© 1995 American Heart Association, Inc.
Articles |
Platelet-Derived Growth Factor Enhances Sp1 Binding to the LDL Receptor Gene
From the Departments of Medicine and Biochemistry, Rush Medical College, Chicago, Ill.
Correspondence to Dr Theodore Mazzone, Rush Medical College, 1653 W Congress Pkwy, Chicago, IL 60612.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract We have previously demonstrated that growth activation of quiescent cells enhances LDL receptor gene transcription and that the proximal 5' flanking region of the LDL receptor gene could transduce a platelet-derived growth factor (PDGF) response. This portion of the LDL receptor gene encompasses a previously characterized sterol response element and an adjacent Sp1 binding site. By use of mobility shift analyses we show that PDGF activation of quiescent cells enhances binding of Sp1 to the LDL receptor gene. Transfection analyses indicated that the Sp1 site, but not the sterol response element binding protein site, could confer PDGF responsiveness to a heterologous promoter in quiescent cells. Furthermore, cotransfection of an LDL receptor reporter gene (containing -141 to +35 bp of the LDL receptor gene promoter) along with an expression construct coding for high-level constitutive expression of an Sp1 cDNA led to marked enhancement in expression of the LDL receptor reporter gene in quiescent cells. Increased Sp1 binding due to PDGF could be due to enhanced production of Sp1; alternatively, posttranslational activation of binding could be involved. Western blot analysis showed no difference in Sp1 abundance in quiescent cells versus PDGF-stimulated cells, suggesting a posttranslational mechanism for activation of Sp1 binding by growth induction. Our data demonstrate that PDGF stimulation of quiescent cells leads to enhanced Sp1 binding to the LDL receptor gene. This enhanced binding could participate in PDGF induction of LDL receptor gene transcription.
Key Words: transcription factors • LDL receptor gene • cell growth
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The LDL receptor protein is ubiquitously expressed in mammalian cells and is a key component of the mechanism by which cells maintain balanced cholesterol homeostasis.1 This protein is highly expressed in cells requiring cholesterol and is suppressed in cells with excess cholesterol. For most cell types, physiological perturbations of cholesterol balance occur as a result of cell growth or differentiation. For a few specialized cell types, such as the hepatocyte or steroidogenic cell, cholesterol balance can change as a result of modulation of the differentiated function of these cells; ie, bile acid synthesis in the hepatocyte or steroid hormone production in the steroidogenic cell.2 3 4 The genetic elements accounting for regulation of LDL receptor gene transcription in response to sterol have been studied in detail5 6 7 and attention has been focused on two proximal elements within the LDL receptor gene 5' flanking sequence. The first of these has been designated as a sterol response element that is encompassed within a 16-bp repeat beginning at -68 bp in the LDL receptor gene and that transduces the gene transcriptional response to cell cholesterol balance. Recently, a series of proteins that bind to the sterol response element, designated SREBPs, have been purified and cloned.8 9 10 11 12 The other element, encompassed within an adjacent 16-bp repeat beginning at -52 bp, has been shown to bind the transcription factor Sp1.13
In addition to the response of LDL receptor gene transcription to direct manipulation of cellular sterol balance, it has been shown in multiple cell types that this transcription responds to stimuli that initiate cell cycle traverse. We have previously shown that stimulation of quiescent human skin fibroblasts with PDGF leads to enhanced LDL receptor gene transcription.14 We have also shown that the proximal portion of the LDL receptor gene 5' flanking region, containing the previously defined sterol response element and Sp1 binding site, can transduce a PDGF response in a reporter gene similar in magnitude to that of the endogenous gene.15 In addition, it has been shown that stimulation of lymphocyte division or hepatocyte growth, in vitro or in vivo, leads to enhanced LDL receptor gene expression.16 17 18 19
Stimulation of cell growth in quiescent cells likely imposes an additional need for cholesterol to support the synthesis of new cellular membranes, especially the cholesterol-rich plasma membrane. We have reported, for example, that PDGF addition to quiescent human skin fibroblasts acutely alters the subcellular distribution of free cholesterol.20 This observation raises the question of whether induction of LDL receptor gene expression after growth activation could be mediated by the sterol response element. Alternatively, the proximal constructs that we have shown will respond to PDGF also contain an Sp1 binding site, and this site could also contribute to PDGF stimulation. The studies presented herein indicate that PDGF stimulation of quiescent cells enhances Sp1 binding to the LDL receptor gene, the Sp1 binding site of the LDL receptor gene confers responsiveness to PDGF on a heterologous promoter in quiescent cells, and high-level constitutive expression of an Sp1 cDNA stimulates expression of an LDL receptor reporter gene in quiescent cells.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Materials
Platelet-deficient serum was purchased from Sigma and partially purified PDGF was prepared from human platelet packs as described previously14 ; its final concentration is given in terms of the amount of purified PDGF required to produce a comparable mitogenic response. Purified recombinant PDGF (BB homodimer) was purchased from GIBCO-BRL. An Sp1 consensus oligonucleotide (ATTCGATCGGGGCGGGGCGAGC) was obtained from Promega. Antibody to Sp1 was obtained from Santa Cruz Biotechnology. Other materials were obtained as described previously.14 15
Cell Culture
The NIH 3T3 cell line was obtained from American Type Culture
Collection. These cells were maintained in DMEM supplemented with 10%
FBS. Cells were plated for experiments as described in the figure
legends. In brief, cells were seeded at 8x104 per 60-mm
dish or 2x105 per 100-mm dish with 10% FBS in DMEM. After
3 days, cells were made quiescent by incubation in 1% PDS for 48
hours. This preincubation protocol established growth quiescence for
NIH 3T3 cells as confirmed by the observation that subconfluent cells
incubated in 1% PDS for 48 hours and then stimulated by PDGF increased
DNA synthesis by 10-fold at 18 hours (data not shown).
