Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1287-1293

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ilmonen, M.
Right arrow Articles by Tikkanen, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ilmonen, M.
Right arrow Articles by Tikkanen, M. J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Dietary Fats
*Genetics Home Reference
Hazardous Substances DB
*L-SERINE
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1287-1293.)
© 1995 American Heart Association, Inc.

Articles

Two New Immunogenetic Polymorphisms of the ApoB Gene and Their Effect on Serum Lipid Levels and Responses to Changes in Dietary Fat Intake

Marja Ilmonen; Tiina Heliö; René Bütler; Aarno Palotie; Pirjo Pietinen; Jussi K. Huttunen; Matti J. Tikkanen

From the Department of Medicine, Division of Cardiology, Helsinki University Central Hospital (M.I., T.H., M.J.T.), the Department of Clinical Chemistry, University of Helsinki (A.P.), the National Public Health Institute (P.P., J.K.H.), Helsinki, Finland, and the Blood Transfusion Service of the Swiss Red Cross, Bern, Switzerland (R.B.).

Correspondence to Marja Ilmonen, MD, Helsinki University Central Hospital, Department of Medicine, Laboratory of Biochemistry L222, Haartmaninkatu 4, FIN-00290 Helsinki, Finland.


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Abstract In previous studies, apoB polymorphisms have been shown to modify serum lipid responses to changes in dietary fat intake. The functionally important apoB DNA change or changes underlying these effects have, however, remained unknown. Using a single-strand conformation polymorphism analysis–based screening method, we identified two previously unreported apoB polymorphisms located close to each other in the 5' region of apoB gene exon 26. This DNA segment corresponds to the binding site of monoclonal anti-apoB antibody D7.2. The two A->G changes at apoB cDNA nucleotides 5869 and 5896 produced an Asn->Ser change at amino acid 1887 and a His->Arg change at amino acid 1896. In the Finnish population, allele frequencies of the rare alleles of the apoB 1887 (Asn->Ser) and apoB 1896 (His->Arg) polymorphisms were .02 and .11, respectively. Both polymorphisms were shown to have an independent effect on the binding affinity of LDL with monoclonal antibody D7.2. The effect of these polymorphisms on serum lipid levels and responses to changes in dietary fat intake in 102 healthy free-living subjects was assessed. The apoB 1896 Arg allele was associated with a higher serum LDL cholesterol level during a low-fat, low-cholesterol diet in men.


Key Words: apoB gene polymorphisms • apoB antigenic polymorphisms • low-fat, low-cholesterol diet


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
The first polymorphisms described for apoB were protein polymorphisms detected by use of alloantibodies produced in multiply transfused patients.1 These Ag polymorphisms were based on antigens a1/d, c/g, h/i, t/z, and x/y, which appeared to be products of five closely linked allele pairs.2 The Ag(x/y)3 and Ag(c/g)4 polymorphisms were shown to be slightly but significantly associated with serum lipid levels. Further studies have characterized DNA changes in the apoB gene corresponding to each of the five Ag epitopes.5 6 7 8 9 10 11 12 The silent Xba I restriction fragment length polymorphism of apoB13 14 was shown to be associated with the Ag system5 6 15 16 17 18 as well as with serum apoB, cholesterol, and triglyceride levels in many16 17 19 20 21 22 23 but not all24 25 26 27 28 studies. These findings suggested that apoB DNA sequence changes contributed in some yet undefined way to the regulation of serum lipid levels.

Our previous studies gave preliminary indications that common apolipoprotein polymorphisms modified serum lipid responses to changes in dietary fat intake29 30 31 32 33 and thereby influenced lipid levels. The apoB DNA change or changes presumably underlying these effects remain unknown. On this basis, we set out to screen the coding regions of the apoB gene for yet unknown functionally important DNA changes by using an SSCP34 35 procedure developed for this purpose.36 Initial SSCP analyses indicated allelic variations in the 5' region of exon 26, a DNA segment corresponding to the binding site of Mab D7.2.37 38 We describe two previously unreported polymorphisms located close to each other in this region and their associations with serum lipoprotein levels and responses to changes in dietary fat intake. These polymorphisms were associated with changes in the binding affinity of LDL with Mab D7.2, generating a new immunogenetic apoB polymorphism.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Subjects
Serum and DNA samples were obtained as described earlier30 from 102 apparently healthy subjects (48 men and 54 women) who had participated in three dietary intervention studies in North Karelia that were reported in 1982-198539 40 41 ; these subjects belonged to identical intervention groups in these studies. The diet intervention consisted of a 2-week baseline period, a 6- or 12-week intervention period with a low-fat, low-cholesterol diet with a ratio of polyunsaturated to saturated fatty acids equal to 1, and a 5- to 6-week switchback period. During the baseline and switchback periods, the participants were on their normal free-choice diets. Serum and DNA samples were also obtained from family members of the two study participants showing the most marked shifts in their Mab D7.2 displacement curves.

Lipid and Lipoprotein Determinations
Blood was drawn after an overnight fast. Serum cholesterol and triglyceride concentrations were determined by use of an enzymatic assay (Boehringer Mannheim). HDL cholesterol was measured after precipitation of VLDL and LDL with dextran sulfate–magnesium chloride.42 Serum LDL cholesterol concentration was calculated by use of the Friedewald approximation.43 The concentration of apoB was determined with a radial immunodiffusion method (Behring-Werke AG). LDL (d=1.019 to 1.050 g/mL) was isolated by sequential ultracentrifugation.44

Antibody Binding Assays and Ag Phenotyping
A solid-phase enzyme-linked immunosorbent assay45 with a large panel of monoclonal antibodies was used to screen for apoB variants. The evaluation of Ag antigenic determinants was carried out on the LDL of all diet study participants by passive hemagglutination inhibition according to the technique developed by Bütler and coworkers46 47 with human antisera used against the Ag factors (x, y, a1, d, c, g, t, z, h, and i). Antibody D7.2 was a generous gift from Dr Gus Schonfeld and Dr Elaine Krul (Lipid Research Center, Washington University, St. Louis, Mo.).

DNA Analyses
Genomic DNA was isolated from frozen whole blood by a Triton X-100 lysis method.48 SSCP analysis from a 1366-bp fragment located in the 5' end of apoB gene exon 26 containing cDNA nucleotides 5641 to 700749 and spanning amino acids 1811 to 2266 was carried out as described earlier.36 The primers used in the PCR were 5' ACATCTATGCCATCTCTTCTG (upstream [A]; nucleotides 5641 to 5661) and 5' ATCAATAGCCTCAATGTGTTG (downstream [B]; nucleotides 6987 to 7007). Amplification reactions were conducted in an automatic Perkin Elmer/Cetus Thermal Cycler using Taq DNA polymerase (Promega). Reaction conditions after the initial denaturation step (5 minutes at 95°C) were 29 cycles of 94°C (1 minute), then 60°C (1 minute), then 72°C (5 minutes). The amplification products were further split with restriction enzymes (New England Biolabs) Ban I (cutting site at nucleotide 6063) and EcoRI (cutting site at nucleotide 6506) into 422-, 443-, and 501-bp segments. SSCP analyses were carried out in 0% to 10% glycerol, 0.5x to 1xTris-borate/EDTA, nondenaturing 5% polyacrylamide gels.

The 422-bp segment cut from the amplified PCR fragment by BanI was sequenced according to a slightly modified method described by Syvänen et al.50 Genomic DNA was amplified by use of primers C (5' CCTACCAAAATAATGAAATAAAAC [upstream; nucleotides 5617 to 5640]) and D (5' TCTTGAGTTTCCAGGTGCCT [downstream; nucleotides 6062 to 6081]), primer C being biotinylated at its 5' end. After initial denaturation, 27 cycles of 94°C (1 minute), then 58°C (1 minute), then 72°C (2 minutes) followed. The biotinylated amplified 461-bp DNA strands were purified with avidin-coated polystyrene particles,36 after which procedure the single-stranded amplification product was sequenced by the Sanger dideoxynucleotide termination method51 with T7 DNA polymerase (Sequenase version 2.0, United States Biochemical) and oligonucleotide D as the sequencing primer.

Genotyping of the apoB 1887 (Asn->Ser) and apoB 1896 (His->Arg) changes was carried out by amplification of the 441-bp segment (nucleotides 5641 to 6081) containing these nucleotide changes with primers A and D and digestion of the amplification product with restriction endonucleases (New England Biolabs) BsrDI (apoB 1887) and Rsa I (apoB 1896). The digestion reactions were conducted in a total volume of 30 µL containing 10 µL of the PCR product in conditions recommended by the manufacturer (incubation at 65°C for BsrDI and 37°C for Rsa I). The presence or absence of cutting sites of each enzyme was verified by use of 3% agarose electrophoresis gels followed by ethidium bromide staining. In the 441-bp amplification product, normal digestion reactions with BsrDI (at nucleotides 5813 and 5873) produce three digestion fragments that are 60, 173, and 208 bp in size. In the absence of the 5873 cutting site, only 173- and 268-bp fragments are produced. Rsa I normally has no cutting site in the 441-bp fragment. The variant nucleotide 5897 cutting site results in two fragments, 185 and 256 bp in size, in the digestion reaction.

ApoB 3'VNTR genotyping was carried out as described by Heliö52 by amplification of the DNA segment overlapping the 3'VNTR region and separating the different-sized alleles with denaturing polyacrylamide gel electrophoresis. In this study, the terminology established by Boerwinkle et al53 to define the number of repeats was used. The apoB Xba I polymorphism was genotyped by Xba I digestion, Southern blotting, and hybridization techniques.30

Statistical Methods
Statistical analysis was carried out with the BMDP statistical software package (BMDP Statistical Software Inc). The mean values of serum lipid and lipoprotein levels between different genotypes were compared by ANOVA. With regard to differences in serum lipid responses in different genotypes, statistical calculations were repeated after adjustment for changes in body mass index. The associations between the apoB 1887 (Asn->Ser) and apoB 1896 (His->Arg) polymorphisms and the Mab D7.2 antigenic polymorphism were estimated by both {chi}2 analysis and Fisher's exact test.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowReferences
 
Studies on the Immunoreactivity of LDL ApoB
LDLs obtained from the diet study participants were tested for apoB variants with a panel of monoclonal antibodies. In 18 of the 102 subjects, a marked shift to the right of displacement curves against antibody D7.2 could be detected. In 2 individuals, this change in binding affinity was clearly stronger than in the remaining 16. The strong displacement curve shifts were evident in some of the family members of these probands, suggesting that the change was genetically determined (Fig 1aDown to 1c). With other antibodies, including antibody B1B3, which was used as a reference standard, the LDLs reacted uniformly, as expected (Fig 1dDown). The epitope of antibody D7.2 is between amino acids 1878 and 2148, and the epitope of B1B3 is between amino acid residues 3506 and 3635.38 Antibody B1B354 but not antibody D7.237 inhibits the binding of LDL to the LDL receptor.



View larger version (27K):
[in this window]
[in a new window]
  		Figure 1. a, Graph shows results of Mab D7.2 binding assay demonstrating genetically determined alterations in LDL binding affinity. LDLs from the proband (AK) and two of her sisters (see pedigree A in Fig 3Up) reacted with Mab D7.2 with low affinity, those from one sister reacted with intermediate affinity, and those from the spouse of the proband reacted with high (normal) affinity. b, Graph shows results of Mab D7.2 binding assay from a family (see Fig 3Up, pedigree C) with the apoB 1887 (Asn->Ser) polymorphism. The assay shows reduced binding of plasma LDL of the Asn/Ser heterozygotes HP, IP, and PP with Mab D7.2. In this family, only plasma samples instead of LDL were available. c, Mab D7.2 binding curve of a family (Fig 3Up, pedigree D) shows reduced binding of the LDLs from the apoB 1896 His/Arg heterozygotes ET and HT. std indicates curve produced by wild-type control LDL used as standard in assays on different microtiter plates. d, Reference antibody B1B3 binding curve from family D shows uniform reactivity of their LDL against the antibody.

SSCP Analysis and Sequencing Reactions
To explore the DNA sequence changes causing the altered binding affinity of apoB with Mab D7.2, SSCP analysis of the DNA fragment containing the sequence coding for the epitope of Mab D7.2 was carried out (Fig 2aDown). In this analysis, the 422-bp digestion product cut from the amplified fragment by Ban I showed a complex mobility pattern suggesting either a three-allelic polymorphism or two closely located mutations.



View larger version (43K):
[in this window]
[in a new window]
  		Figure 2. a, Photograph shows SSCP analysis from family A. A complex polymorphic moving pattern in the 422-bp DNA fragment cut from the original PCR product with Ban I is seen. Lanes 1 to 5 (see pedigree A in Fig 3Up) represent the first generation (from left to right) and lanes 6 and 7 represent the two sons of the proband. Four different moving patterns indicating at least three different alleles are seen. Lanes 2, 3, and 5 originating from DNA samples from the three sisters exhibiting low binding affinity to Mab D7.2 are identical. Lanes 6 and 7 come from the two sons of the proband who later proved to be heterozygotes for the apoB 1896 Arg allele. Lane 1 represents the sister of the proband, and has intermediate binding affinity carrying the apoB 1887 Ser allele, and lane 4 represents the spouse of the proband, and has normal binding affinity. b, Photograph shows sequencing reactions from a compound heterozygote (lanes G, T, A, and C on the left) showing A->G nucleotide changes at locations 5869 and 5896 and from a simple apoB 1896 His/Arg heterozygote (lanes G, T, A, and C on the right) showing an A->G change at nucleotide 5896 only.

Sequencing reactions in samples obtained from the family members revealed two DNA changes: an A->G change at nucleotide 5869, changing the code for amino acid 1887 from AAT to AGT with an Asn->Ser change, and another A->G change at nucleotide 5896 with a change from CAT to CGT (His->Arg) at amino acid 1896 (Fig 2bUp). Segregation of both DNA variations was demonstrated in these (Fig 1aUp through 1c) and in several other families (Fig 3Down). Both probands who were originally identified with the Mab binding assay were compound heterozygotes for the two mutations. 3'VNTR analysis in their families showed that the two DNA variations were not located on the same apoB allele. The relationship between each of the DNA variations and the binding affinity of LDL apoB with Mab D7.2 is illustrated in Fig 1bUp and 1cUp. Neither of the DNA variations seemed to affect any lipid parameters in these mainly normolipidemic families (data not shown).



View larger version (21K):
[in this window]
[in a new window]
  		Figure 3. Pedigrees from four Finnish families show the inheritance of the apoB 1887 (Asn->Ser) and apoB 1896 (His->Arg) polymorphisms on different apoB 3'VNTR alleles. Mab D7.2 binding curves from the members of families A, C, and D are seen in Fig 1Up. The probands of families A and B were the two compound heterozygotes originally showing the most markedly reduced binding of their LDLs to Mab D7.2. Dagger indicates a family member who was dead at the time of the study.

Genotyping of the ApoB 1887 (Asn->Ser) and ApoB 1896 (His->Arg) Polymorphisms in the Diet Study Participants
The nucleotide 5869 (A->G) change producing the apoB 1887 Ser allele removes a BsrDI cutting site located at nucleotide 5873. The nucleotide 5896 (A->G) variation with the apoB 1896 Arg allele produces a new Rsa I cutting site at nucleotide 5897. Both DNA changes can thus be easily detected by simple PCR amplification, restriction enzyme digestion, and agarose gel electrophoresis followed by ethidium bromide staining (see "DNA Analyses"). BsrDI digestion revealed 97 apoB 1887 Asn/Asn genotypes, 5 Asn/Ser genotypes, and no Ser/Ser genotypes among the 102 diet study participants (Table 1Down), with an allele frequency of the rare Ser allele of .02. According to the results of Rsa I digestion, 81 subjects were genotyped as apoB 1896 His/His, 20 as His/Arg, and 1 as Arg/Arg (Table 1Down), corresponding to an allele frequency of the rare Arg allele of .11. No association was detected between the apoB 1887 (Asn->Ser) and the apoB 1896 (His->Arg) polymorphisms ({chi}2=1.416, P=.4926; Fisher's exact test, P{approx}1.0000). The Mab D7.2 binding affinity changes and the newly described DNA variations were compared in the diet study participants. Of the 78 subjects homozygous for the common alleles of both polymorphisms, all except 1 had originally been classified as showing normal immunoreactivity with Mab D7.2. All 5 subjects carrying the apoB 1887 Ser allele, irrespective of their apoB 1896 (His->Arg) genotype, showed reduced binding. The Arg allele of the apoB 1896 (His->Arg) polymorphism did not always associate with detectable shifts in the displacement curves: only 11 of the 18 apoB 1896 His/Arg (apoB 1887 Asn/Asn) heterozygotes had originally been classified as having impaired binding to Mab D7.2. However, a combination of both variant alleles was associated with a shift of the displacement curves even further to the right, suggesting a possible additive effect on the immunoreactivity of LDL with Mab D7.2. The association of the Mab D7.2 polymorphism with the apoB 1887 Asn/Ser and apoB 1896 His/Arg polymorphisms was statistically significant ({chi}2=49.712, P<.0001, and {chi}2=46.261, P<.0001, respectively).


View this table:
[in this window]
[in a new window]
  		Table 1. ApoB 1887 Asn/Ser and ApoB 1896 His/Arg Genotypes in Diet Study Participants

Association of the ApoB 1896 (His->Arg) Polymorphism With Antigenic and Other ApoB Genetic Variants
Ag phenotyping, 3'VNTR genotyping, and Xba I RFLP analysis of the diet study participants showed that all subjects carrying the apoB 1896 Arg allele (His/Arg heterozygotes) were either homozygous or heterozygous for the xa1gti-3'VNTR 35-X- (Xba I restriction site absent) haplotype. In all families with the apoB 1896 (His->Arg) polymorphism studied, the Arg allele was also coinherited with the apoB 3'VNTR 35 and X- alleles (Fig 3Up). With regard to the apoB 1887 Asn->Ser polymorphism, no common haplotype was shared by the subjects carrying the rare allele, in accordance with family studies in this report showing the Ser allele in association with at least two apoB 3'VNTR alleles (33 and 37).

Effect of ApoB 1887 (Asn->Ser) and 1896 (His->Arg) Polymorphisms on Serum Lipid Levels and Response to Dietary Intervention
Statistical calculations in the diet study participants were performed separately for men and women. For the apoB 1887 (Asn->Ser) polymorphism, with only 3 and 2 individuals in the male and female groups, respectively, carrying the apoB 1887 Ser allele, no significant differences in lipid or lipoprotein levels between genotypes were observed (data not shown).

With respect to the apoB 1896 (His->Arg) polymorphism, no significant differences in baseline or switchback levels of serum lipids or lipoproteins could be seen between the His/His and His/Arg groups in men (Table 2Down). During the intervention period, men with the genotype His/Arg tended to have slightly higher serum total cholesterol (P=.0792), LDL cholesterol (P=.0494), and apoB levels (P=.0814) compared with the His/His men. Serum total cholesterol, LDL cholesterol, and apoB responses to dietary intervention in the His/His and His/Arg men are illustrated in Fig 4Down, showing slightly smaller reductions in total and LDL cholesterol in the His/Arg men after the low-fat diet and smaller increases in total cholesterol (P=.0490), LDL cholesterol (P=.0533), and apoB (P=.0340) after they switched back to the original high-fat (free-choice) diet. In women, no significant differences were seen during any study period (data not shown).


View this table:
[in this window]
[in a new window]
  		Table 2. Serum Lipid and Lipoprotein Levels in Men According to ApoB 1896 (His->Arg) Genotype During Baseline, Intervention, and Switchback Diets



View larger version (12K):
[in this window]
[in a new window]
  		Figure 4. Bar graphs show the effects of the apoB 1896 (His->Arg) polymorphism on the total cholesterol (Chol), LDL cholesterol (LDLchol), and apoB response to diet intervention in 37 His/His men (open bars) and 10 His/Arg men (gray bars). I indicates change (mean±SEM) from the baseline diet to the intervention diet; S, change from the intervention to the switchback diet. Adjustment for the change in body mass index after intervention (-0.41±0.36 kg/m2 and -0.35±0.24 kg/m2 in His/His and His/Arg men, respectively) or switchback (0.04±0.33 kg/m2 and -0.01±0.30 kg/m2, respectively) had no effect on the results.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowReferences
 
Since the description of the five Ag antigen pairs and recognition of some of them with monoclonal antibodies, this is the first report of a new immunochemical polymorphism of LDL apoB. Our original unpublished observation of the polymorphism detected with Mab D7.2 dates back several years and was puzzling at that time because the binding curve patterns of the pedigrees studied did not fit into a common two-allelic genetic model. The systematic SSCP-based apoB gene screening system36 provided the means for clarifying the DNA sequence changes responsible for the binding defect. SSCP analyses and subsequent sequencing studies uncovered the presence of two separate, closely located DNA changes, both associated with alterations in the binding affinity of LDL apoB with Mab D7.2. Two probands with the most marked impairment of binding proved to be compound heterozygote for the new polymorphisms, explaining the difficulties in the interpretation of the original binding curves.

Haplotype analysis of the diet study population demonstrated that the apoB 1896 Arg allele was associated with the Ag haplotype xa1gti, the apoB 3'VNTR 35 allele, and the X- allele, whereas no common haplotype could be determined for the apoB 1887 Ser allele. This is in accordance with our family studies showing coinheritance of the apoB 1896 Arg allele and apoB 3'VNTR allele 35, in contrast to the association of the apoB 1887 Ser allele with two different 3'VNTR alleles (33 and 37). With allele frequencies for the rare alleles above .01, both DNA changes described here represent polymorphisms of the apoB gene. In this sample, no association between the two polymorphisms could be detected. However, association tests are not necessarily valid in small samples, and further studies are needed to exclude an association.

The two new apoB polymorphisms are located in a region not believed to have any direct role in the apoB–LDL receptor interaction. Some changes in the surface structure of LDL apoB due to the amino acid changes are, however, likely because the immunoreactivity against Mab D7.2 of LDL apoB was impaired in the carriers of the mutant alleles. The diet study suggested that the LDL cholesterol levels were higher in the His/Arg men during the low-fat diet. This could be related to the tendency in these men to show a reduced total cholesterol and LDL cholesterol response to dietary change, both during intervention and during switchback to the original diet (see Fig 4Up). These findings may represent an example of the variability gene concept.55 56 57 According to this concept, the apoB 1896 Arg allele could exert a restrictive influence on lipid changes. The trends were, however, of borderline significance, and were observed in men only. Thus, our results cannot prove or exclude a true effect of the apoB 1896 polymorphism on lipid metabolism.

In summary, we have characterized a new immunogenetic apoB polymorphism associated with two separate, closely located DNA changes, both of which affect the amino acid sequence of apoB. The possible role of the apoB 1896 (His->Arg) polymorphism in the regulation of serum lipid levels could not be confirmed or ruled out. Further investigations on dietary response in conjunction with turnover studies using labeled apoB 1896 Arg LDL are warranted.


*    Selected Abbreviations and Acronyms
 
3'VNTR = 3' variable number of tandem repeats
Ag = antigen group
Mab = monoclonal antibody
PCR = polymerase chain reaction
SSCP = single-strand conformation polymorphism


*    Acknowledgments
 
This work was supported in part by the State Medical Research Council, Academy of Finland, and by grants from the Finnish Foundation for Cardiovascular Research, the Sigrid Juselius and Paavo Nurmi Foundations. The excellent technical assistance of our laboratory personnel, Terhi Hakala, Päivi Ruha, and Tuula Soppela-Loponen, is gratefully acknowledged.

Received April 4, 1995; accepted June 20, 1995.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Allison AC, Blumberg BS. An isoprecipitation reaction distinguishing human serum-protein types. Lancet. 1991;1:634-637.
  2. Bütler R, Bütler-Brunner E, Scherz R, Pflugshaupt R. The Ag-system of low density lipoprotein—an updating. In: Peeters H, ed. Protides of the Biological Fluids. New York, NY: Pergamon Press; 1978;24:255-262.
  3. Berg K, Hames C, Dahlén G, Frick MH, Krishan I. Genetic variation in serum low density lipoproteins and lipid levels in man. Proc Natl Acad Sci U S A. 1976;73:937-940. [Abstract/Free Full Text]
  4. Tikkanen MJ, Viikari J, Åkerblom HK, Pesonen E. Apolipoprotein B polymorphism and altered apolipoprotein B and low density lipoprotein cholesterol concentrations in Finnish children. Br Med J. 1988;296:169-170.
  5. Ma Y, Schumaker VN, Bütler R, Sparkes RS. Two DNA restriction fragment length polymorphisms associated with Ag(t/z) and Ag(g/c) antigenic sites of human apolipoprotein B. Arteriosclerosis. 1987;7:301-305. [Abstract/Free Full Text]
  6. Dunning AM, Tikkanen MJ, Ehnholm C, Bütler R, Humphries SE. Relationships between DNA and protein polymorphisms of apolipoprotein B. Hum Genet. 1988;78:325-329. [Medline] [Order article via Infotrieve]
  7. Wang X, Schlapfer P, Ma Y, Bütler R, Elovson J, Schumaker VN. Apolipoprotein B: the Ag(a1/d) immunogenetic polymorphism coincides with a T-to-C substitution at nucleotide 1981, creating an Alu I restriction site. Arteriosclerosis. 1988;8:429-435. [Abstract/Free Full Text]
  8. Ma Y, Wang X, Bütler R, Schumaker VN. Bsp 12861 restriction fragment length polymorphism detects Ag(c/g) locus of human apolipoprotein B in all 17 persons studied. Arteriosclerosis. 1989;9:242-246. [Abstract/Free Full Text]
  9. Young SG, Hubl ST. An ApaLI restriction site polymorphism is associated with the MB19 polymorphism in apolipoprotein B. J Lipid Res. 1989;30:443-449. [Abstract]
  10. Xu C, Nanjee N, Tikkanen MJ, Huttunen JK, Pietinen P, Bütler R, Angelico F, Del Ben M, Mazzarella R, Antonio R, Miller NG, Humphries S, Talmud PJ. Apolipoprotein B amino acid 3611 substitution from arginine to glutamine creates the Ag (h/i) epitope: the polymorphism is not associated with differences in serum cholesterol and apolipoprotein B levels. Hum Genet. 1989;82:322-326. [Medline] [Order article via Infotrieve]
  11. Wu MJ, Bütler E, Bütler R, Schumaker VN. Identification of the base substitution responsible for the Ag(x/y) polymorphism of apolipoprotein B-100. Arterioscler Thromb. 1991;11:379-384. [Abstract/Free Full Text]
  12. Dunning AM, Renges HH, Xu CF, Peacock R, Brasseur R, Laxer G, Tikkanen MJ, Bütler R, Saha N, Hamsten A, Rosseneu M, Talmud P, Humphries SE. Two amino acid substitutions in apolipoprotein B are in complete allelic association with the antigen group (x/y) polymorphism: evidence for little recombination in the 3' end of the human gene. Am J Hum Genet. 1992;50:208-221. [Medline] [Order article via Infotrieve]
  13. Blackhart BD, Ludwig EM, Pierotti VR, Caiati L, Onasch MA, Wallis SC, Powell L, Pease R, Knott TJ, Chu ML, Mahley RW, Scott J, McCarthy BJ, Levy-Wilson B. Structure of the human apolipoprotein B gene. J Biol Chem. 1986;261:15364-15367. [Abstract/Free Full Text]
  14. Carlsson P, Darnfors C, Olofsson SO, Bjursell G. Analysis of the human apolipoprotein B gene: complete structure of the B-74 region. Gene. 1986;49:29-51. [Medline] [Order article via Infotrieve]
  15. Berg K, Powell LM, Wallis SC, Pease R, Knott TJ, Scott J. Genetic linkage between the antigenic group (Ag) variation and the apolipoprotein B gene: assignment of the Ag locus. Proc Natl Acad Sci U S A. 1986;83:7367-7370. [Abstract/Free Full Text]
  16. Berg K. DNA polymorphism at the apolipoprotein B locus is associated with lipoprotein level. Clin Genet. 1986;30:515-520. [Medline] [Order article via Infotrieve]
  17. Dunning AM, Duriez P, Vu Dac N, Fruchart JC, Humphries SE. Association between epitopes detected by monoclonal antibody BIP-45 and the XbaI polymorphism of apolipoprotein B. Clin Genet. 1988;33:181-188. [Medline] [Order article via Infotrieve]
  18. Ma Y, Ladias JAA, Bütler R, Schumaker VN, Antonarakis SE, Lusis AJ, Heinzman C, Kwiterovich PO. Apolipoprotein B gene haplotypes: association between Ag and DNA polymorphisms. Arteriosclerosis. 1988;8:521-524. [Abstract/Free Full Text]
  19. Law A, Wallis SC, Powell LM, Pease RJ, Brunt H, Priestley LM, Knott TJ, Scott J, Altman DG, Miller GJ, Rajput J, Miller NE. Common DNA polymorphism within coning sequence of apolipoprotein B gene associated with altered lipid levels. Lancet. 1986;1:1301-1303. [Medline] [Order article via Infotrieve]
  20. Talmud PJ, Barni N, Kessling AM, Carlsson P, Darnfors C, Bjursell G, Galton D, Wynn V, Kirk H, Hayden MR, Humphries SE. Apolipoprotein B gene variants are involved in the determination of serum cholesterol levels: a study in normo- and hyperlipidaemic individuals. Atherosclerosis. 1987;67:81-89. [Medline] [Order article via Infotrieve]
  21. Aalto-Setälä K, Tikkanen MJ, Taskinen MR, Nieminen M, Holmberg P, Kontula K. XbaI and c/g polymorphisms of the apolipoprotein B gene locus are associated with serum cholesterol and LDL-cholesterol levels in Finland. Atherosclerosis. 1988;74:47-54. [Medline] [Order article via Infotrieve]
  22. Aalto-Setälä K, Gylling H, Helve E, Kovanen P, Miettinen TA, Turtola H, Kontula K. Genetic polymorphism of the apolipoprotein B gene locus influences serum LDL cholesterol level in familial hypercholesterolemia. Hum Genet. 1989;82:305-307. [Medline] [Order article via Infotrieve]
  23. Leren TP, Berg K, Hjermann I, Leren P. Further evidence for an association between the XbaI polymorphism at the apolipoprotein B locus and lipoprotein level. Clin Genet. 1988;34:347-351. [Medline] [Order article via Infotrieve]
  24. Hegele RA, Huang LS, Herbert PN, Blum CB, Buring JE, Hennekens CH, Breslow JL. Apolipoprotein B-gene DNA polymorphisms associated with myocardial infarction. N Engl J Med. 1986;315:1509-1515. [Abstract]
  25. Aburatani H, Matsumoto A, Itoh H, Yamada N, Murase T, Takaku F, Itakura H. A study of DNA polymorphism in the apolipoprotein B gene in a Japanese population. Atherosclerosis. 1988;72:71-76. [Medline] [Order article via Infotrieve]
  26. Monsalve MV, Young R, Jobsis J, Wiseman SA, Dhamu S, Powell JT, Greenhalgh RM, Humphries SE. DNA polymorphisms of the gene for apolipoprotein B in patients with peripheral arterial disease. Atherosclerosis. 1988;70:123-129. [Medline] [Order article via Infotrieve]
  27. Rajput-Williams J, Knott TJ, Wallis SC, Sweetnam P, Yarnell J, Cox N, Bell GI, Miller NE, Scott J. Variation of apolipoprotein-B gene is associated with obesity, high blood cholesterol levels, and increased risk of coronary heart disease. Lancet. 1988;2:1442-1446.[Medline] [Order article via Infotrieve]
  28. Darnfors C, Wiklund O, Nilsson J, Gerard B, Carlsson P, Johansson S, Bondjers G, Bjursell G. Lack of correlation between the apolipoprotein B Xba I polymorphism and blood lipid levels in a Swedish population. Atherosclerosis. 1989;75:183-188. [Medline] [Order article via Infotrieve]
  29. Tikkanen MJ, Huttunen JK, Ehnholm C, Pietinen P. Apolipoprotein E4 homozygosity predisposes to serum cholesterol elevation during high-fat diet. Arteriosclerosis. 1990;10:285-288. [Abstract/Free Full Text]
  30. Tikkanen MJ, Xu CF, Hämäläinen T, Talmud P, Sarna S, Huttunen JK, Pietinen P, Humphries S. XbaI polymorphism of the apolipoprotein B gene influences plasma lipid response to diet intervention. Clin Genet. 1990;37:327-334. [Medline] [Order article via Infotrieve]
  31. Xu CF, Boerwinkle E, Tikkanen MJ, Huttunen JK, Humphries SE, Talmud PJ. Genetic variation at the apolipoprotein gene loci contribute to response of plasma lipids to dietary change. Genet Epidemiol. 1990;7:261-275.[Medline] [Order article via Infotrieve]
  32. Xu C, Tikkanen MJ, Huttunen JK, Pietinen P, Bütler R, Humphries S, Talmud P. Apolipoprotein B signal peptide insertion/deletion polymorphism is associated with Ag epitopes and involved in the determination of serum triglyceride levels. J Lipid Res. 1990;31:1255-1261. [Abstract]
  33. Talmud PJ, Boerwinkle E, Xu C, Tikkanen MJ, Pietinen P, Huttunen JK, Humphries S. Dietary intake and gene variation influence the response of plasma lipids to dietary intervention. Genet Epidemiol. 1992;9:249-260. [Medline] [Order article via Infotrieve]
  34. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A. 1989;86:2766-2770. [Abstract/Free Full Text]
  35. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics. 1989;5:874-879. [Medline] [Order article via Infotrieve]
  36. Ilmonen M, Heliö T, Ebeling T, Pyörälä K, Uusitupa M, Palotie A, Tikkanen MJ. Screening for mutations in the exon 26 of the apolipoprotein B gene in hypercholesterolemic Finnish families by the single-strand conformation polymorphism method. Hum Mutat. 1994;4:217-223. [Medline] [Order article via Infotrieve]
  37. Krul ES, Kleinman Y, Kinoshita M, Pfleger B, Oida K, Law A, Scott J, Pease R, Schonfeld G. Regional specificities of monoclonal anti-human apolipoprotein B antibodies. J Lipid Res. 1988;29:937-947. [Abstract]
  38. Krul ES, Kinoshita M, Talmud P, Humphries SE, Turner S, Goldberg AC, Cook K, Boerwinkle E, Schonfeld G. Two distinct truncated apolipoprotein B species in a kindred with hypobetalipoproteinemia. Arteriosclerosis. 1989;9:856-868. [Abstract/Free Full Text]
  39. Ehnholm C, Huttunen JK, Pietinen P, Leino U, Mutanen M, Kostiainen E, Pikkarainen J, Dougherty R, Iacono J, Puska P. Effect of diet on serum lipoproteins in a population with a high risk of coronary heart disease. N Engl J Med. 1982;307:850-855. [Abstract]
  40. Ehnholm C, Huttunen JK, Pietinen P, Leino U, Mutanen M, Kostiainen E, Iacono JM, Dougherty R, Puska P. Effect of a diet low in saturated fatty acids on plasma lipids, lipoproteins, and HDL subfractions. Arteriosclerosis. 1984;4:265-269. [Abstract/Free Full Text]
  41. Kuusi T, Ehnholm C, Huttunen JK, Kostiainen E, Pietinen P, Leino U, Uusitalo U, Nikkari T, Iacono JM, Puska P. Concentration and composition of serum lipoproteins during a low-fat diet at two levels of polyunsaturated fat. J Lipid Res. 1985;26:360-367. [Abstract]
  42. Kostner GM. Enzymatic determination of cholesterol in high-density lipoprotein fractions prepared by polyanion precipitation. Clin Chem. 1976;22:695. Letter.
  43. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem. 1972;18:499-502. [Abstract]
  44. Havel RJ, Eder HA, Bragdon JH. The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J Clin Invest. 1955;34:1345-1353.
  45. Tikkanen MJ, Ehnholm C, Bütler R, Young SG, Curtiss LK, Witztum JL. Monoclonal antibody detects Ag polymorphism of apolipoprotein B. FEBS Lett. 1986;202:54-58. [Medline] [Order article via Infotrieve]
  46. Bütler R, Brunner E. A new sensitive method for studying the polymorphisms of the human low density lipoproteins. Vox Sang. 1966;11:738-740.[Medline] [Order article via Infotrieve]
  47. Bütler R, Brunner E, Vierucci A, Morganti G. Comparative studies on anti-Ag sera in immunodiffusion and in passive hemagglutination methods. Vox Sang. 1967;13:327-345. [Medline] [Order article via Infotrieve]
  48. Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel SS, Miller OJ, Breg WR, Jones HWJ, Rary JM. Analysis of human Y-chromosome-specific reiterated DNA in chromosome variants. Proc Natl Acad Sci U S A. 1977;74:1245-1249. [Abstract/Free Full Text]
  49. Knott TJ, Wallis SC, Powell LM, Pease RJ, Lusis AJ, Blackhart B, McCarthy BJ, Mahley RW, Levy-Wilson B, Scott J. Complete cDNA and derived protein sequence of human apolipoprotein B-100. Nucleic Acids Res. 1986;14:7501-7503. [Free Full Text]
  50. Syvänen AC, Aalto-Setälä K, Kontula K, Söderlund H. Direct sequencing of affinity-captured amplified human DNA: application to the detection of apolipoprotein E polymorphism. FEBS Lett. 1989;258:71-74. [Medline] [Order article via Infotrieve]
  51. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463-5467. [Abstract/Free Full Text]
  52. Heliö T. Concept of VNTR alleles: comparison of apolipoprotein B 3' hypervariable region genotyping results obtained by three methods. Biochem Biophys Res Commun. 1991;181:846-851. [Medline] [Order article via Infotrieve]
  53. Boerwinkle E, Lee SS, Bütler R, Schumaker VN, Chan L. Rapid typing of apolipoprotein B DNA polymorphism by DNA amplification: association between Ag epitopes of human apolipoprotein B-100, a signal peptide insertion/deletion polymorphism, and a 3' flanking DNA variable number of tandem repeats polymorphism of the apolipoprotein B gene. Atherosclerosis. 1990;81:225-232. [Medline] [Order article via Infotrieve]
  54. Tikkanen MJ, Dargar R, Pfleger B, Gonen B, Davie JM, Schonfeld G. Antigenic mapping of human low density lipoprotein with monoclonal antibodies. J Lipid Res. 1982;23:1032-1038. [Abstract]
  55. Berg K. Twin studies of coronary heart disease and its risk factors. Acta Genet Med Gemellol (Roma). 1984;33:349-361. [Medline] [Order article via Infotrieve]
  56. Berg K. Genetics of coronary heart disease and its risk factors. In: Berg K, ed. Medical Genetics: Past, Present, Future. New York, NY: Alan R Liss Inc; 1985:351-374.
  57. Berg K. Normal genetic lipoprotein variations and atherosclerosis. In: Sirtori CR, Nichols AV, Franceschini G, eds. Human Apolipoprotein Mutants: Impact on Atherosclerosis and Longevity. New York, NY: Plenum Press; 1986:31-49.



This article has been cited by other articles:


Home page
 Am. J. Clin. Nutr.Home page
L. F Masson, G. McNeill, and A. Avenell
Genetic variation and the lipid response to dietary intervention: a systematic review
Am. J. Clinical Nutrition, May 1, 2003; 77(5): 1098 - 1111.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
L. Beghin, N. Duhal, P. Poulain, P. Hauw, B. Lacroix, J.-M. Lecerf, J.-P. Bonte, J.-C. Fruchart, and G. Luc
Measurement of apolipoprotein B concentration in plasma lipoproteins by combining selective precipitation and mass spectrometry
J. Lipid Res., July 1, 2000; 41(7): 1172 - 1176.
[Abstract] [Full Text]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
B. Vedie, X. Jeunemaitre, J. L. Megnien, I. Myara, H. Trebeden, A. Simon, and N. Moatti
Charge Heterogeneity of LDL in Asymptomatic Hypercholesterolemic Men Is Related to Lipid Parameters and Variations in the ApoB and CIII Genes
Arterioscler. Thromb. Vasc. Biol., November 1, 1998; 18(11): 1780 - 1789.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ilmonen, M.
Right arrow Articles by Tikkanen, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ilmonen, M.
Right arrow Articles by Tikkanen, M. J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Dietary Fats
*Genetics Home Reference
Hazardous Substances DB
*L-SERINE

ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search
Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited.