| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Articles |
From the Department of Medicine, Division of Cardiology, Helsinki University Central Hospital (M.I., T.H., M.J.T.), the Department of Clinical Chemistry, University of Helsinki (A.P.), the National Public Health Institute (P.P., J.K.H.), Helsinki, Finland, and the Blood Transfusion Service of the Swiss Red Cross, Bern, Switzerland (R.B.).
Correspondence to Marja Ilmonen, MD, Helsinki University Central Hospital, Department of Medicine, Laboratory of Biochemistry L222, Haartmaninkatu 4, FIN-00290 Helsinki, Finland.
| Abstract |
|---|
|
|
|---|
G changes at apoB cDNA
nucleotides 5869 and 5896 produced an Asn
Ser change at
amino acid 1887 and a His
Arg change at amino acid 1896. In the
Finnish population, allele frequencies of the rare alleles of
the apoB 1887 (Asn
Ser) and apoB 1896 (His
Arg) polymorphisms
were .02 and .11, respectively. Both polymorphisms were shown to
have an independent effect on the binding affinity of LDL with
monoclonal antibody D7.2. The effect of these polymorphisms on
serum lipid levels and responses to changes in dietary fat intake in
102 healthy free-living subjects was assessed. The apoB 1896 Arg
allele was associated with a higher serum LDL
cholesterol level during a low-fat,
low-cholesterol diet in men.
Key Words: apoB gene polymorphisms apoB antigenic polymorphisms low-fat, low-cholesterol diet
| Introduction |
|---|
|
|
|---|
Our previous studies gave preliminary indications that common apolipoprotein polymorphisms modified serum lipid responses to changes in dietary fat intake29 30 31 32 33 and thereby influenced lipid levels. The apoB DNA change or changes presumably underlying these effects remain unknown. On this basis, we set out to screen the coding regions of the apoB gene for yet unknown functionally important DNA changes by using an SSCP34 35 procedure developed for this purpose.36 Initial SSCP analyses indicated allelic variations in the 5' region of exon 26, a DNA segment corresponding to the binding site of Mab D7.2.37 38 We describe two previously unreported polymorphisms located close to each other in this region and their associations with serum lipoprotein levels and responses to changes in dietary fat intake. These polymorphisms were associated with changes in the binding affinity of LDL with Mab D7.2, generating a new immunogenetic apoB polymorphism.
| Methods |
|---|
|
|
|---|
Lipid and Lipoprotein Determinations
Blood was drawn after an overnight fast. Serum
cholesterol and triglyceride concentrations
were determined by use of an enzymatic assay (Boehringer
Mannheim). HDL cholesterol was measured after precipitation
of VLDL and LDL with dextran sulfatemagnesium
chloride.42 Serum LDL cholesterol
concentration was calculated by use of the Friedewald
approximation.43 The concentration of apoB was determined
with a radial immunodiffusion method (Behring-Werke AG). LDL
(d=1.019 to 1.050 g/mL) was isolated by sequential
ultracentrifugation.44
Antibody Binding Assays and Ag Phenotyping
A solid-phase enzyme-linked immunosorbent assay45
with a large panel of monoclonal antibodies was used to screen for apoB
variants. The evaluation of Ag antigenic determinants was carried out
on the LDL of all diet study participants by passive hemagglutination
inhibition according to the technique developed by Bütler and
coworkers46 47 with human antisera used against the Ag
factors (x, y, a1, d, c, g, t, z, h, and i).
Antibody D7.2 was a generous gift from Dr Gus Schonfeld and Dr Elaine
Krul (Lipid Research Center, Washington University, St. Louis,
Mo.).
