Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1287-1293
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1287-1293.)
© 1995 American Heart Association, Inc.
Two New Immunogenetic Polymorphisms of the ApoB Gene and Their Effect on Serum Lipid Levels and Responses to Changes in Dietary Fat Intake
Marja Ilmonen;
Tiina Heliö;
René Bütler;
Aarno Palotie;
Pirjo Pietinen;
Jussi K. Huttunen;
Matti J. Tikkanen
From the Department of Medicine, Division of Cardiology, Helsinki
University Central Hospital (M.I., T.H., M.J.T.), the Department of Clinical
Chemistry, University of Helsinki (A.P.), the National Public Health Institute
(P.P., J.K.H.), Helsinki, Finland, and the Blood Transfusion Service of the
Swiss Red Cross, Bern, Switzerland (R.B.).
Correspondence to Marja Ilmonen, MD, Helsinki University Central Hospital, Department of Medicine, Laboratory of Biochemistry L222, Haartmaninkatu 4, FIN-00290 Helsinki, Finland.
 |
Abstract
|
|---|
Abstract In previous studies, apoB polymorphisms have
been shown
to modify serum lipid responses to changes in dietary fat
intake.
The functionally important apoB DNA change or changes
underlying
these effects have, however, remained unknown. Using a
single-strand
conformation polymorphism analysisbased
screening method,
we identified two previously unreported apoB
polymorphisms located
close to each other in the 5' region of apoB
gene exon 26. This
DNA segment corresponds to the binding site of
monoclonal anti-apoB
antibody D7.2. The two A

G changes at apoB cDNA
nucleotides 5869
and 5896 produced an Asn

Ser change at
amino acid 1887 and a
His

Arg change at amino acid 1896. In the
Finnish population,
allele frequencies of the rare alleles of
the apoB 1887 (Asn

Ser)
and apoB 1896 (His

Arg) polymorphisms
were .02 and .11, respectively.
Both polymorphisms were shown to
have an independent effect
on the binding affinity of LDL with
monoclonal antibody D7.2.
The effect of these polymorphisms on
serum lipid levels and
responses to changes in dietary fat intake in
102 healthy free-living
subjects was assessed. The apoB 1896 Arg
allele was associated
with a higher serum LDL
cholesterol level during a low-fat,
low-cholesterol
diet in men.
Key Words: apoB gene polymorphisms apoB antigenic polymorphisms low-fat, low-cholesterol diet
 |
Introduction
|
|---|
The first
polymorphisms described for apoB were protein polymorphisms
detected
by use of alloantibodies produced in multiply transfused
patients.
1 These Ag polymorphisms were based on
antigens a
1/d, c/g, h/i,
t/z, and x/y, which
appeared to be products of five closely
linked allele
pairs.
2 The Ag(x/y)
3 and
Ag(c/g)
4 polymorphisms
were shown to be slightly but
significantly associated with
serum lipid levels. Further studies have
characterized DNA changes
in the apoB gene corresponding to each of the
five Ag epitopes.
5 6 7 8 9 10 11 12 The silent
Xba I
restriction fragment length
polymorphism of apoB
13 14
was shown to be associated with the
Ag system
5 6 15 16 17 18 as
well as with serum apoB, cholesterol,
and
triglyceride levels in many
16 17 19 20 21 22 23 but not
all
24 25 26 27 28 studies. These findings suggested that apoB DNA
sequence
changes contributed in some yet undefined way to the
regulation
of serum lipid levels.
Our previous studies gave preliminary indications that common
apolipoprotein polymorphisms modified serum lipid responses to
changes in dietary fat intake29 30 31 32 33 and thereby influenced
lipid levels. The apoB DNA change or changes presumably underlying
these effects remain unknown. On this basis, we set out to screen the
coding regions of the apoB gene for yet unknown functionally important
DNA changes by using an SSCP34 35 procedure developed for
this purpose.36 Initial SSCP analyses indicated
allelic variations in the 5' region of exon 26, a DNA segment
corresponding to the binding site of Mab D7.2.37 38 We
describe two previously unreported polymorphisms located close to
each other in this region and their associations with serum lipoprotein
levels and responses to changes in dietary fat intake. These
polymorphisms were associated with changes in the binding affinity
of LDL with Mab D7.2, generating a new immunogenetic apoB
polymorphism.
 |
Methods
|
|---|
Subjects
Serum and DNA samples were obtained as described
earlier
30 from 102 apparently healthy subjects (48 men and
54 women) who
had participated in three dietary intervention studies in
North
Karelia that were reported in 1982-1985
39 40 41 ; these
subjects
belonged to identical intervention groups in these studies.
The
diet intervention consisted of a 2-week baseline period, a 6-
or
12-week intervention period with a low-fat, low-cholesterol
diet
with a ratio of polyunsaturated to saturated fatty acids equal
to
1, and a 5- to 6-week switchback period. During the baseline
and
switchback periods, the participants were on their normal
free-choice
diets. Serum and DNA samples were also obtained
from family members of
the two study participants showing the
most marked shifts in their Mab
D7.2 displacement curves.