DNA Transfection and Isolation of Stable
Transfectants
For stable transgene expression, NIH 3T3 cells were transfected
by use of Lipofectin reagent (BRL) in a standard lipofection protocol.
One day before transfection, 5x105 cells were plated in
100-mm dishes. Cells were transfected with 9 µg of a reporter
construct and 1 µg of pSV2 neoplasmid along with 30 µg of
Lipofectin reagent in 3 mL of serum-free medium for 7 hours. Cells were
then incubated overnight in DMEM supplemented with 10% FBS. After 3
days, fresh medium containing 850 µg/mL of G418 was added. Mixed mass
cultures of stably transfected cells were formed by pooling of 50 to
100 neomycin-resistant colonies after 4 to 6 weeks of
selection. Pools from two independent transfections were evaluated for
each construct. Stably expressing pools were maintained in culture
medium containing 850 µg/mL of G418. The reporter constructs used for
stable transfection in these studies have been previously described in
detail.5 6 13 For analysis of LDL receptor
promoter response to PDGF in stable transfectants, transfected pools
were grown in G418-free medium for 1 week. The cells were then made
quiescent by addition of 1% PDS for 48 hours according to the standard
procedure, and PDGF was added as described in the figure legends. Cells
were washed with 10 mL of cold PBS and harvested for CAT activity,
which was quantitated as previously described.15
Transient transfections were performed by use of a standard calcium phosphate coprecipitation technique. Control transfections contained 7.5 µg of the -141/+36 region of the LDL receptor gene cloned into a luciferase reporter vector, plus 7.5 µg of carrier plasmid and 5 µg of a ß-galactosidase reporter gene driven by the SV40 promoter. For measurement of the effect of Sp1, 7.5 µg of a eukaryotic expression vector containing an EcoR1-HindIII fragment of the Sp1 cDNA (which codes for a fully functional protein) driven by the SV40 promoter was substituted for the carrier plasmid.
Gel Mobility Shift Assay
Protein nuclear extracts were made from NIH 3T3 cells as
described.21 In brief, 2x107 cells were
washed twice in cold PBS, and a nuclear pellet was isolated by being
lysed with hypotonic buffer ([mmol] HEPES 10, pH 7.9, spermidine
0.75, spermine 0.15, EDTA 0.1, EGTA 0.1, DTT 1, and KCl 10)
containing sucrose and being centrifuged at 16 000g
for 30 seconds. The nuclear pellet was then suspended in nuclear
suspension buffer ([mmol/L] HEPES 20, pH 7.9, spermidine 0.75,
spermine 0.15, EDTA 0.2, EGTA 2, and DTT 2 and 25% glycerol).
Nuclei were then lysed by addition of 0.32 mol/L ammonium sulfate, and
nuclear proteins were spun at 150 000g for 90 minutes and
precipitated by addition of solid ammonium sulfate (0.33 g/mL). The
proteins were then dissolved in 0.2 mL of nuclear suspension buffer and
dialyzed against this same buffer.