DNA Analyses
Genomic DNA was isolated from frozen whole blood by a Triton
X-100 lysis method.48 SSCP analysis from a 1366-bp
fragment located in the 5' end of apoB gene exon 26 containing cDNA
nucleotides 5641 to 700749 and spanning amino
acids 1811 to 2266 was carried out as described earlier.36
The primers used in the PCR were 5' ACATCTATGCCATCTCTTCTG (upstream
[A]; nucleotides 5641 to 5661) and 5'
ATCAATAGCCTCAATGTGTTG (downstream [B]; nucleotides 6987
to 7007). Amplification reactions were conducted in an automatic Perkin
Elmer/Cetus Thermal Cycler using Taq DNA polymerase
(Promega). Reaction conditions after the initial denaturation step (5
minutes at 95°C) were 29 cycles of 94°C (1 minute), then 60°C (1
minute), then 72°C (5 minutes). The amplification products were
further split with restriction enzymes (New England Biolabs)
Ban I (cutting site at nucleotide 6063) and
EcoRI (cutting site at nucleotide 6506) into
422-, 443-, and 501-bp segments. SSCP analyses were carried out
in 0% to 10% glycerol, 0.5x to 1xTris-borate/EDTA, nondenaturing
5% polyacrylamide gels.
The 422-bp segment cut from the amplified PCR fragment by BanI was sequenced according to a slightly modified method described by Syvänen et al.50 Genomic DNA was amplified by use of primers C (5' CCTACCAAAATAATGAAATAAAAC [upstream; nucleotides 5617 to 5640]) and D (5' TCTTGAGTTTCCAGGTGCCT [downstream; nucleotides 6062 to 6081]), primer C being biotinylated at its 5' end. After initial denaturation, 27 cycles of 94°C (1 minute), then 58°C (1 minute), then 72°C (2 minutes) followed. The biotinylated amplified 461-bp DNA strands were purified with avidin-coated polystyrene particles,36 after which procedure the single-stranded amplification product was sequenced by the Sanger dideoxynucleotide termination method51 with T7 DNA polymerase (Sequenase version 2.0, United States Biochemical) and oligonucleotide D as the sequencing primer.
Genotyping of the apoB 1887 (Asn
Ser) and apoB 1896 (His
Arg)
changes was carried out by amplification of the 441-bp segment
(nucleotides 5641 to 6081) containing these
nucleotide changes with primers A and D and digestion of
the amplification product with restriction endonucleases (New
England Biolabs) BsrDI (apoB 1887) and Rsa I
(apoB 1896). The digestion reactions were conducted in a total volume
of 30 µL containing 10 µL of the PCR product in conditions
recommended by the manufacturer (incubation at 65°C for
BsrDI and 37°C for Rsa I). The presence or
absence of cutting sites of each enzyme was verified by use of 3%
agarose electrophoresis gels followed by ethidium bromide staining. In
the 441-bp amplification product, normal digestion reactions with
BsrDI (at nucleotides 5813 and 5873) produce
three digestion fragments that are 60, 173, and 208 bp in size. In the
absence of the 5873 cutting site, only 173- and 268-bp fragments are
produced. Rsa I normally has no cutting site in the 441-bp
fragment. The variant nucleotide 5897 cutting site results
in two fragments, 185 and 256 bp in size, in the digestion
reaction.
ApoB 3'VNTR genotyping was carried out as described by Heliö52 by amplification of the DNA segment overlapping the 3'VNTR region and separating the different-sized alleles with denaturing polyacrylamide gel electrophoresis. In this study, the terminology established by Boerwinkle et al53 to define the number of repeats was used. The apoB Xba I polymorphism was genotyped by Xba I digestion, Southern blotting, and hybridization techniques.30
Statistical Methods
Statistical analysis was carried out with the
BMDP statistical software package (BMDP Statistical
Software Inc). The mean values of serum lipid and lipoprotein levels
between different genotypes were compared by ANOVA. With regard
to differences in serum lipid responses in different genotypes,
statistical calculations were repeated after adjustment for changes in
body mass index. The associations between the apoB 1887 (Asn
Ser) and
apoB 1896 (His
Arg) polymorphisms and the Mab D7.2 antigenic
polymorphism were estimated by both
2
analysis and Fisher's exact test.
| Results |
|---|
|
|
|---|
|
SSCP Analysis and Sequencing Reactions
To explore the DNA sequence changes causing the altered binding
affinity of apoB with Mab D7.2, SSCP analysis of the DNA
fragment containing the sequence coding for the epitope of Mab D7.2 was
carried out (Fig 2a
). In this analysis, the
422-bp digestion product cut from the amplified fragment by
Ban I showed a complex mobility pattern suggesting either a
three-allelic polymorphism or two closely located mutations.
|
Sequencing reactions in samples obtained from the family members
revealed two DNA changes: an A
G change at nucleotide
5869, changing the code for amino acid 1887 from AAT to AGT with an
Asn
Ser change, and another A
G change at nucleotide
5896 with a change from CAT to CGT (His
Arg) at amino acid 1896 (Fig 2b
). Segregation of both DNA variations was demonstrated in these (Fig 1a
through 1c) and in several other families (Fig 3
).