Lipid and Lipoprotein Determinations
Blood was drawn after an overnight fast. Serum
cholesterol and triglyceride concentrations
were determined by use of an enzymatic assay (Boehringer
Mannheim). HDL cholesterol was measured after precipitation
of VLDL and LDL with dextran sulfatemagnesium
chloride.42 Serum LDL cholesterol
concentration was calculated by use of the Friedewald
approximation.43 The concentration of apoB was determined
with a radial immunodiffusion method (Behring-Werke AG). LDL
(d=1.019 to 1.050 g/mL) was isolated by sequential
ultracentrifugation.44
Antibody Binding Assays and Ag Phenotyping
A solid-phase enzyme-linked immunosorbent assay45
with a large panel of monoclonal antibodies was used to screen for apoB
variants. The evaluation of Ag antigenic determinants was carried out
on the LDL of all diet study participants by passive hemagglutination
inhibition according to the technique developed by Bütler and
coworkers46 47 with human antisera used against the Ag
factors (x, y, a1, d, c, g, t, z, h, and i).
Antibody D7.2 was a generous gift from Dr Gus Schonfeld and Dr Elaine
Krul (Lipid Research Center, Washington University, St. Louis,
Mo.).
DNA Analyses
Genomic DNA was isolated from frozen whole blood by a Triton
X-100 lysis method.48 SSCP analysis from a 1366-bp
fragment located in the 5' end of apoB gene exon 26 containing cDNA
nucleotides 5641 to 700749 and spanning amino
acids 1811 to 2266 was carried out as described earlier.36
The primers used in the PCR were 5' ACATCTATGCCATCTCTTCTG (upstream
[A]; nucleotides 5641 to 5661) and 5'
ATCAATAGCCTCAATGTGTTG (downstream [B]; nucleotides 6987
to 7007). Amplification reactions were conducted in an automatic Perkin
Elmer/Cetus Thermal Cycler using Taq DNA polymerase
(Promega). Reaction conditions after the initial denaturation step (5
minutes at 95°C) were 29 cycles of 94°C (1 minute), then 60°C (1
minute), then 72°C (5 minutes). The amplification products were
further split with restriction enzymes (New England Biolabs)
Ban I (cutting site at nucleotide 6063) and
EcoRI (cutting site at nucleotide 6506) into
422-, 443-, and 501-bp segments. SSCP analyses were carried out
in 0% to 10% glycerol, 0.5x to 1xTris-borate/EDTA, nondenaturing
5% polyacrylamide gels.
The 422-bp segment cut from the amplified PCR fragment by
BanI was sequenced according to a slightly modified method
described by Syvänen et al.50 Genomic DNA was
amplified by use of primers C (5' CCTACCAAAATAATGAAATAAAAC [upstream;
nucleotides 5617 to 5640]) and D (5' TCTTGAGTTTCCAGGTGCCT
[downstream; nucleotides 6062 to 6081]), primer C being
biotinylated at its 5' end. After initial denaturation, 27 cycles of
94°C (1 minute), then 58°C (1 minute), then 72°C (2 minutes)
followed. The biotinylated amplified 461-bp DNA strands were purified
with avidin-coated polystyrene particles,36 after which
procedure the single-stranded amplification product was sequenced
by the Sanger dideoxynucleotide termination
method51 with T7 DNA polymerase (Sequenase version 2.0,
United States Biochemical) and oligonucleotide D as the
sequencing primer.
Genotyping of the apoB 1887 (Asn
Ser) and apoB 1896 (His
Arg)
changes was carried out by amplification of the 441-bp segment
(nucleotides 5641 to 6081) containing these
nucleotide changes with primers A and D and digestion of
the amplification product with restriction endonucleases (New
England Biolabs) BsrDI (apoB 1887) and Rsa I
(apoB 1896). The digestion reactions were conducted in a total volume
of 30 µL containing 10 µL of the PCR product in conditions
recommended by the manufacturer (incubation at 65°C for
BsrDI and 37°C for Rsa I). The presence or
absence of cutting sites of each enzyme was verified by use of 3%
agarose electrophoresis gels followed by ethidium bromide staining. In
the 441-bp amplification product, normal digestion reactions with
BsrDI (at nucleotides 5813 and 5873) produce
three digestion fragments that are 60, 173, and 208 bp in size. In the
absence of the 5873 cutting site, only 173- and 268-bp fragments are
produced. Rsa I normally has no cutting site in the 441-bp
fragment. The variant nucleotide 5897 cutting site results
in two fragments, 185 and 256 bp in size, in the digestion
reaction.
ApoB 3'VNTR genotyping was carried out as described by
Heliö52 by amplification of the DNA segment
overlapping the 3'VNTR region and separating the different-sized
alleles with denaturing polyacrylamide gel electrophoresis.
In this study, the terminology established by Boerwinkle et
al53 to define the number of repeats was used. The apoB
Xba I polymorphism was genotyped by
Xba I digestion, Southern blotting, and hybridization
techniques.30
Statistical Methods
Statistical analysis was carried out with the
BMDP statistical software package (BMDP Statistical
Software Inc). The mean values of serum lipid and lipoprotein levels
between different genotypes were compared by ANOVA. With regard
to differences in serum lipid responses in different genotypes,
statistical calculations were repeated after adjustment for changes in
body mass index. The associations between the apoB 1887 (Asn
Ser) and
apoB 1896 (His
Arg) polymorphisms and the Mab D7.2 antigenic
polymorphism were estimated by both
2
analysis and Fisher's exact test.
 |
Results
|
|---|
Studies on the Immunoreactivity of LDL ApoB
LDLs obtained from the diet study participants were tested for
apoB
variants with a panel of monoclonal antibodies. In 18 of the
102
subjects, a marked shift to the right of displacement curves
against
antibody D7.2 could be detected. In 2 individuals, this
change in
binding affinity was clearly stronger than in the
remaining 16. The
strong displacement curve shifts were evident
in some of the family
members of these probands, suggesting
that the change was genetically
determined (Fig 1a

to 1c). With
other antibodies,
including antibody B1B3, which was used as
a reference standard, the
LDLs reacted uniformly, as expected
(Fig 1d

). The epitope of antibody
D7.2 is between amino acids
1878 and 2148, and the epitope of B1B3 is
between amino acid
residues 3506 and 3635.