The regions of the human LDL receptor promoter containing the sterol
response element and Sp1 binding site were produced by
oligonucleotide synthesis. The R23 oligo contained both
sites (-72 TTTGAAAATCACCCCACTGCAAACTCCTCCCCCTGCTAGAAA
-31) and the R3 oligo contained only the Sp1 site (-56
CTGCAAACTCCTCCCCCTGCTAG -34). The adjacent 16-bp repeats
are underlined. The DNA was radiolabeled with T4 DNA polymerase by use
of [
-32P]ATP (3000 Ci/mmol, Amersham). Approximately 1
to 3 ng of the labeled probe (10 000 to 25 000 cpm; specific
activity, 6000 to 10 000 cpm/ng) and 2 µg poly(dI-dC) in a buffer
(10 mmol/L Tris-HCl, pH 7.5, 50 mmol/L KCl, 1 mmol/L DTT, and 1 mmol/L
EDTA and 5% glycerol) were mixed with 3 to 5 µg of nuclear extract
protein in a final volume of 10 µL. The mixture was incubated on ice
for 30 minutes and then at 30°C for 10 minutes. The protein-DNA
complexes were resolved on a 5% nondenaturing polyacrylamide
gel (29:1) containing 0.5xTBE buffer at 5°C.22
Immunoblot Analysis
Cells were lysed by incubation in RIPA buffer (PBS, pH 7.4; 1%
NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mmol/L sodium
orthovanadate, PMSF at 100 µg/mL, aprotinin at 50 µg/mL, and
leupeptin at 10 µg/mL) for 30 minutes on ice. Cell lysate was spun at
14 000 rpm for 20 minutes at 4°C and the supernatant was collected
as total cell protein extract. Equal amounts (10 µg) of cell extract
were electrophoresed on 8% SDS-polyacrylamide gels and
transferred to nitrocellulose membranes. The linearity of the assay was
confirmed by measurement of proportionate changes in signal intensity
after different amounts of a standard cell extract preparation were
loaded. Purified Sp1 protein (Promega) was also included as a standard.
The membranes were washed with TBS-Tween (10 mmol/L Tris-HCl, pH 8.0,
150 mmol/L NaCl, and Tween 0.1%) with 5% nonfat dried milk for 2
hours at room temperature and then blotted for 1 to 2 hours with
anti-Sp1 antibody. The membranes were washed with TBS-Tween and
incubated with 1:1500 dilution of horseradish peroxidase–conjugated
anti-rabbit immunoglobulin (Amersham) for 1 hour at room temperature.
Thereafter, membranes were washed with TBS-Tween and developed with ECL
reagents (Amersham).
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
PDGF Stimulation Enhances Protein Binding to the -52/-35 bp Fragment of the LDL Receptor Gene
Extracts from quiescent or PDGF-treated NIH 3T3 cells were examined for binding activity to an R3 or R23 LDL receptor gene oligoprobe (see "Methods"). The left panel of Fig 1
shows the results of a representative
experiment performed with the R3 probe. Lane 1 shows labeled probe
analyzed without preincubation with nuclear extract. The free
probe has run out of the gel and nothing is visible in this lane. Lane
2 shows the R3 probe incubated with nuclear extract from quiescent
cells and lane 3 shows the same probe incubated with nuclear extract
from cells treated with PDGF for 18 hours. As shown, incubation with
the latter nuclear extract produces a new protein/DNA complex, labeled
C1. The saturability of the interaction of the labeled probe with the
protein present in PDGF-treated nuclear extract is indicated by the
results in lane 4, where inclusion of a 100-fold molar excess of
unlabeled R3 oligo leads to loss of the C1 complex. The right panel
shows the results of similar incubation protocols done with a labeled
R23 probe. Lane 1 shows probe alone without preincubation with nuclear
extract. The free probe is visible just at the bottom of this gel. Lane
2 shows the incubation of labeled probe with quiescent cell nuclear
extract and the presence of a complex labeled C2. Lane 3 shows the
results of incubating this labeled probe with nuclear extract from
PDGF-treated cells. The C2 complex has become somewhat more abundant
and a C1 complex appears. Lane 4 shows the results of incubating the
labeled R23 oligo with PDGF nuclear extract and a 100-fold molar excess
of unlabeled R23. As shown, the C1 complex is markedly reduced in
abundance with a smaller decrease in the abundance of the C2 complex.
In lane 5, the results of including a 100-fold molar excess of
unlabeled R3 oligo with PDGF nuclear extract and a labeled R23 probe
are shown. The C1 complex has almost completely disappeared, with
little change in the complex labeled C2. The results of these mobility
shift analyses indicate that PDGF treatment of quiescent cells
leads to the appearance of a new complex, labeled C1. This complex can
be observed when either a labeled R3 or R23 probe is used. In the
latter circumstance, the C1 complex is markedly reduced in abundance by
excess unlabeled R23 or R3. On the basis of these results, we concluded
that specific PDGF-induced binding occurred on R3. This portion of the
LDL receptor gene contains the previously identified Sp1 binding site;
however, Sp1 binding to this site has not been reported to be subject
to humoral regulation. We therefore undertook a series of experiments
to more precisely identify the protein present in the complex
induced by PDGF treatment.
|
PDGF-Induced Protein Binding Is Due to Sp1
Fig 2A shows the results of an experiment in which
binding to a labeled R3 probe or R23 probe or a labeled Sp1 consensus
oligonucleotide was analyzed. Lanes 1, 2, and 3
show the results of analyzing these probes without preincubation.