Both probands who were originally identified with the Mab binding assay
were compound heterozygotes for the two mutations. 3'VNTR
analysis in their families showed that the two DNA variations
were not located on the same apoB allele. The relationship between
each of the DNA variations and the binding affinity of LDL apoB with
Mab D7.2 is illustrated in Fig 1b
and 1c
. Neither of the DNA variations
seemed to affect any lipid parameters in these mainly
normolipidemic families (data not shown).
|
Genotyping of the ApoB 1887 (Asn
Ser) and ApoB 1896 (His
Arg)
Polymorphisms in the Diet Study Participants
The nucleotide 5869 (A
G) change producing the apoB
1887 Ser allele removes a BsrDI cutting site located at
nucleotide 5873. The nucleotide 5896 (A
G)
variation with the apoB 1896 Arg allele produces a new
Rsa I cutting site at nucleotide 5897. Both DNA
changes can thus be easily detected by simple PCR amplification,
restriction enzyme digestion, and agarose gel electrophoresis followed
by ethidium bromide staining (see "DNA Analyses").
BsrDI digestion revealed 97 apoB 1887 Asn/Asn
genotypes, 5 Asn/Ser genotypes, and no Ser/Ser
genotypes among the 102 diet study participants (Table 1
), with an allele frequency of the rare Ser
allele of .02. According to the results of Rsa I
digestion, 81 subjects were genotyped as apoB 1896 His/His, 20
as His/Arg, and 1 as Arg/Arg (Table 1
), corresponding to an allele
frequency of the rare Arg allele of .11. No association was
detected between the apoB 1887 (Asn
Ser) and the apoB 1896
(His
Arg) polymorphisms (
2=1.416,
P=.4926; Fisher's exact test, P
1.0000). The
Mab D7.2 binding affinity changes and the newly described DNA
variations were compared in the diet study participants. Of the 78
subjects homozygous for the common alleles of both
polymorphisms, all except 1 had originally been classified as
showing normal immunoreactivity with Mab D7.2. All 5 subjects carrying
the apoB 1887 Ser allele, irrespective of their apoB 1896
(His
Arg) genotype, showed reduced binding. The Arg
allele of the apoB 1896 (His
Arg) polymorphism did not always
associate with detectable shifts in the displacement curves: only 11 of
the 18 apoB 1896 His/Arg (apoB 1887 Asn/Asn) heterozygotes had
originally been classified as having impaired binding to Mab D7.2.
However, a combination of both variant alleles was associated with
a shift of the displacement curves even further to the right,
suggesting a possible additive effect on the immunoreactivity of LDL
with Mab D7.2. The association of the Mab D7.2 polymorphism with
the apoB 1887 Asn/Ser and apoB 1896 His/Arg polymorphisms was
statistically significant (
2=49.712,
P<.0001, and
2=46.261,
P<.0001, respectively).
|
Association of the ApoB 1896 (His
Arg) Polymorphism With
Antigenic and Other ApoB Genetic Variants
Ag phenotyping, 3'VNTR genotyping, and Xba I RFLP
analysis of the diet study participants showed that all
subjects carrying the apoB 1896 Arg allele (His/Arg heterozygotes)
were either homozygous or heterozygous for the
xa1gti-3'VNTR 35-X- (Xba I restriction site
absent) haplotype. In all families with the apoB 1896 (His
Arg)
polymorphism studied, the Arg allele was also coinherited with
the apoB 3'VNTR 35 and X- alleles (Fig 3
). With regard to the apoB
1887 Asn
Ser polymorphism, no common haplotype was shared by the
subjects carrying the rare allele, in accordance with family
studies in this report showing the Ser allele in association with
at least two apoB 3'VNTR alleles (33 and 37).