38 Antibody
B1B3
54 but not antibody
D7.2
37 inhibits the
binding of LDL to the LDL receptor.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 1. a, Graph shows results of Mab D7.2 binding assay
demonstrating genetically determined alterations in LDL binding
affinity. LDLs from the proband (AK) and two of her sisters (see
pedigree A in Fig 3 ) reacted with Mab D7.2 with low affinity, those
from one sister reacted with intermediate affinity, and those from the
spouse of the proband reacted with high (normal) affinity. b, Graph
shows results of Mab D7.2 binding assay from a family (see Fig 3 ,
pedigree C) with the apoB 1887 (Asn Ser) polymorphism. The assay
shows reduced binding of plasma LDL of the Asn/Ser heterozygotes HP,
IP, and PP with Mab D7.2. In this family, only plasma samples instead
of LDL were available. c, Mab D7.2 binding curve of a family (Fig 3 ,
pedigree D) shows reduced binding of the LDLs from the apoB 1896
His/Arg heterozygotes ET and HT. std indicates curve produced by
wild-type control LDL used as standard in assays on different
microtiter plates. d, Reference antibody B1B3 binding curve from family
D shows uniform reactivity of their LDL against the antibody.
|
|
SSCP Analysis and Sequencing Reactions
To explore the DNA sequence changes causing the altered binding
affinity of apoB with Mab D7.2, SSCP analysis of the DNA
fragment containing the sequence coding for the epitope of Mab D7.2 was
carried out (Fig 2a
). In this analysis, the
422-bp digestion product cut from the amplified fragment by
Ban I showed a complex mobility pattern suggesting either a
three-allelic polymorphism or two closely located mutations.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 2. a, Photograph shows SSCP analysis from
family A. A complex polymorphic moving pattern in the 422-bp DNA
fragment cut from the original PCR product with Ban I is
seen. Lanes 1 to 5 (see pedigree A in Fig 3 ) represent the
first generation (from left to right) and lanes 6 and 7
represent the two sons of the proband. Four different moving
patterns indicating at least three different alleles are seen.
Lanes 2, 3, and 5 originating from DNA samples from the three sisters
exhibiting low binding affinity to Mab D7.2 are identical. Lanes 6 and
7 come from the two sons of the proband who later proved to be
heterozygotes for the apoB 1896 Arg allele. Lane 1
represents the sister of the proband, and has intermediate
binding affinity carrying the apoB 1887 Ser allele, and lane 4
represents the spouse of the proband, and has normal binding
affinity. b, Photograph shows sequencing reactions from a compound
heterozygote (lanes G, T, A, and C on the left) showing A G
nucleotide changes at locations 5869 and 5896 and from a
simple apoB 1896 His/Arg heterozygote (lanes G, T, A, and C on the
right) showing an A G change at nucleotide 5896 only.
|
|
Sequencing reactions in samples obtained from the family members
revealed two DNA changes: an A
G change at nucleotide
5869, changing the code for amino acid 1887 from AAT to AGT with an
Asn
Ser change, and another A
G change at nucleotide
5896 with a change from CAT to CGT (His
Arg) at amino acid 1896 (Fig 2b
). Segregation of both DNA variations was demonstrated in these (Fig 1a
through 1c) and in several other families (Fig 3
).
Both probands who were originally identified with the Mab binding assay
were compound heterozygotes for the two mutations. 3'VNTR
analysis in their families showed that the two DNA variations
were not located on the same apoB allele. The relationship between
each of the DNA variations and the binding affinity of LDL apoB with
Mab D7.2 is illustrated in Fig 1b
and 1c
. Neither of the DNA variations
seemed to affect any lipid parameters in these mainly
normolipidemic families (data not shown).
Genotyping of the ApoB 1887 (Asn
Ser) and ApoB 1896 (His
Arg)
Polymorphisms in the Diet Study Participants
The nucleotide 5869 (A
G) change producing the apoB
1887 Ser allele removes a BsrDI cutting site located at
nucleotide 5873. The nucleotide 5896 (A
G)
variation with the apoB 1896 Arg allele produces a new
Rsa I cutting site at nucleotide 5897. Both DNA
changes can thus be easily detected by simple PCR amplification,
restriction enzyme digestion, and agarose gel electrophoresis followed
by ethidium bromide staining (see "DNA Analyses").
BsrDI digestion revealed 97 apoB 1887 Asn/Asn
genotypes, 5 Asn/Ser genotypes, and no Ser/Ser
genotypes among the 102 diet study participants (Table 1
), with an allele frequency of the rare Ser
allele of .02. According to the results of Rsa I
digestion, 81 subjects were genotyped as apoB 1896 His/His, 20
as His/Arg, and 1 as Arg/Arg (Table 1
), corresponding to an allele
frequency of the rare Arg allele of .11. No association was
detected between the apoB 1887 (Asn
Ser) and the apoB 1896
(His
Arg) polymorphisms (
2=1.416,
P=.4926; Fisher's exact test, P
1.0000). The
Mab D7.2 binding affinity changes and the newly described DNA
variations were compared in the diet study participants. Of the 78
subjects homozygous for the common alleles of both
polymorphisms, all except 1 had originally been classified as
showing normal immunoreactivity with Mab D7.2. All 5 subjects carrying
the apoB 1887 Ser allele, irrespective of their apoB 1896
(His
Arg) genotype, showed reduced binding. The Arg
allele of the apoB 1896 (His
Arg) polymorphism did not always
associate with detectable shifts in the displacement curves: only 11 of
the 18 apoB 1896 His/Arg (apoB 1887 Asn/Asn) heterozygotes had
originally been classified as having impaired binding to Mab D7.2.
However, a combination of both variant alleles was associated with
a shift of the displacement curves even further to the right,
suggesting a possible additive effect on the immunoreactivity of LDL
with Mab D7.2. The association of the Mab D7.2 polymorphism with
the apoB 1887 Asn/Ser and apoB 1896 His/Arg polymorphisms was
statistically significant (
2=49.712,
P<.0001, and
2=46.261,
P<.0001, respectively).
Association of the ApoB 1896 (His
Arg) Polymorphism With
Antigenic and Other ApoB Genetic Variants
Ag phenotyping, 3'VNTR genotyping, and Xba I RFLP
analysis of the diet study participants showed that all
subjects carrying the apoB 1896 Arg allele (His/Arg heterozygotes)
were either homozygous or heterozygous for the
xa1gti-3'VNTR 35-X- (Xba I restriction site
absent) haplotype. In all families with the apoB 1896 (His
Arg)
polymorphism studied, the Arg allele was also coinherited with
the apoB 3'VNTR 35 and X- alleles (Fig 3
). With regard to the apoB
1887 Asn
Ser polymorphism, no common haplotype was shared by the
subjects carrying the rare allele, in accordance with family
studies in this report showing the Ser allele in association with
at least two apoB 3'VNTR alleles (33 and 37).
Effect of ApoB 1887 (Asn
Ser) and 1896 (His
Arg)
Polymorphisms on Serum Lipid Levels and Response to Dietary
Intervention
Statistical calculations in the diet study participants were
performed separately for men and women. For the apoB 1887 (Asn
Ser)
polymorphism, with only 3 and 2 individuals in the male and female
groups, respectively, carrying the apoB 1887 Ser allele, no
significant differences in lipid or lipoprotein levels between
genotypes were observed (data not shown).
With respect to the apoB 1896 (His
Arg) polymorphism, no
significant differences in baseline or switchback levels of serum
lipids or lipoproteins could be seen between the His/His and His/Arg
groups in men (Table 2
). During the intervention period,
men with the genotype His/Arg tended to have slightly higher
serum total cholesterol (P=.0792), LDL
cholesterol (P=.0494), and apoB levels
(P=.0814) compared with the His/His men. Serum total
cholesterol, LDL cholesterol, and apoB
responses to dietary intervention in the His/His and His/Arg men are
illustrated in Fig 4
, showing slightly smaller
reductions in total and LDL cholesterol in the His/Arg men
after the low-fat diet and smaller increases in total
cholesterol (P=.0490), LDL
cholesterol (P=.0533), and apoB
(P=.0340) after they switched back to the original high-fat
(free-choice) diet. In women, no significant differences were seen
during any study period (data not shown).
View this table:
[in this window]
[in a new window]
|
Table 2. Serum Lipid and Lipoprotein Levels in Men According
to ApoB 1896 (His Arg) Genotype During Baseline,
Intervention, and Switchback Diets
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Figure 4. Bar graphs show the effects of the apoB 1896
(His Arg) polymorphism on the total cholesterol
(Chol), LDL cholesterol (LDLchol), and apoB response to
diet intervention in 37 His/His men (open bars) and 10 His/Arg men
(gray bars). I indicates change (mean±SEM) from the baseline
diet to the intervention diet; S, change from the intervention to the
switchback diet. Adjustment for the change in body mass index after
intervention (-0.41±0.36 kg/m2 and -0.35±0.24
kg/m2 in His/His and His/Arg men, respectively) or
switchback (0.04±0.33 kg/m2 and -0.01±0.30
kg/m2, respectively) had no effect on the results.
|
|
 |
Discussion
|
|---|
Since the description of the five Ag antigen pairs and recognition
of
some of them with monoclonal antibodies, this is the first report
of
a new immunochemical polymorphism of LDL apoB. Our original
unpublished
observation of the polymorphism detected with Mab D7.2
dates
back several years and was puzzling at that time because the
binding
curve patterns of the pedigrees studied did not fit into a
common
two-allelic genetic model. The systematic SSCP-based apoB gene
screening
system
36 provided the means for clarifying the
DNA sequence
changes responsible for the binding defect. SSCP
analyses and
subsequent sequencing studies uncovered the
presence of two
separate, closely located DNA changes, both associated
with
alterations in the binding affinity of LDL apoB with Mab D7.2.
Two
probands with the most marked impairment of binding proved
to be
compound heterozygote for the new polymorphisms, explaining
the
difficulties in the interpretation of the original binding
curves.
Haplotype analysis of the diet study population demonstrated
that the apoB 1896 Arg allele was associated with the Ag haplotype
xa1gti, the apoB 3'VNTR 35 allele, and the X-
allele, whereas no common haplotype could be determined for the
apoB 1887 Ser allele. This is in accordance with our family studies
showing coinheritance of the apoB 1896 Arg allele and apoB 3'VNTR
allele 35, in contrast to the association of the apoB 1887 Ser
allele with two different 3'VNTR alleles (33 and 37). With
allele frequencies for the rare alleles above .01, both DNA
changes described here represent polymorphisms of the apoB
gene. In this sample, no association between the two polymorphisms
could be detected. However, association tests are not necessarily valid
in small samples, and further studies are needed to exclude an
association.
The two new apoB polymorphisms are located in a region not believed
to have any direct role in the apoBLDL receptor interaction. Some
changes in the surface structure of LDL apoB due to the amino acid
changes are, however, likely because the immunoreactivity against Mab
D7.2 of LDL apoB was impaired in the carriers of the mutant
alleles. The diet study suggested that the LDL
cholesterol levels were higher in the His/Arg men during
the low-fat diet. This could be related to the tendency in these men to
show a reduced total cholesterol and LDL
cholesterol response to dietary change, both during
intervention and during switchback to the original diet (see Fig 4
).
These findings may represent an example of the variability gene
concept.55 56 57 According to this concept, the apoB 1896 Arg
allele could exert a restrictive influence on lipid changes. The
trends were, however, of borderline significance, and were observed in
men only. Thus, our results cannot prove or exclude a true effect of
the apoB 1896 polymorphism on lipid metabolism.
In summary, we have characterized a new immunogenetic apoB
polymorphism associated with two separate, closely located DNA
changes, both of which affect the amino acid sequence of apoB. The
possible role of the apoB 1896 (His
Arg) polymorphism in the
regulation of serum lipid levels could not be confirmed or ruled out.
Further investigations on dietary response in conjunction with turnover
studies using labeled apoB 1896 Arg LDL are warranted.
 |
Selected Abbreviations and Acronyms
|
|---|
| 3'VNTR |
= |
3' variable number of tandem repeats |
| Ag |
= |
antigen group |
| Mab |
= |
monoclonal antibody |
| PCR |
= |
polymerase chain reaction |
| SSCP |
= |
single-strand conformation polymorphism |
|
 |
Acknowledgments
|
|---|
This work was supported in part by the State Medical
Research
Council, Academy of Finland, and by grants from the Finnish
Foundation
for Cardiovascular Research, the Sigrid
Juselius and Paavo Nurmi
Foundations. The excellent technical
assistance of our laboratory
personnel, Terhi Hakala, Päivi Ruha,
and Tuula Soppela-Loponen,
is gratefully acknowledged.
Received April 4, 1995;
accepted June 20, 1995.
 |
References
|
|---|
-
Allison AC, Blumberg BS. An
isoprecipitation reaction distinguishing human serum-protein
types. Lancet. 1991;1:634-637.
-
Bütler R, Bütler-Brunner E, Scherz R,
Pflugshaupt R. The Ag-system of low density lipoproteinan
updating. In: Peeters H, ed. Protides of the Biological
Fluids. New York, NY: Pergamon Press; 1978;24:255-262.
-
Berg K, Hames C, Dahlén G, Frick MH, Krishan I.
Genetic variation in serum low density lipoproteins and lipid
levels in man. Proc Natl Acad Sci U S A. 1976;73:937-940. [Abstract/Free Full Text]
-
Tikkanen MJ, Viikari J, Åkerblom HK, Pesonen E.
Apolipoprotein B polymorphism and altered apolipoprotein B
and low density lipoprotein cholesterol concentrations in
Finnish children. Br Med J. 1988;296:169-170.
-
Ma Y, Schumaker VN, Bütler R, Sparkes RS.
Two DNA restriction fragment length polymorphisms associated
with Ag(t/z) and Ag(g/c) antigenic sites of human apolipoprotein
B. Arteriosclerosis. 1987;7:301-305. [Abstract/Free Full Text]
-
Dunning AM, Tikkanen MJ, Ehnholm C, Bütler R,
Humphries SE. Relationships between DNA and protein
polymorphisms of apolipoprotein B. Hum Genet. 1988;78:325-329. [Medline]
[Order article via Infotrieve]
-
Wang X, Schlapfer P, Ma Y, Bütler R, Elovson J,
Schumaker VN. Apolipoprotein B: the Ag(a1/d) immunogenetic
polymorphism coincides with a T-to-C substitution at
nucleotide 1981, creating an Alu I restriction
site. Arteriosclerosis. 1988;8:429-435. [Abstract/Free Full Text]
-
Ma Y, Wang X, Bütler R, Schumaker VN. Bsp
12861 restriction fragment length polymorphism detects Ag(c/g)
locus of human apolipoprotein B in all 17 persons studied.
Arteriosclerosis. 1989;9:242-246. [Abstract/Free Full Text]
-
Young SG, Hubl ST. An ApaLI restriction site
polymorphism is associated with the MB19 polymorphism in
apolipoprotein B. J Lipid Res. 1989;30:443-449. [Abstract]
-
Xu C, Nanjee N, Tikkanen MJ, Huttunen JK, Pietinen P,
Bütler R, Angelico F, Del Ben M, Mazzarella R, Antonio R, Miller
NG, Humphries S, Talmud PJ. Apolipoprotein B amino acid 3611
substitution from arginine to glutamine creates the Ag (h/i) epitope:
the polymorphism is not associated with differences in serum
cholesterol and apolipoprotein B levels. Hum
Genet. 1989;82:322-326. [Medline]
[Order article via Infotrieve]
-
Wu MJ, Bütler E, Bütler R, Schumaker VN.
Identification of the base substitution responsible for the
Ag(x/y) polymorphism of apolipoprotein B-100.
Arterioscler Thromb. 1991;11:379-384. [Abstract/Free Full Text]
-
Dunning AM, Renges HH, Xu CF, Peacock R, Brasseur R,
Laxer G, Tikkanen MJ, Bütler R, Saha N, Hamsten A, Rosseneu M,
Talmud P, Humphries SE. Two amino acid substitutions in
apolipoprotein B are in complete allelic association with the antigen
group (x/y) polymorphism: evidence for little recombination in the
3' end of the human gene. Am J Hum Genet. 1992;50:208-221. [Medline]
[Order article via Infotrieve]
-
Blackhart BD, Ludwig EM, Pierotti VR, Caiati L, Onasch
MA, Wallis SC, Powell L, Pease R, Knott TJ, Chu ML, Mahley RW, Scott J,
McCarthy BJ, Levy-Wilson B. Structure of the human
apolipoprotein B gene. J Biol Chem. 1986;261:15364-15367. [Abstract/Free Full Text]
-
Carlsson P, Darnfors C, Olofsson SO, Bjursell G.
Analysis of the human apolipoprotein B gene: complete
structure of the B-74 region. Gene. 1986;49:29-51. [Medline]
[Order article via Infotrieve]
-
Berg K, Powell LM, Wallis SC, Pease R, Knott TJ, Scott
J. Genetic linkage between the antigenic group (Ag) variation
and the apolipoprotein B gene: assignment of the Ag locus.
Proc Natl Acad Sci U S A. 1986;83:7367-7370. [Abstract/Free Full Text]
-
Berg K. DNA polymorphism at the
apolipoprotein B locus is associated with lipoprotein level.
Clin Genet. 1986;30:515-520. [Medline]
[Order article via Infotrieve]
-
Dunning AM, Duriez P, Vu Dac N, Fruchart JC, Humphries
SE. Association between epitopes detected by monoclonal antibody
BIP-45 and the XbaI polymorphism of apolipoprotein B.
Clin Genet. 1988;33:181-188. [Medline]
[Order article via Infotrieve]
-
Ma Y, Ladias JAA, Bütler R, Schumaker VN,
Antonarakis SE, Lusis AJ, Heinzman C, Kwiterovich PO.
Apolipoprotein B gene haplotypes: association between Ag and DNA
polymorphisms.
Arteriosclerosis. 1988;8:521-524. [Abstract/Free Full Text]
-
Law A, Wallis SC, Powell LM, Pease RJ, Brunt H,
Priestley LM, Knott TJ, Scott J, Altman DG, Miller GJ, Rajput J, Miller
NE. Common DNA polymorphism within coning sequence of
apolipoprotein B gene associated with altered lipid levels.
Lancet. 1986;1:1301-1303. [Medline]
[Order article via Infotrieve]
-
Talmud PJ, Barni N, Kessling AM, Carlsson P, Darnfors
C, Bjursell G, Galton D, Wynn V, Kirk H, Hayden MR, Humphries SE.
Apolipoprotein B gene variants are involved in the determination
of serum cholesterol levels: a study in normo- and
hyperlipidaemic individuals.
Atherosclerosis. 1987;67:81-89. [Medline]
[Order article via Infotrieve]
-
Aalto-Setälä K, Tikkanen MJ, Taskinen MR,
Nieminen M, Holmberg P, Kontula K. XbaI and c/g
polymorphisms of the apolipoprotein B gene locus are associated
with serum cholesterol and LDL-cholesterol
levels in Finland. Atherosclerosis. 1988;74:47-54. [Medline]
[Order article via Infotrieve]
-
Aalto-Setälä K, Gylling H, Helve E, Kovanen
P, Miettinen TA, Turtola H, Kontula K. Genetic polymorphism
of the apolipoprotein B gene locus influences serum LDL
cholesterol level in familial
hypercholesterolemia. Hum
Genet. 1989;82:305-307. [Medline]
[Order article via Infotrieve]
-
Leren TP, Berg K, Hjermann I, Leren P. Further
evidence for an association between the XbaI polymorphism at the
apolipoprotein B locus and lipoprotein level. Clin
Genet. 1988;34:347-351. [Medline]
[Order article via Infotrieve]
-
Hegele RA, Huang LS, Herbert PN, Blum CB, Buring JE,
Hennekens CH, Breslow JL. Apolipoprotein B-gene DNA
polymorphisms associated with myocardial infarction.
N Engl J Med. 1986;315:1509-1515. [Abstract]
-
Aburatani H, Matsumoto A, Itoh H, Yamada N, Murase T,
Takaku F, Itakura H. A study of DNA polymorphism in the
apolipoprotein B gene in a Japanese population.
Atherosclerosis. 1988;72:71-76. [Medline]
[Order article via Infotrieve]
-
Monsalve MV, Young R, Jobsis J, Wiseman SA, Dhamu S,
Powell JT, Greenhalgh RM, Humphries SE. DNA polymorphisms of
the gene for apolipoprotein B in patients with peripheral
arterial disease.
Atherosclerosis. 1988;70:123-129. [Medline]
[Order article via Infotrieve]
-
Rajput-Williams J, Knott TJ, Wallis SC, Sweetnam P,
Yarnell J, Cox N, Bell GI, Miller NE, Scott J. Variation of
apolipoprotein-B gene is associated with obesity, high blood
cholesterol levels, and increased risk of coronary
heart disease. Lancet. 1988;2:1442-1446.[Medline]
[Order article via Infotrieve]
-
Darnfors C, Wiklund O, Nilsson J, Gerard B, Carlsson P,
Johansson S, Bondjers G, Bjursell G. Lack of correlation between
the apolipoprotein B Xba I polymorphism and blood lipid levels in a
Swedish population. Atherosclerosis. 1989;75:183-188. [Medline]
[Order article via Infotrieve]
-
Tikkanen MJ, Huttunen JK, Ehnholm C, Pietinen P.
Apolipoprotein E4 homozygosity predisposes to serum
cholesterol elevation during high-fat diet.
Arteriosclerosis. 1990;10:285-288. [Abstract/Free Full Text]
-
Tikkanen MJ, Xu CF, Hämäläinen T,
Talmud P, Sarna S, Huttunen JK, Pietinen P, Humphries S. XbaI
polymorphism of the apolipoprotein B gene influences plasma lipid
response to diet intervention. Clin Genet. 1990;37:327-334. [Medline]
[Order article via Infotrieve]
-
Xu CF, Boerwinkle E, Tikkanen MJ, Huttunen JK,
Humphries SE, Talmud PJ. Genetic variation at the apolipoprotein
gene loci contribute to response of plasma lipids to dietary
change. Genet Epidemiol. 1990;7:261-275.[Medline]
[Order article via Infotrieve]
-
Xu C, Tikkanen MJ, Huttunen JK, Pietinen P,
Bütler R, Humphries S, Talmud P. Apolipoprotein B signal
peptide insertion/deletion polymorphism is associated with Ag
epitopes and involved in the determination of serum
triglyceride levels. J Lipid
Res. 1990;31:1255-1261. [Abstract]
-
Talmud PJ, Boerwinkle E, Xu C, Tikkanen MJ, Pietinen P,
Huttunen JK, Humphries S. Dietary intake and gene variation
influence the response of plasma lipids to dietary
intervention. Genet Epidemiol. 1992;9:249-260. [Medline]
[Order article via Infotrieve]
-
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T.
Detection of polymorphisms of human DNA by gel
electrophoresis as single-strand conformation
polymorphisms. Proc Natl Acad Sci U S A. 1989;86:2766-2770. [Abstract/Free Full Text]
-
Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid
and sensitive detection of point mutations and DNA polymorphisms
using the polymerase chain reaction. Genomics. 1989;5:874-879. [Medline]
[Order article via Infotrieve]
-
Ilmonen M, Heliö T, Ebeling T,
Pyörälä K, Uusitupa M, Palotie A, Tikkanen MJ.
Screening for mutations in the exon 26 of the apolipoprotein B
gene in hypercholesterolemic Finnish families by
the single-strand conformation polymorphism method.
Hum Mutat. 1994;4:217-223. [Medline]
[Order article via Infotrieve]
-
Krul ES, Kleinman Y, Kinoshita M, Pfleger B, Oida
K, Law A, Scott J, Pease R, Schonfeld G. Regional specificities
of monoclonal anti-human apolipoprotein B antibodies.
J Lipid Res. 1988;29:937-947. [Abstract]
-
Krul ES, Kinoshita M, Talmud P, Humphries SE, Turner S,
Goldberg AC, Cook K, Boerwinkle E, Schonfeld G. Two distinct
truncated apolipoprotein B species in a kindred with
hypobetalipoproteinemia.
Arteriosclerosis. 1989;9:856-868. [Abstract/Free Full Text]
-
Ehnholm C, Huttunen JK, Pietinen P, Leino U, Mutanen M,
Kostiainen E, Pikkarainen J, Dougherty R, Iacono J, Puska P.
Effect of diet on serum lipoproteins in a population with a high
risk of coronary heart disease. N Engl
J Med. 1982;307:850-855. [Abstract]
-
Ehnholm C, Huttunen JK, Pietinen P, Leino U, Mutanen M,
Kostiainen E, Iacono JM, Dougherty R, Puska P. Effect of a diet
low in saturated fatty acids on plasma lipids, lipoproteins, and HDL
subfractions. Arteriosclerosis. 1984;4:265-269. [Abstract/Free Full Text]
-
Kuusi T, Ehnholm C, Huttunen JK, Kostiainen E, Pietinen
P, Leino U, Uusitalo U, Nikkari T, Iacono JM, Puska P.
Concentration and composition of serum lipoproteins during a
low-fat diet at two levels of polyunsaturated fat.
J Lipid Res. 1985;26:360-367. [Abstract]
-
Kostner GM. Enzymatic determination of
cholesterol in high-density lipoprotein fractions prepared
by polyanion precipitation. Clin Chem. 1976;22:695.
Letter.
-
Friedewald WT, Levy RI, Fredrickson DS.
Estimation of the concentration of low-density lipoprotein
cholesterol in plasma, without use of the preparative
ultracentrifuge. Clin Chem. 1972;18:499-502. [Abstract]
-
Havel RJ, Eder HA, Bragdon JH. The distribution
and chemical composition of ultracentrifugally separated lipoproteins
in human serum. J Clin Invest. 1955;34:1345-1353.
-
Tikkanen MJ, Ehnholm C, Bütler R, Young SG,
Curtiss LK, Witztum JL. Monoclonal antibody detects Ag
polymorphism of apolipoprotein B. FEBS Lett. 1986;202:54-58. [Medline]
[Order article via Infotrieve]
-
Bütler R, Brunner E. A new sensitive
method for studying the polymorphisms of the human low density
lipoproteins. Vox Sang. 1966;11:738-740.[Medline]
[Order article via Infotrieve]
-
Bütler R, Brunner E, Vierucci A, Morganti G.
Comparative studies on anti-Ag sera in immunodiffusion and in
passive hemagglutination methods. Vox Sang. 1967;13:327-345. [Medline]
[Order article via Infotrieve]
-
Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel
SS, Miller OJ, Breg WR, Jones HWJ, Rary JM. Analysis of
human Y-chromosome-specific reiterated DNA in chromosome
variants. Proc Natl Acad Sci U S A. 1977;74:1245-1249. [Abstract/Free Full Text]
-
Knott TJ, Wallis SC, Powell LM, Pease RJ, Lusis AJ,
Blackhart B, McCarthy BJ, Mahley RW, Levy-Wilson B, Scott J.
Complete cDNA and derived protein sequence of human
apolipoprotein B-100. Nucleic Acids Res. 1986;14:7501-7503. [Free Full Text]
-
Syvänen AC, Aalto-Setälä K, Kontula
K, Söderlund H. Direct sequencing of affinity-captured
amplified human DNA: application to the detection of apolipoprotein E
polymorphism. FEBS Lett. 1989;258:71-74. [Medline]
[Order article via Infotrieve]
-
Sanger F, Nicklen S, Coulson AR. DNA
sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci U S A. 1977;74:5463-5467. [Abstract/Free Full Text]
-
Heliö T. Concept of VNTR alleles:
comparison of apolipoprotein B 3' hypervariable region
genotyping results obtained by three methods. Biochem
Biophys Res Commun. 1991;181:846-851. [Medline]
[Order article via Infotrieve]
-
Boerwinkle E, Lee SS, Bütler R, Schumaker VN,
Chan L. Rapid typing of apolipoprotein B DNA polymorphism by
DNA amplification: association between Ag epitopes of human
apolipoprotein B-100, a signal peptide insertion/deletion
polymorphism, and a 3' flanking DNA variable number of tandem
repeats polymorphism of the apolipoprotein B gene.
Atherosclerosis. 1990;81:225-232. [Medline]
[Order article via Infotrieve]
-
Tikkanen MJ, Dargar R, Pfleger B, Gonen B, Davie JM,
Schonfeld G. Antigenic mapping of human low density lipoprotein
with monoclonal antibodies. J Lipid Res. 1982;23:1032-1038. [Abstract]
-
Berg K. Twin studies of coronary heart
disease and its risk factors. Acta Genet Med Gemellol
(Roma). 1984;33:349-361. [Medline]
[Order article via Infotrieve]
-
Berg K. Genetics of coronary heart
disease and its risk factors. In: Berg K, ed. Medical
Genetics: Past, Present, Future. New York, NY: Alan R Liss
Inc; 1985:351-374.
-
Berg K. Normal genetic lipoprotein variations
and atherosclerosis. In: Sirtori CR, Nichols
AV, Franceschini G, eds. Human Apolipoprotein Mutants: Impact on
Atherosclerosis and Longevity. New York, NY:
Plenum Press; 1986:31-49.
This article has been cited by other articles:

|
 |

|
 |
 
L. F Masson, G. McNeill, and A. Avenell
Genetic variation and the lipid response to dietary intervention: a systematic review
Am. J. Clinical Nutrition,
May 1, 2003;
77(5):
1098 - 1111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Beghin, N. Duhal, P. Poulain, P. Hauw, B. Lacroix, J.-M. Lecerf, J.-P. Bonte, J.-C. Fruchart, and G. Luc
Measurement of apolipoprotein B concentration in plasma lipoproteins by combining selective precipitation and mass spectrometry
J. Lipid Res.,
July 1, 2000;
41(7):
1172 - 1176.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Vedie, X. Jeunemaitre, J. L. Megnien, I. Myara, H. Trebeden, A. Simon, and N. Moatti
Charge Heterogeneity of LDL in Asymptomatic Hypercholesterolemic Men Is Related to Lipid Parameters and Variations in the ApoB and CIII Genes
Arterioscler. Thromb. Vasc. Biol.,
November 1, 1998;
18(11):
1780 - 1789.
[Abstract]
[Full Text]
[PDF]
|
 |
|