"F" marks the position of unbound probe. Lanes 4, 5, and 6 show
the results for each of these probes after incubation with nuclear
extract from PDGF-treated cells. In lane 4, in which the R3 probe is
used, the complex labeled C1 in the left panel of Fig 1
is again
identified. In lane 5, in which a labeled R23 probe is used, complexes
C1 and C2 are again identified as they were in the right panel of Fig 1. It can be seen here that the mobilities of C1 complexes in which
either the R3 probe or the R23 probe is used are identical. This is in
accord with the results in Fig 1, which show that the C1 complex
arising from the R23 probe can be specifically competed by excess R3.
In lane 6, incubation of a labeled Sp1 consensus
oligonucleotide with nuclear extract from PDGF-treated
cells produces a complex that has mobility identical to that of the C1
complex. In Fig 2B, protein interactions with the labeled Sp1 consensus
oligonucleotide are further examined. Lane 1 shows this
probe alone without preincubation with nuclear extract. Lane 2 shows a
result of preincubating this labeled probe with nuclear extract from
quiescent cells and, as previously seen with the R3 probe, no
protein-DNA complex is visible. In lane 3, incubation of this labeled
probe with PDGF-treated nuclear extract produces a C1 complex, as it
did in Fig 2A. In lane 4 this complex is significantly competed out by
a 100-fold molar excess of unlabeled R3 oligo. A similar degree of
competition results from a 100-fold molar excess of unlabeled Sp1
consensus oligonucleotide, which is shown in lane 5. In
Fig 2C, the reverse competition is shown. Labeled R3 probe was competed
with a 10- to 60-fold molar excess of unlabeled R3 or Sp1 consensus
oligo during incubation with nuclear extract from PDGF-treated cells. A
10-fold molar excess of unlabeled R3 oligo or Sp1 consensus oligo
reduced the abundance of the C1 complex by 99% and 95% respectively,
as determined by scanning densitometry. In Fig 2D we show the results
of a supershift assay with labeled R3 probe, nuclear extract from
PDGF-treated cells, and an antibody to Sp1. Inclusion of the antibody
to Sp1 shifted 51% of the C1 complex, as determined by scanning
densitometry.
|
Sp1 Binding Site of the LDL Receptor Gene Can Transduce a
PDGF Response
The above mobility shift assays showed that PDGF treatment of
quiescent cells induced Sp1 binding to the LDL receptor gene. In the
next series of experiments, the functional significance of this
enhanced binding was considered. In Table 1, the results
of experiments with a series of LDL receptor gene reporter constructs
are shown. The first of these constructs included -72 to -35 bp of
the LDL receptor 5' flanking sequence inserted into a HSVTK CAT
reporter gene. This portion of the LDL receptor gene encompasses the
sterol response element (-68 to -52 bp) and the Sp1 binding site
(-52 to -37 bp). Two additional constructs contained either the -69
to -53 bp fragment or the -52 to -35 bp fragment of the LDL receptor
gene inserted into the same HSVTK CAT reporter. As shown in Table 1,
cells expressing -72/-35 HSVTK CAT responded to PDGF stimulation with
a 2.0-fold activation of CAT expression at 24 hours after PDGF addition
(P<.001). This level of response is similar to what we have
observed in human skin fibroblasts transiently transfected with the
intact proximal LDL receptor gene promoter construct.15
Cells expressing the -69/-53 HSVTK CAT construct showed a 1.5-fold
change in CAT expression. Cells expressing the -52/-35 HSVTK CAT
construct showed a 2.9-fold increase in CAT activity 24 hours after
PDGF addition (P<.005). Similar results were obtained when
cells expressing these constructs were assayed 6 hours after PDGF
addition (not shown). Cells stably expressing the HSVTK promoter
construct alone (ie, without an inserted LDL receptor gene fragment)
did not respond to PDGF. As reported by others, constructs containing a
mutation in the core Sp1 binding element within R3 were not expressed
in transfected cells.13 The data in this table indicate
that the Sp1 binding site (encompassed within the R3 oligo) confers
PDGF responsiveness on a heterologous promoter in quiescent cells.
|
Table 2 shows the results of transfection studies
designed to further evaluate the significance of enhanced Sp1 binding
in the context of the intact proximal regulatory region of the LDL
receptor gene. NIH 3T3 cells were transiently transfected with
-141/+36 bp of the LDL receptor gene joined to a luciferase reporter
along with an Sp1 cDNA expression vector. In control cells, the
Sp1 expression vector was replaced with carrier plasmid DNA. All
transfections also included a vector containing the ß-galactosidase
reporter driven by the SV40 early promoter and enhancer.
After transfection, cells were made quiescent by being placed in 1%
PDS for 48 hours before harvest. For transfections including the Sp1
expression vector, LDL receptor transgene expression (RLU per
milligram) was increased in three separate transfections. The
SV40 promoter, controlling ß-galactosidase expression,
also responded to Sp1, as expected on the basis of previous
reports.23 However, RLU/ß-galactosidase activity ratios
increased from 2.48±0.26 to 4.02±0.11 (P<.001),
indicating more effective activation of the LDL receptor gene
promoter.
|
Mechanism for Increased Sp1 Binding After PDGF
Stimulation
Changes in the binding of Sp1 after PDGF stimulation could be due
to changes in Sp1 abundance (as in the cotransfection experiment above)
or may be related to posttranslational modifications that alter Sp1
binding (Ref 24 and "Discussion"). We have previously shown that
PDGF stimulation of LDL receptor gene transcription occurred without
new protein synthesis.25 We therefore evaluated Sp1
protein abundance in quiescent versus PDGF-treated cells. Immunoblot
analysis of total cell protein extract showed no difference in
Sp1 protein abundance after PDGF stimulation (Fig 3). As
is also shown, the relative abundance of the bands corresponding to the
95 kD and 105 kD species of Sp1 is also unchanged after PDGF
treatment.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
A great deal of experimental data have now accumulated indicating that the LDL receptor pathway can respond to multiple humoral signals. Insulin and PDGF can stimulate LDL receptor gene expression in quiescent mesenchymal cells.14 15 Serum factors stimulate LDL receptor expression in HepG2 cells,19 and mitogenic stimulation increases LDL receptor gene expression in lymphocytes.18 Various agonists of second messenger pathways have been shown to modulate LDL receptor expression in HepG2 cells and monocytes, including cyclic AMP, protein kinase C agonists, calcium ionophores, and arachidonic acid metabolites.26 27 Cytokines have been shown to modulate LDL receptor pathway activity in endothelial cells,28 arterial smooth muscle cells,29 and HepG2 cells.30 Many of these stimuli increase LDL receptor mRNA levels, and some have been shown to enhance LDL receptor gene transcription. Furthermore, many of these humoral stimuli activate cell division, growth, or differentiation. Because activation of growth or differentiation may impose an additional need for cholesterol to support cell membrane synthesis, humoral activation of the LDL receptor gene could reasonably be ascribed to the sterol response element. However, a number of observations suggest that another LDL receptor gene element can participate in the regulation of gene transcription by humoral factors. It has recently been shown, for example, that the protein that drives transcription by means of the sterol response element rapidly decays in the presence of cycloheximide.12 We have previously shown, however, that the addition of cyclohemixide to quiescent skin fibroblasts markedly stimulates LDL receptor gene transcription.25 Furthermore, others have reported that mitogenic induction of LDL receptor gene expression in human lymphocytes remains intact even in the presence of abundant exogenous sterol.17 18 These observations suggest that another mechanism exists by which LDL receptor gene transcription can respond to mitogens. Our data indicate that humoral induction of LDL receptor gene transcription can be mediated by enhanced Sp1 binding to the LDL receptor gene.
Because many genes contain Sp1 binding sites and Sp1 is a ubiquitously
expressed transcription factor, it has until recently been considered
important only in the constitutive expression of housekeeping genes.
However, recent evidence suggests that Sp1 can mediate differential
expression of specific genes.24 31 32 33 Such specificity
could derive from different affinities of Sp1 sites or from interaction
of Sp1 with other transcription factors binding to nearby or adjacent
regulatory sites. Such regulatory cooperation resulting in synergistic
transcriptional activation, or interference, has been shown between
GATA-1 and Sp1 in the modulation of -globin gene expression in K562
cells.33 Also, both of the above potential mechanisms for
imparting specificity in response to Sp1 have been shown for the LDL
receptor gene. Sanchez et al34 have shown that SREBP and
Sp1 interact in an orientation-specific manner to maximize
sterol-regulated expression of the LDL receptor gene. Furthermore,
placing the lower-affinity HSVTK Sp1 binding site adjacent to the SREBP
site reduced expression of an LDL receptor gene reporter compared with
a construct containing the SREBP site and an adjacent LDL receptor Sp1
binding site. In our experiments the HSVTK promoter, which contains Sp1
binding sites, did not respond to PDGF in quiescent cells. Insertion of
the LDL receptor gene Sp1 site conferred responsiveness to PDGF. In
addition, for the experiments shown in Table 2, promoters driving both
reporter genes contain Sp1 binding sites. However, luciferase
expression is activated to a greater extent than
ß-galactosidase expression in the cells transfected with the Sp1
cDNA. Although we cannot rule out the potential explanation that
another gene element or transcription factor is limiting for
ß-galactosidase expression under these experimental conditions, this
observation is consistent with data from other laboratories
indicating that Sp1 can differentially modulate expression of specific
genes.24 31 32 33
Our data also address potential mechanisms by which PDGF
stimulates Sp1 binding to the LDL receptor gene. Increased Sp1 binding
induced by PDGF could reflect increased Sp1 abundance after PDGF
stimulation. The immunoblot analysis (Fig 3),
however, shows no difference in Sp1 abundance in cell protein extracts
from quiescent or PDGF-treated cells. Without a change in Sp1 levels,
altered binding could reflect a posttranslational modification: eg,
glycosylation or phosphorylation that can be detected
by altered migration of Sp1 on polyacrylamide gels between the
95 kD and 105 kD species.24 The immunoblot
analysis in Fig 3 reveals the expected doublet
representing these two species; however, no significant
alteration of Sp1 distribution between the 105 kD and 95 kD forms is
detectable after PDGF stimulation. A more appealing hypothesis for the
cause of enhanced Sp1 binding after PDGF stimulation incorporates
recent observations indicating the existence of inactive protein
complexes containing Sp1.35 36 37 Release of Sp1 from these
complexes has been reported to result in enhanced gene binding activity
and correlates with increased Sp1-dependent gene transcription. In one
report an evolutionarily conserved protein, p74, that
inactivates Sp1 by binding to its N-terminal
transactivation domain was identified.35 Of particular
interest is the recent report that the retinoblastoma gene product,
a cell cycle–specific protein generally believed to be important for
control of cell proliferation, stimulates Sp1-dependent gene
transcription by liberating Sp1 from a complex containing a
protease-sensitive negative regulator.36 37 Alternatively,
we cannot rule out the possibility that cell cycle–specific cofactors
are required for the enhancement of binding of Sp1 to the LDL receptor
gene after PDGF stimulation. In Fig 2D it can be seen that antisera
raised against a peptide containing amino acid residues 520 to 538 of
Sp1 shifts 51% of the C1 complex. The residual unshifted complex could
be the result of limited accessibility of the appropriate epitope in
the Sp1-DNA complex. Additional protein cofactors, however, could also
be present in the complex and limit accessibility of the epitope.
The competition experiments shown in Fig 2A indicate that the presence
of any such protein cofactors in the C1 complex absolutely requires Sp1
binding.
In summary, the data in this report indicate that PDGF stimulation of quiescent cells enhances binding of Sp1 to the LDL receptor gene. Furthermore, our data indicate that the Sp1 binding site of the LDL receptor gene confers PDGF responsiveness to a heterologous promoter in quiescent cells and that high-level constitutive expression of an Sp1 cDNA drives expression of an LDL receptor gene reporter. Activation of Sp1 binding by PDGF does not involve altered levels of Sp1 protein, consistent with our previous observation that PDGF stimulation of LDL receptor gene activity is independent of new protein synthesis. Dissection of potential regulatory interactions between adjacent SREBP and Sp1 binding sites after growth activation will require additional investigation.
|
Selected Abbreviations and Acronyms |
|---|
|
|
Acknowledgments |
|---|
This work was supported by grant HL-15062 from the National Institutes of Health. The authors would like to thank Beverly Burge for preparing the manuscript. The first two authors contributed equally to this work.
Received March 25, 1995; accepted May 23, 1995.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science. 1986;232:34-47.
2.
Golos TG, Strauss JF III. Regulation of low
density lipoprotein receptor synthesis in cultured luteinized human
granulosa cells by human chorionic gonadotropin and 8-bromo-cyclic
AMP. J Biol Chem. 1985;260:14399-14402.
3. Rudling M. Hepatic mRNA levels for the LDL receptor and HMG-CoA reductase show coordinate regulation in vivo. J Lipid Res. 1992;33:493-501. [Abstract]
4. Erickson SK, Fielding PE. Parameters of cholesterol metabolism in the human hepatoma cell line, Hep-G2. J Lipid Res. 1986;27:875-883. [Abstract]
5. Sudhof TC, Russell DW, Brown MS, Goldstein JL. 42 bp element from LDL receptor gene confers end-product repression by sterols when inserted into viral TK promoter. Cell. 1987;48:1061-1069. [Medline] [Order article via Infotrieve]
6.
Sudhof TC, Van Der Westhuyzen DR, Goldstein JL, Brown
MS, Russell DW. Three direct repeats and a TATA-like sequence
are required for regulated expression of the human low density
lipoprotein receptor gene. J Biol Chem. 1987;262:10773-10779.
7.
Smith JR, Osborne TF, Goldstein JL, Brown MS.
Identification of nucleotides responsible for
enhancer activity of sterol regulatory element in low density
lipoprotein receptor gene. J Biol Chem. 1990;265:2306-2310.
8.
Briggs MR, Yokoyama C, Wang X, Brown MS, Goldstein JL.
Nuclear protein that binds sterol regulatory element of low
density lipoprotein receptor promoter, I: identification of the protein
and delineation of its target nucleotide sequence.
J Biol Chem. 1993;268:14490-14496.
9.
Hua X, Yokoyama C, Wu J, Briggs MR, Brown MS,
Goldstein JL, Wang X. SREBP-2, a second
basic-helix-loop-helix-leucine zipper protein that stimulates
transcription by binding to a sterol regulatory element.
Proc Natl Acad Sci U S A. 1993;90:11603-11607.
10.
Wang X, Briggs MR, Hua X, Yokoyama C, Goldstein JL,
Brown MS. Nuclear protein that binds sterol regulatory element
of low density lipoprotein receptor promoter, II: purification and
characterization. J Biol Chem. 1993;268:14497-14504.
11. Yokoyama C, Wang X, Briggs MR, Admon A, Wu J, Hua X, Goldstein JL, Brown MS. SREBP-1, a basic-helix-loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene. Cell. 1993;75:187-197. [Medline] [Order article via Infotrieve]
12. Wang X, Sato R, Brown MS, Hua X, Goldstein JL. SREBP-1, a membrane-bound transcription factor released by sterol-regulated proteolysis. Cell. 1994;77:53-62. [Medline] [Order article via Infotrieve]
13.
Dawson PA, Hoffman SL, Van Der Westhuyzen DR, Sudhof
TC, Brown MS, Goldstein JL. Sterol-dependent repression of low
density lipoprotein receptor promoter mediated by 16-base pair sequence
adjacent to binding site for transcription factor Sp1.
J Biol Chem. 1988;263:3372-3379.
14.
Mazzone T, Basheeruddin K, Ping L, Frazer S, Getz GS.
Mechanism of the growth-related activation of the low density
lipoprotein receptor pathway. J Biol Chem. 1989;264:1787-1792.
15.
Mazzone T, Basheeruddin K, Ping L, Schick C.
Relation of growth- and sterol-related regulatory pathways for
LDL receptor gene expression. J Biol Chem. 1990;265:5145-5149.
16. Bocchetta M, Bruscalupi G, Castellano F, Trentalance A, Komaromy M, Fong LG, Cooper AD. Early induction of LDL receptor gene during rat liver regeneration. J Cell Physiol. 1993;156:601-609. [Medline] [Order article via Infotrieve]
17. Cuthbert JA, Lipsky PE. Differential regulation of the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase, synthase, and low density lipoprotein receptor genes. J Lipid Res. 1992;33:1157-1163. [Abstract]
18. Cuthbert JA, Lipsky PE. Mitogenic stimulation alters the regulation of LDL receptor gene expression in human lymphocytes. J Lipid Res. 1990;31:2067-2078. [Abstract]
19. Ellsworth JL, Brown C, Cooper AD. Stimulation of LDL receptor activity in Hep-G2 cells by a serum factor(s). J Cell Physiol. 1988;135:213-223. [Medline] [Order article via Infotrieve]
20. Mazzone T, Pustelnikas L. Growth-related modulation of human skin fibroblast cholesterol distribution and metabolism. Biochim Biophys Acta. 1990;1047:180-186. [Medline] [Order article via Infotrieve]
21. Shapiro DJ, Sharp PP, Wahl WW, Keller MJ. A high-efficiency HeLa cell nuclear transcription extract. DNA. 1988;7:47-55. [Medline] [Order article via Infotrieve]
22. Singh H, Sen R, Baltimore D, Sharp PA. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobin genes. Nature. 1986;319:154-158. [Medline] [Order article via Infotrieve]
23. Dyan WS, Tijan R. The promoter specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell. 1983;35:79-87. [Medline] [Order article via Infotrieve]
24.
Zhang D-E, Hetherington CJ, Shencao T, Dziennis SE,
Gonzalez DA, Chen H-M, Tenen DG. Sp1 is a critical factor for
the monocytic specific expression of human CD14. J
Biol Chem. 1994;269:11425-11434.
25.
Mazzone T, Basheeruddin K, Duncan H.
Inhibitors of translation induce low density
lipoprotein receptor gene expression in human skin fibroblasts.
J Biol Chem. 1989;264:15529-15534.
26.
Auwerx JH, Chait A, Wolfbauer G, Deeb SS.
Involvement of second messengers in regulation of the low
density lipoprotein receptor gene. Mol Cell Biol. 1989;9:2298-2302.
27. Krone W, Klass A, Nagele H, Behnke B, Greten H. Effects of prostaglandins on LDL receptor activity and cholesterol synthesis in freshly isolated human mononuclear leukocytes. J Lipid Res. 1988;29:1663-1669.[Abstract]
28.
Hamanaka R, Kohno K, Seguchi T, Okamura K, Morimoto A,
Ono M, Ogata J, Kuwano M. Induction of low density lipoprotein
receptor and a transcription factor SP-1 by tumor necrosis factor in
human microvascular endothelial cells.
J Biol Chem. 1992;267:13160-13165.
29.
Nicholson AC, Hajjar DP. Transforming
growth factor-ß up-regulates low density lipoprotein
receptor-mediated cholesterol metabolism in
vascular smooth muscle cells. J Biol Chem. 1992;267:25982-25987.
30.
Stopeck AT, Nicholson AC, Mancini FP, Hajjar DP.
Cytokine regulation of low density lipoprotein receptor
gene transcription in HepG2 cells. J Biol
Chem. 1993;268:17489-17494.
31.
Chen H-M, Pahl HL, Scheibe RJ, Zhang DE, Tenen DG.
The Sp1 transcription factor binds the CD11b promoter
specifically in myeloid cells in vivo and is essential for
myeloid-specific promoter activity. J Biol
Chem. 1993;268:8230-8239.
32.
Darrow AL, Rickles RJ, Pecorino LT, Strickland S.
Transcription factor Sp1 is important for retinoic acid-induced
expression of the tissue plasminogen activator
gene during F9 teratocarcinoma cell differentiation. Mol
Cell Biol. 1990;10:5883-5893.
33.
Fischer KD, Haese A, Nowock J. Cooperation of
GATA-1 and Sp1 can result in synergistic transcriptional activation or
interference. J Biol Chem. 1993;268:23915-23923.
34.
Sanchez HB, Yieh L, Osborne TF. Cooperation by
sterol regulatory element-binding protein and Sp1 in sterol regulaion
of low density lipoprotein receptor gene. J
Biol Chem. 1995;270:1161-1169.
35.
Murata Y, Kim HG, Rogers KT, Udvadia AJ, Horowitz JM.
Negative regulation of Sp1 trans-activation is correlated with
the binding of cellular proteins to the amino terminus of the Sp1
trans-activation domain. J Biol Chem. 1994;269:20674-20681.
36.
Chen LI, Nishinaka T, Kwan K, Kitabayashi I, Yokoyama
K, Fu YF, Grunwald S, Chiu R. The retinoblastoma gene
product RB stimulates Sp1-mediated transcription by liberating Sp1
from a negative regulator. Mol Cell Biol. 1994;14:4380-4389.
37.
Udvadia AJ, Rogers KT, Higgins PDR, Murata Y, Martin
KH, Humphrey PA, Horowitz JM. Sp1 binds promoter elements
regulated by the RB protein and Sp1-mediated transcription is
stimulated by RB coexpression. Proc Natl Acad Sci
U S A. 1993;90:3265-3269.
This article has been cited by other articles:
 |
|
 |
|
  J. Kotzka, D. Müller-Wieland, G. Roth, L. Kremer, M. Munck, S. Schürmann, B. Knebel, and W. Krone Sterol regulatory element binding proteins (SREBP)-1a and SREBP-2 are linked to the MAP-kinase cascade J. Lipid Res., January 1, 2000; 41(1): 99 - 108. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. P. Hajjar and M. E. Haberland Lipoprotein Trafficking in Vascular Cells. MOLECULAR TROJAN HORSES AND CELLULAR SABOTEURS J. Biol. Chem., September 12, 1997; 272(37): 22975 - 22978. [Full Text] [PDF]
|
|
|
|
|
|
K. D. Mehta, R. Chang, J. Underwood, J. Wise, and A. Kumar Identification of a Novel cis-Acting Element Participating in Maximal Induction of the Human Low Density Lipoprotein Receptor Gene Transcription in Response to Low Cellular Cholesterol Levels J. Biol. Chem., December 27, 1996; 271(52): 33616 - 33622. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||