Effect of ApoB 1887 (Asn
Ser) and 1896 (His
Arg)
Polymorphisms on Serum Lipid Levels and Response to Dietary
Intervention
Statistical calculations in the diet study participants were
performed separately for men and women. For the apoB 1887 (Asn
Ser)
polymorphism, with only 3 and 2 individuals in the male and female
groups, respectively, carrying the apoB 1887 Ser allele, no
significant differences in lipid or lipoprotein levels between
genotypes were observed (data not shown).
With respect to the apoB 1896 (His
Arg) polymorphism, no
significant differences in baseline or switchback levels of serum
lipids or lipoproteins could be seen between the His/His and His/Arg
groups in men (Table 2
). During the intervention period,
men with the genotype His/Arg tended to have slightly higher
serum total cholesterol (P=.0792), LDL
cholesterol (P=.0494), and apoB levels
(P=.0814) compared with the His/His men. Serum total
cholesterol, LDL cholesterol, and apoB
responses to dietary intervention in the His/His and His/Arg men are
illustrated in Fig 4
, showing slightly smaller
reductions in total and LDL cholesterol in the His/Arg men
after the low-fat diet and smaller increases in total
cholesterol (P=.0490), LDL
cholesterol (P=.0533), and apoB
(P=.0340) after they switched back to the original high-fat
(free-choice) diet. In women, no significant differences were seen
during any study period (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
Haplotype analysis of the diet study population demonstrated that the apoB 1896 Arg allele was associated with the Ag haplotype xa1gti, the apoB 3'VNTR 35 allele, and the X- allele, whereas no common haplotype could be determined for the apoB 1887 Ser allele. This is in accordance with our family studies showing coinheritance of the apoB 1896 Arg allele and apoB 3'VNTR allele 35, in contrast to the association of the apoB 1887 Ser allele with two different 3'VNTR alleles (33 and 37). With allele frequencies for the rare alleles above .01, both DNA changes described here represent polymorphisms of the apoB gene. In this sample, no association between the two polymorphisms could be detected. However, association tests are not necessarily valid in small samples, and further studies are needed to exclude an association.
The two new apoB polymorphisms are located in a region not believed
to have any direct role in the apoBLDL receptor interaction. Some
changes in the surface structure of LDL apoB due to the amino acid
changes are, however, likely because the immunoreactivity against Mab
D7.2 of LDL apoB was impaired in the carriers of the mutant
alleles. The diet study suggested that the LDL
cholesterol levels were higher in the His/Arg men during
the low-fat diet. This could be related to the tendency in these men to
show a reduced total cholesterol and LDL
cholesterol response to dietary change, both during
intervention and during switchback to the original diet (see Fig 4
).
These findings may represent an example of the variability gene
concept.55 56 57 According to this concept, the apoB 1896 Arg
allele could exert a restrictive influence on lipid changes. The
trends were, however, of borderline significance, and were observed in
men only. Thus, our results cannot prove or exclude a true effect of
the apoB 1896 polymorphism on lipid metabolism.
In summary, we have characterized a new immunogenetic apoB
polymorphism associated with two separate, closely located DNA
changes, both of which affect the amino acid sequence of apoB. The
possible role of the apoB 1896 (His
Arg) polymorphism in the
regulation of serum lipid levels could not be confirmed or ruled out.
Further investigations on dietary response in conjunction with turnover
studies using labeled apoB 1896 Arg LDL are warranted.
| Selected Abbreviations and Acronyms |
|---|
|
| Acknowledgments |
|---|
Received April 4, 1995; accepted June 20, 1995.
| References |
|---|
|
|
|---|
2. Bütler R, Bütler-Brunner E, Scherz R, Pflugshaupt R. The Ag-system of low density lipoproteinan updating. In: Peeters H, ed. Protides of the Biological Fluids. New York, NY: Pergamon Press; 1978;24:255-262.
3.
Berg K, Hames C, Dahlén G, Frick MH, Krishan I.
Genetic variation in serum low density lipoproteins and lipid
levels in man. Proc Natl Acad Sci U S A. 1976;73:937-940.
4. Tikkanen MJ, Viikari J, Åkerblom HK, Pesonen E. Apolipoprotein B polymorphism and altered apolipoprotein B and low density lipoprotein cholesterol concentrations in Finnish children. Br Med J. 1988;296:169-170.
5.
Ma Y, Schumaker VN, Bütler R, Sparkes RS.
Two DNA restriction fragment length polymorphisms associated
with Ag(t/z) and Ag(g/c) antigenic sites of human apolipoprotein
B. Arteriosclerosis. 1987;7:301-305.
6. Dunning AM, Tikkanen MJ, Ehnholm C, Bütler R, Humphries SE. Relationships between DNA and protein polymorphisms of apolipoprotein B. Hum Genet. 1988;78:325-329. [Medline] [Order article via Infotrieve]
7.
Wang X, Schlapfer P, Ma Y, Bütler R, Elovson J,
Schumaker VN. Apolipoprotein B: the Ag(a1/d) immunogenetic
polymorphism coincides with a T-to-C substitution at
nucleotide 1981, creating an Alu I restriction
site. Arteriosclerosis. 1988;8:429-435.
8.
Ma Y, Wang X, Bütler R, Schumaker VN. Bsp
12861 restriction fragment length polymorphism detects Ag(c/g)
locus of human apolipoprotein B in all 17 persons studied.
Arteriosclerosis. 1989;9:242-246.
9. Young SG, Hubl ST. An ApaLI restriction site polymorphism is associated with the MB19 polymorphism in apolipoprotein B. J Lipid Res. 1989;30:443-449. [Abstract]
10. Xu C, Nanjee N, Tikkanen MJ, Huttunen JK, Pietinen P, Bütler R, Angelico F, Del Ben M, Mazzarella R, Antonio R, Miller NG, Humphries S, Talmud PJ. Apolipoprotein B amino acid 3611 substitution from arginine to glutamine creates the Ag (h/i) epitope: the polymorphism is not associated with differences in serum cholesterol and apolipoprotein B levels. Hum Genet. 1989;82:322-326. [Medline] [Order article via Infotrieve]
11.
Wu MJ, Bütler E, Bütler R, Schumaker VN.
Identification of the base substitution responsible for the
Ag(x/y) polymorphism of apolipoprotein B-100.
Arterioscler Thromb. 1991;11:379-384.
12. Dunning AM, Renges HH, Xu CF, Peacock R, Brasseur R, Laxer G, Tikkanen MJ, Bütler R, Saha N, Hamsten A, Rosseneu M, Talmud P, Humphries SE. Two amino acid substitutions in apolipoprotein B are in complete allelic association with the antigen group (x/y) polymorphism: evidence for little recombination in the 3' end of the human gene. Am J Hum Genet. 1992;50:208-221. [Medline] [Order article via Infotrieve]
13.
Blackhart BD, Ludwig EM, Pierotti VR, Caiati L, Onasch
MA, Wallis SC, Powell L, Pease R, Knott TJ, Chu ML, Mahley RW, Scott J,
McCarthy BJ, Levy-Wilson B. Structure of the human
apolipoprotein B gene. J Biol Chem. 1986;261:15364-15367.
14. Carlsson P, Darnfors C, Olofsson SO, Bjursell G. Analysis of the human apolipoprotein B gene: complete structure of the B-74 region. Gene. 1986;49:29-51. [Medline] [Order article via Infotrieve]
15.
Berg K, Powell LM, Wallis SC, Pease R, Knott TJ, Scott
J. Genetic linkage between the antigenic group (Ag) variation
and the apolipoprotein B gene: assignment of the Ag locus.
Proc Natl Acad Sci U S A. 1986;83:7367-7370.
16. Berg K. DNA polymorphism at the apolipoprotein B locus is associated with lipoprotein level. Clin Genet. 1986;30:515-520. [Medline] [Order article via Infotrieve]
17. Dunning AM, Duriez P, Vu Dac N, Fruchart JC, Humphries SE. Association between epitopes detected by monoclonal antibody BIP-45 and the XbaI polymorphism of apolipoprotein B. Clin Genet. 1988;33:181-188. [Medline] [Order article via Infotrieve]
18.
Ma Y, Ladias JAA, Bütler R, Schumaker VN,
Antonarakis SE, Lusis AJ, Heinzman C, Kwiterovich PO.
Apolipoprotein B gene haplotypes: association between Ag and DNA
polymorphisms.
Arteriosclerosis. 1988;8:521-524.
19. Law A, Wallis SC, Powell LM, Pease RJ, Brunt H, Priestley LM, Knott TJ, Scott J, Altman DG, Miller GJ, Rajput J, Miller NE. Common DNA polymorphism within coning sequence of apolipoprotein B gene associated with altered lipid levels. Lancet. 1986;1:1301-1303. [Medline] [Order article via Infotrieve]
20. Talmud PJ, Barni N, Kessling AM, Carlsson P, Darnfors C, Bjursell G, Galton D, Wynn V, Kirk H, Hayden MR, Humphries SE. Apolipoprotein B gene variants are involved in the determination of serum cholesterol levels: a study in normo- and hyperlipidaemic individuals. Atherosclerosis. 1987;67:81-89. [Medline] [Order article via Infotrieve]
21. Aalto-Setälä K, Tikkanen MJ, Taskinen MR, Nieminen M, Holmberg P, Kontula K. XbaI and c/g polymorphisms of the apolipoprotein B gene locus are associated with serum cholesterol and LDL-cholesterol levels in Finland. Atherosclerosis. 1988;74:47-54. [Medline] [Order article via Infotrieve]
22. Aalto-Setälä K, Gylling H, Helve E, Kovanen P, Miettinen TA, Turtola H, Kontula K. Genetic polymorphism of the apolipoprotein B gene locus influences serum LDL cholesterol level in familial hypercholesterolemia. Hum Genet. 1989;82:305-307. [Medline] [Order article via Infotrieve]
23. Leren TP, Berg K, Hjermann I, Leren P. Further evidence for an association between the XbaI polymorphism at the apolipoprotein B locus and lipoprotein level. Clin Genet. 1988;34:347-351. [Medline] [Order article via Infotrieve]
24. Hegele RA, Huang LS, Herbert PN, Blum CB, Buring JE, Hennekens CH, Breslow JL. Apolipoprotein B-gene DNA polymorphisms associated with myocardial infarction. N Engl J Med. 1986;315:1509-1515. [Abstract]
25. Aburatani H, Matsumoto A, Itoh H, Yamada N, Murase T, Takaku F, Itakura H. A study of DNA polymorphism in the apolipoprotein B gene in a Japanese population. Atherosclerosis. 1988;72:71-76. [Medline] [Order article via Infotrieve]
26. Monsalve MV, Young R, Jobsis J, Wiseman SA, Dhamu S, Powell JT, Greenhalgh RM, Humphries SE. DNA polymorphisms of the gene for apolipoprotein B in patients with peripheral arterial disease. Atherosclerosis. 1988;70:123-129. [Medline] [Order article via Infotrieve]
27. Rajput-Williams J, Knott TJ, Wallis SC, Sweetnam P, Yarnell J, Cox N, Bell GI, Miller NE, Scott J. Variation of apolipoprotein-B gene is associated with obesity, high blood cholesterol levels, and increased risk of coronary heart disease. Lancet. 1988;2:1442-1446.[Medline] [Order article via Infotrieve]
28. Darnfors C, Wiklund O, Nilsson J, Gerard B, Carlsson P, Johansson S, Bondjers G, Bjursell G. Lack of correlation between the apolipoprotein B Xba I polymorphism and blood lipid levels in a Swedish population. Atherosclerosis. 1989;75:183-188. [Medline] [Order article via Infotrieve]
29.
Tikkanen MJ, Huttunen JK, Ehnholm C, Pietinen P.
Apolipoprotein E4 homozygosity predisposes to serum
cholesterol elevation during high-fat diet.
Arteriosclerosis. 1990;10:285-288.
30. Tikkanen MJ, Xu CF, Hämäläinen T, Talmud P, Sarna S, Huttunen JK, Pietinen P, Humphries S. XbaI polymorphism of the apolipoprotein B gene influences plasma lipid response to diet intervention. Clin Genet. 1990;37:327-334. [Medline] [Order article via Infotrieve]
31. Xu CF, Boerwinkle E, Tikkanen MJ, Huttunen JK, Humphries SE, Talmud PJ. Genetic variation at the apolipoprotein gene loci contribute to response of plasma lipids to dietary change. Genet Epidemiol. 1990;7:261-275.[Medline] [Order article via Infotrieve]
32. Xu C, Tikkanen MJ, Huttunen JK, Pietinen P, Bütler R, Humphries S, Talmud P. Apolipoprotein B signal peptide insertion/deletion polymorphism is associated with Ag epitopes and involved in the determination of serum triglyceride levels. J Lipid Res. 1990;31:1255-1261. [Abstract]
33. Talmud PJ, Boerwinkle E, Xu C, Tikkanen MJ, Pietinen P, Huttunen JK, Humphries S. Dietary intake and gene variation influence the response of plasma lipids to dietary intervention. Genet Epidemiol. 1992;9:249-260. [Medline] [Order article via Infotrieve]
34.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T.
Detection of polymorphisms of human DNA by gel
electrophoresis as single-strand conformation
polymorphisms. Proc Natl Acad Sci U S A. 1989;86:2766-2770.
35. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics. 1989;5:874-879. [Medline] [Order article via Infotrieve]
36. Ilmonen M, Heliö T, Ebeling T, Pyörälä K, Uusitupa M, Palotie A, Tikkanen MJ. Screening for mutations in the exon 26 of the apolipoprotein B gene in hypercholesterolemic Finnish families by the single-strand conformation polymorphism method. Hum Mutat. 1994;4:217-223. [Medline] [Order article via Infotrieve]
37. Krul ES, Kleinman Y, Kinoshita M, Pfleger B, Oida K, Law A, Scott J, Pease R, Schonfeld G. Regional specificities of monoclonal anti-human apolipoprotein B antibodies. J Lipid Res. 1988;29:937-947. [Abstract]
38.
Krul ES, Kinoshita M, Talmud P, Humphries SE, Turner S,
Goldberg AC, Cook K, Boerwinkle E, Schonfeld G. Two distinct
truncated apolipoprotein B species in a kindred with
hypobetalipoproteinemia.
Arteriosclerosis. 1989;9:856-868.
39. Ehnholm C, Huttunen JK, Pietinen P, Leino U, Mutanen M, Kostiainen E, Pikkarainen J, Dougherty R, Iacono J, Puska P. Effect of diet on serum lipoproteins in a population with a high risk of coronary heart disease. N Engl J Med. 1982;307:850-855. [Abstract]
40.
Ehnholm C, Huttunen JK, Pietinen P, Leino U, Mutanen M,
Kostiainen E, Iacono JM, Dougherty R, Puska P. Effect of a diet
low in saturated fatty acids on plasma lipids, lipoproteins, and HDL
subfractions. Arteriosclerosis. 1984;4:265-269.
41. Kuusi T, Ehnholm C, Huttunen JK, Kostiainen E, Pietinen P, Leino U, Uusitalo U, Nikkari T, Iacono JM, Puska P. Concentration and composition of serum lipoproteins during a low-fat diet at two levels of polyunsaturated fat. J Lipid Res. 1985;26:360-367. [Abstract]
42. Kostner GM. Enzymatic determination of cholesterol in high-density lipoprotein fractions prepared by polyanion precipitation. Clin Chem. 1976;22:695. Letter.
43. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem. 1972;18:499-502. [Abstract]
44. Havel RJ, Eder HA, Bragdon JH. The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J Clin Invest. 1955;34:1345-1353.
45. Tikkanen MJ, Ehnholm C, Bütler R, Young SG, Curtiss LK, Witztum JL. Monoclonal antibody detects Ag polymorphism of apolipoprotein B. FEBS Lett. 1986;202:54-58. [Medline] [Order article via Infotrieve]
46. Bütler R, Brunner E. A new sensitive method for studying the polymorphisms of the human low density lipoproteins. Vox Sang. 1966;11:738-740.[Medline] [Order article via Infotrieve]
47. Bütler R, Brunner E, Vierucci A, Morganti G. Comparative studies on anti-Ag sera in immunodiffusion and in passive hemagglutination methods. Vox Sang. 1967;13:327-345. [Medline] [Order article via Infotrieve]
48.
Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel
SS, Miller OJ, Breg WR, Jones HWJ, Rary JM. Analysis of
human Y-chromosome-specific reiterated DNA in chromosome
variants. Proc Natl Acad Sci U S A. 1977;74:1245-1249.
49.
Knott TJ, Wallis SC, Powell LM, Pease RJ, Lusis AJ,
Blackhart B, McCarthy BJ, Mahley RW, Levy-Wilson B, Scott J.
Complete cDNA and derived protein sequence of human
apolipoprotein B-100. Nucleic Acids Res. 1986;14:7501-7503.
50. Syvänen AC, Aalto-Setälä K, Kontula K, Söderlund H. Direct sequencing of affinity-captured amplified human DNA: application to the detection of apolipoprotein E polymorphism. FEBS Lett. 1989;258:71-74. [Medline] [Order article via Infotrieve]
51.
Sanger F, Nicklen S, Coulson AR. DNA
sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci U S A. 1977;74:5463-5467.
52. Heliö T. Concept of VNTR alleles: comparison of apolipoprotein B 3' hypervariable region genotyping results obtained by three methods. Biochem Biophys Res Commun. 1991;181:846-851. [Medline] [Order article via Infotrieve]
53. Boerwinkle E, Lee SS, Bütler R, Schumaker VN, Chan L. Rapid typing of apolipoprotein B DNA polymorphism by DNA amplification: association between Ag epitopes of human apolipoprotein B-100, a signal peptide insertion/deletion polymorphism, and a 3' flanking DNA variable number of tandem repeats polymorphism of the apolipoprotein B gene. Atherosclerosis. 1990;81:225-232. [Medline] [Order article via Infotrieve]
54. Tikkanen MJ, Dargar R, Pfleger B, Gonen B, Davie JM, Schonfeld G. Antigenic mapping of human low density lipoprotein with monoclonal antibodies. J Lipid Res. 1982;23:1032-1038. [Abstract]
55. Berg K. Twin studies of coronary heart disease and its risk factors. Acta Genet Med Gemellol (Roma). 1984;33:349-361. [Medline] [Order article via Infotrieve]
56. Berg K. Genetics of coronary heart disease and its risk factors. In: Berg K, ed. Medical Genetics: Past, Present, Future. New York, NY: Alan R Liss Inc; 1985:351-374.
57. Berg K. Normal genetic lipoprotein variations and atherosclerosis. In: Sirtori CR, Nichols AV, Franceschini G, eds. Human Apolipoprotein Mutants: Impact on Atherosclerosis and Longevity. New York, NY: Plenum Press; 1986:31-49.
This article has been cited by other articles:
![]() |
L. F Masson, G. McNeill, and A. Avenell Genetic variation and the lipid response to dietary intervention: a systematic review Am. J. Clinical Nutrition, May 1, 2003; 77(5): 1098 - 1111. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Beghin, N. Duhal, P. Poulain, P. Hauw, B. Lacroix, J.-M. Lecerf, J.-P. Bonte, J.-C. Fruchart, and G. Luc Measurement of apolipoprotein B concentration in plasma lipoproteins by combining selective precipitation and mass spectrometry J. Lipid Res., July 1, 2000; 41(7): 1172 - 1176. [Abstract] [Full Text] |
||||
![]() |
B. Vedie, X. Jeunemaitre, J. L. Megnien, I. Myara, H. Trebeden, A. Simon, and N. Moatti Charge Heterogeneity of LDL in Asymptomatic Hypercholesterolemic Men Is Related to Lipid Parameters and Variations in the ApoB and CIII Genes Arterioscler Thromb Vasc Biol, November 1, 1998; 18(11): 1780 - 1789. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |