.
Circulation. 1993;88:2030-2034.
51. Ridker PM, Hennekens CH, Stampfer MJ, Manson J, Vaughan DE. Prospective study of endogenous tissue plasminogen activator and risk of stroke. Lancet. 1994;343:940-943.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  J. E. Mallewa, E. Wilkins, J. Vilar, M. Mallewa, D. Doran, D. Back, and M. Pirmohamed HIV-associated lipodystrophy: a review of underlying mechanisms and therapeutic options J. Antimicrob. Chemother., October 1, 2008; 62(4): 648 - 660. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Zambrelli, E. Emanuele, S. Marcheselli, L. Montagna, D. Geroldi, and G. Micieli Apo(a) size in ischemic stroke: Relation with subtype and severity on hospital admission Neurology, April 26, 2005; 64(8): 1366 - 1370. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J Milionis, A. F Winder, and D. P Mikhailidis Lipoprotein (a) and stroke J. Clin. Pathol., July 1, 2000; 53(7): 487 - 496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Margaglione, G. Cappucci, M. d'Addedda, D. Colaizzo, N. Giuliani, G. Vecchione, G. Mascolo, E. Grandone, and G. Di Minno PAI-1 Plasma Levels in a General Population Without Clinical Evidence of Atherosclerosis : Relation to Environmental and Genetic Determinants Arterioscler Thromb Vasc Biol, April 1, 1998; 18(4): 562 - 567. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Debus, H. G. Koch, G. Kurlemann, R. Sträter, H. Vielhaber, P. Weber, and U. Nowak-Göttl Factor V Leiden and genetic defects of thrombophilia in childhood porencephaly Arch. Dis. Child. Fetal Neonatal Ed., March 1, 1998; 78(2): 121F - 124. [Abstract] [Full Text]
|
|
|
|
|
|
M. Margaglione, G. Cappucci, D. Colaizzo, N. Giuliani, G. Vecchione, E. Grandone, O. Pennelli, and G. Di Minno The PAI-1 Gene Locus 4G/5G Polymorphism Is Associated With a Family History of Coronary Artery Disease Arterioscler Thromb Vasc Biol, February 1, 1998; 18(2): 152 - 156. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Margaglione, D. Seripa, C. Gravina, E. Grandone, G. Vecchione, G. Cappucci, G. Merla, S. Papa, A. Postiglione, G. Di Minno, et al. Prevalence of Apolipoprotein E Alleles in Healthy Subjects and Survivors of Ischemic Stroke : An Italian Case-Control Study Stroke, February 1, 1998; 29(2): 399 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Margaglione, E. Grandone, G. Vecchione, G. Cappucci, N. Giuliani, D. Colaizzo, E. Celentano, S. Panico, and G. Di Minno Plasminogen Activator Inhibitor-1 (PAI-1) Antigen Plasma Levels in Subjects Attending a Metabolic Ward: Relation to Polymorphisms of PAI-1 and Angiontensin Converting Enzyme (ACE) Genes Arterioscler Thromb Vasc Biol, October 1, 1997; 17(10): 2082 - 2087. [Abstract] [Full Text]
|
|
|
|
 |
|
 U. Nowak-Gottl, O. Debus, M. Findeisen, R. Kassenbohmer, H. G. Koch, H. Pollmann, C. Postler, P. Weber, and H. Vielhaber Lipoprotein (a): Its Role in Childhood Thromboembolism Pediatrics, June 1, 1997; 99(6): e11 - e11. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Margaglione, E. Celentano, E. Grandone, G. Vecchione, G. Cappucci, N. Giuliani, D. Colaizzo, S. Panico, F. P. Mancini, and G. Di Minno Deletion Polymorphism in the Angiotensin-Converting Enzyme Gene in Patients With a History of Ischemic Stroke Arterioscler Thromb Vasc Biol, February 1, 1996; 16(2): 304 - 309. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||