Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1229-1239

This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Breviario, F.
Right arrow Articles by Dejana, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Breviario, F.
Right arrow Articles by Dejana, E.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1229-1239.)
© 1995 American Heart Association, Inc.


Articles

Functional Properties of Human Vascular Endothelial Cadherin (7B4/Cadherin-5), an Endothelium-Specific Cadherin

F. Breviario; L. Caveda; M. Corada; I. Martin-Padura; P. Navarro; J. Golay; M. Introna; D. Gulino; M. G. Lampugnani; E. Dejana

From the Istituto di Ricerche Farmacologiche Mario Negri, Milano, Italy (F.B., L.C., M.C., I.M.-P., P.N., J.G., M.I., M.G.L., E.D.), and CEA-CENG, Laboratoire d'Hématologie, DBMS, INSERM U217, Grenoble, France (D.G., E.D.).

Correspondence to E. Dejana, CEA-CENG, Laboratoire d'Hématologie, DBMS, INSERM U217, 17, rue des Martyrs, 38054 Grenoble, Cedex 9, France. E-mail elisabetta@bossons.ceng.cea.fr.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract Human vascular endothelial cadherin (VE-cadherin, 7B4/cadherin-5) is an endothelial-specific cadherin localized at the intercellular junctions. To directly investigate the functional role of this molecule we cloned the full-length cDNA from human endothelial cells and transfected its coding region into Chinese hamster ovary cells. The product of the transfected cDNA had the same molecular weight as the natural VE-cadherin in human endothelial cells, and reacted with several VE-cadherin mouse monoclonal antibodies. Furthermore, it selectively concentrated at intercellular junctions, where it codistributed with {alpha}-catenin. VE-cadherin conferred adhesive properties to transfected cells. It mediated homophilic, calcium-dependent aggregation and cell-to-cell adhesion. In addition, it decreased intercellular permeability to high–molecular weight molecules and reduced cell migration rate across a wounded area. Thus, VE-cadherin may exert a relevant role in endothelial cell biology through control of the cohesion and organization of the intercellular junctions.


Key Words: cadherin • endothelium • transfection


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The endothelial cells (ECs) constitute a most important permselective barrier controlling the passage of plasma proteins and circulating cells from blood to tissues (for review, see Reference 11 ). This property is regulated both by the caveolar-vescicular system and by the dynamic opening and closing of intercellular junctions (for review, see Reference 22 ). At the ultrastructural level, the types and numbers of EC junctions vary along the vascular tree3 ; they are well organized and numerous in the large vessels where the control of permeability is strict, whereas they almost disappear in the postcapillary venules, where cellular extravasation and exchange of plasma constituents need to be particularly efficient.4 Despite their biological relevance, little is known about the specific molecular components of interendothelial junctions and their reciprocal functional role.

Many cell-adhesive molecules belonging to the integrin,5 immunoglobulin, or cadherin6 7 families have been localized at intercellular junctions in epithelial cells. Cadherins are calcium-dependent and protease-sensitive adhesive proteins that mediate homotypic cell-to-cell adhesion.8 9 10 Structurally, cadherins are single-chain transmembrane glycoproteins localized at specialized structures such as adherence junctions in cardiac cells and intermediate junctions in intestinal epithelia.11 12 The intracellular domain of cadherins is linked to specific cytoplasmic proteins named catenins. Three different catenins have been identified: {alpha}, ß, and {gamma} (or plakoglobin). Catenins are highly conserved along the phylogenetic tree and amongst different cell types.13 14 The most important biological role of cadherins is to support homotypic cell aggregation and segregation, which during embryogenesis promote the formation of defined tissues and organs. Despite their similar biochemical properties, each cadherin is characterized by a different spatiotemporal pattern of expression and cell-binding specificity. In humans, E-cadherin, or uvomorulin, is essentially found in epithelia and in subsets of neurons, N-cadherin is expressed in the nervous system and in skeletal and cardiac muscles, and P-cadherin exhibits a widespread distribution.9 Recent studies identified many additional vertebrate and invertebrate proteins15 16 17 that are included in the cadherin gene family on the basis of their structural homologies. However, in most cases their functions as adhesive molecules remain to be defined.

In a previous article we identified a monoclonal antibody, 7B4, that recognizes a protein present at the intercellular junctions of human ECs both in vitro and in vivo.18 From results of an analysis of a large series of normal and pathological tissues, this antigen appeared to be expressed only on the endothelium of all types of vessels. The amino terminal and some internal peptide sequences of the affinity-purified human 7B4 antigen18 were found to be identical to the cDNA-deduced amino acid sequence of a member of the cadherin family called cadherin-5.15 Further work indicated that the 7B4 antigen is localized at the intercellular junctions of the endothelium only when the cells come into contact with one another, and its distribution is modified after treatment of the cells with permeability-increasing agents.18 These results suggested that the 7B4 antigen is involved in endothelial cell-to-cell adhesion. However, direct data on the functional role of this molecule are not available.

In this report we describe the isolation, from human ECs, of the full-length cDNA of 7B4/cadherin-5 and the expression of its coding region in heterologous Chinese hamster ovary (CHO) cells after transfection. The analysis of different biological properties of transfectants indicates that 7B4 antigen has adhesive properties and controls a series of functions potentially relevant in EC biology. Given its selective expression in ECs, we propose for 7B4/cadherin-5 the name VE-cadherin (vascular endothelial cadherin).


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Antibodies and Recombinant Fragments
Mouse monoclonal antibodies (mAbs) to human VE-cadherin were clone TEA 1.31,19 clone BV9 (Hemeris), and clone BV6 (Bioline), characterized by immunodepletion analysis following the procedure described by Leach et al.19 All three clones reacted with epitopes on the extracellular domain of the molecule as indicated by positive staining of intact living cells (flow cytometry analysis; see below). Rabbit pan-cadherin antiserum against the conserved cytoplasmic sequence of all cadherins20 was a kind gift of Dr B. Geiger (Weizmann Institute, Rehovot, Israel). Rat mAb to {alpha}-catenin (clone {alpha}18) was kindly donated by Dr A. Nagafuchi (National Institute for Physiological Sciences, Okazaki, Japan).

Recombinant fragments spanning the extracellular domains of either VE-cadherin or the GpIIIa subunit were produced in Escherichia coli cDNA fragments encoding partial VE-cadherin or GpIIIa sequences were generated by polymerase chain reaction (PCR). For each fragment, the primers were designed to create, at the 5' end, an EcoRI site and, at the 3' end, an in-frame stop codon followed by a HindIII restriction site. cDNA fragments containing the sequences from nucleotide 166 to nucleotide 1482 for VE-cadherin (Fig 1Down) and from nucleotide 658 to nucleotide 1200 for the GpIIIa subunit21 were generated. The fragments were then cloned into the expression vector pTG1924 containing the heat-inducible promoter PL and sequenced to verify that no spontaneous mutation had arisen during PCR reaction. The resulting pTG-derived vectors expressed VE-cadherin (D48-K486) and GpIIIa (F214-L394). Production and purification of these two recombinant proteins were made as previously described.22



View larger version (68K):
[in this window]
[in a new window]
 
Figure 1. FigureUp shows nucleotide and amino acid sequences of human VE cadherin cDNA. The arrow shows the proteolytic cleavage site of the protein precursor. The seven potential N-glycosylation sites are indicated by the open circles. The deduced amino acid sequences confirmed by direct sequencing of the affinity-purified protein18 are indicated by dots. The transmembrane domain is underlined and the polyadenylation signal is double underlined. The two potential ATG initiation codons are indicated by asterisks. The new part of the sequence added at the 3' end has been shifted by one line. The nucleotide sequence data are available from EMBL/Genebank (accession number X79981).

Cells
Human ECs from umbilical cord vein were isolated and cultured as previously described.18 CHO cells were cultured in Dulbecco modified Eagle's medium (DMEM) with 10% fetal calf serum (FCS) (culture medium). CHO cells transfected with the full-length cDNA of human N-cadherin23 were kindly provided by Dr B. Geiger and Dr O. Ayalon, (Weizmann Institute) and CHO cells transfected with ß1 integrin chain cDNA were a kind gift of Dr G. Tarone (Universitá di Torino, Italy).24 Sterile plasticware was from Falcon (Becton Dickinson); culture medium and serum were from GIBCO.

RNA Extraction and Northern Blot Analysis
Total RNA was extracted and purified by use of the guanidinium isothiocyanate/CsCl2 method as described,25 and 10 µg was run in a standard formaldehyde/agarose gel, blotted onto nitrocellulose membrane (Schleicher and Schuell), and fixed at 80°C under vacuum for 2 hours. Hybridization and washing conditions were as described.25

PCR Amplification
On the basis of the cDNA sequence previously published15 we amplified, from human EC RNA, the coding region of human cadherin-5 (from nucleotide 103 to nucleotide 2442). This was done according to the protocol of the GeneAMP RNA PCR kit (Perkin Elmer Cetus) with the oligonucleotides pGCACGATCTGTTCCTCCTGGGAAG (nucleotides 68 to 91) and pGCTGTGGTGCCTGGAGTCTGACTGGCCTGGG (nucleotides 2490 to 2520). The PCR products were subcloned into the pCRII plasmid by use of the TA cloning kit (Invitrogen Corporation). A clone containing the human VE-cadherin coding sequence was identified and sequenced by use of the dideoxynucleotide chain termination method26 and was called pORFcad.

Library Screening, DNA Sequencing, and Computer Analysis
A cDNA library from human ECs was screened as previously described27 with the clone pORFcad used as a probe. Plaques showing a strong positive hybridization signal were screened three times to obtain a single clone. Phage inserts were rescued in the pBluescript vector and sequenced as described above. The nucleotide and deduced protein sequences were screened against the EMBL and Swissprot DataBank by use of a FASTA program28 as implemented on the EMBL net computer resource.29 Detailed sequence analyses were carried out with the PC/Gene sequence analysis package (Intelligenetics Corp).

Constructs and Transfections
The pORFcad plasmid was cut with EcoRI and the insert subcloned into the pECE eukaryotic expression vector30 to give the pECE–VE-cadherin construct. CHO cells were plated at 3x106 to 4x106 cells per 100-mm Petri dish in DMEM with 10% FCS. After 18 to 24 hours they were transfected by calcium phosphate precipitation with 17 µg pECE–VE-cadherin and 3 µg pSV2neo plasmids. Cells were washed once 24 hours later with serum-free medium and cultured for another 48 hours in DMEM with 10% FCS. They were then detached, plated at 1x106 per 100-mm Petri dish, and cultured in the presence of 1 mg/mL G-418 (Geneticin, GIBCO). After about 10 days in selective medium, the surviving colonies were ring cloned. G-418–resistant clones were screened for VE-cadherin expression by indirect immunofluorescence microscopy. The cells treated in this manner (VE-transfectants) were expanded in the presence of G-418 (800 µg/mL) before being frozen for stock storage. Upon being thawed, the cells were cultured in the absence of G-418. VE-cadherin expression was stable for at least 20 in vitro passages (splitting ratio, 1:15 to 1:20).

The VE-transfectants were regularly checked for Mycoplasma contamination. Control cells, CHOs transfected with the empty pECE and pSV2neo plasmids, were selected, cloned, and cultured in the same way.

Western Blot
Cells grown to tight confluency were washed twice with Ca2+- and Mg2+-PBS and twice with serum-free DMEM. Cells were extracted with 1% Nonidet P40, 0.5% SDS in Tris-buffered saline (10 mmol/L Tris HCl and 150 mmol/L NaCl, pH 7.5), 1 mmol/L PMSF, and 20 U/mL aprotinin for 20 minutes on ice. Cell extracts were passed through a 21-gauge needle to shear DNA and centrifuged at 13 000 rpm for 5 minutes at 4°C. The supernatants corresponding to 3x105 cells were separated by SDS-electrophoresis on a 7.5% SDS-polyacrylamide gel under reducing conditions. The gel was then incubated for 30 minutes (2x 15 minutes) in transfer buffer (50 mmol/L Tris HCl, 95 mmol/L glycine, and 1 mmol/L CaCl2). Proteins were electrotransferred onto nitrocellulose (Bio-Rad Laboratories), which was blocked with 10% low-fat milk (Magist, Gespal) in Ca2+- and Mg2+-PBS (blocking buffer) and incubated overnight with the appropriate antibody (TEA 1.31, BV6, or BV9 hybridoma culture supernatant, diluted 1:2 in blocking buffer). This was sequentially followed by 60 minutes of incubation with rabbit anti-mouse IgG (20 µg/mL, Dako) and 90 minutes of incubation with 125I-labeled protein A (about 105 cpm/mL; Amersham International). Between the various steps the nitrocellulose was washed several times with blocking buffer containing 0.1% Tween 20. The immunoreactive bands were revealed by autoradiography. In some experiments cell extracts, obtained as above but in the absence of SDS, were immunoprecipitated with antibodies to VE-cadherin as described18 before being immunoblotted with antibodies to {alpha}-catenin.

Immunofluorescence Microscopy
CHO cells were cultured on glass coverslips (13 mm in diameter) set in a well of a 24-well plate. For EC culturing (either pure culture or coculture with VE-transfectants), glass coverslips were coated with human plasma fibronectin (7 µg/mL). Cells were fixed with 3% paraformaldehyde, permeabilized with 0.5% TX-100, and processed for indirect immunofluorescence microscopy.18 Incubation with the primary antibody was followed by incubation with rhodamine-conjugated secondary antibody (Dakopatts) in the presence of fluorescein-labeled phalloidin (Sigma Chemical Co) with several washes in 0.1% BSA-TBS between the various steps. Coverslips were then mounted in Mowiol 4-88 (Calbiochem). A Zeiss Axiophot microscope was used for observation and image recording on Kodak TMax P3200 films.

Cell Aggregation
VE-cadherin is particularly sensitive to trypsin even in the presence of calcium18 ; therefore, preliminary experiments were performed to establish the detaching protocol that maximally preserved VE-cadherin antigen on the cell surface while maintaining virtually 100% cell viability. In particular, the cell layer was washed several times with Ca2+- and Mg2+-PBS and further incubated in the same buffer for 15 minutes at 37°C. Trypsin (0.01%; from bovine pancreas, type III, Sigma Chemical Co) in Hank's balanced salt solution with 25 mmol/L HEPES (HHBSS), 10 mmol/L CaCl2, and 5 mmol/L MgCl2 was then added and maintained on the cells for the shortest interval after which initial intercellular retraction appeared (usually 5 to 7 minutes; the progression of trypsin effect was carefully monitored under the microscope). Cells were completely and rapidly detached by vigorous shaking of the flasks. Trypsin action was stopped by addition of DMEM with 10% FCS and 0.1% soybean trypsin inhibitor (Sigma Chemical Co). Cells were then centrifuged and resuspended in HHBSS without Ca2+ and Mg2+ to obtain a single cell suspension. Cells were further centrifuged and resuspended in 1% BSA in Ca2+- and Mg2+-free HHBSS at a concentration of 4x105/mL. Cell suspension (0.5 mL/well) was seeded in a 24-well plate previously coated with 1% BSA to prevent cell adhesion.31 CaCl2 (2 mmol/L) was added to start calcium-dependent aggregation. Controls without calcium addition were always run in parallel. Incubation was for 90 minutes at 37°C on a rotating platform (80 rpm). The reaction was stopped with 5% glutaraldehyde (electron microscopy grade, Sigma Chemical Co; 0.5 mL/well).

The initial number of particles (Nt0) and the number of particles at 90 minutes (Nt90) were counted with a ZM Coulter Counter (window set at 6 to 100 µm). Aggregation was estimated by use of the formula (Nt0-Nt90)/(Nt0)x100 as described.8

To evaluate the formation of homophilic/heterophilic aggregates, either control or VE-transfectants in suspension (8x105/mL) were labeled with 2 µmol/L BCECF acetoxymethylester; Molecular Probes for 10 minutes at 37°C. Cells were then washed twice with 1% BSA-HHBSS and resuspended at 8x105/mL in 1% BSA-HHBSS. Labeled cells (0.25 mL) were mixed with 0.25 mL unlabeled VE-transfectants (8x105/mL) in a well of a 24-well plate. Aggregation was as described above in the presence of 2 mmol/L CaCl2. Aggregates were observed by both phase-contrast and fluorescence microscopy. The number of labeled and unlabeled cells in each aggregate was recorded and quantitative analysis of the aggregate composition was as described.32

Cell Adhesion
The adherent cell layer was obtained by culturing both CHO cells and ECs (3x103/well at seeding) in 96-well plates for 4 to 5 days to confluency. Cells to be used in suspension were labeled overnight with [125I]iododeoxyuridine (1 µCi/mL, Amersham). Detachment was as described above to preserve VE-cadherin on the cell surface. Labeled cell suspensions (3x104 cells in 100 µL DMEM with 10% FCS for each well) were added on the top of adherent cells (from which culture medium had been removed with no rinsing).33 Incubation was for 30 minutes at 37°C. Nonadherent cells were removed by three washes with Ca2+- and Mg2+-PBS containing 10% FCS. The well content was then solubilized with 1 mol/L NaOH/0.1% SDS (50 µL) and counted for radioactivity.33

Permeability Assay
Cells (1.5x104 at seeding) were cultured for 5 days in Transwell units (with polycarbonate filters, 0.4-µm pores; Costar). Culture medium was replaced, without washing, with serum-free medium (0.1 mL upper chamber and 0.6 mL lower chamber). Horseradish peroxidase (HRP) (0.126 µmol/L initial concentration in the upper chamber, type VI-A, 44 kD, specific activity 250 U/mg; Sigma Chemical Co) or HRP conjugated to goat immunoglobulin (HRPIg) (8 µg/mL initial concentration in the upper chamber, 200 kD minimum [calculated], specific activity 28 U/mg; Sigma Chemical Co) was added to the upper compartment. After 2 hours of incubation at 37°C, the medium in the lower compartment was assayed photometrically for the presence of HRP activity either with guajacol as a substrate18 when HRP was used or with o-phenylenediamine dihydrochloride as a substrate when HRPIg was used, according to the manufacturer's instructions (Sigma Chemical Co).

Cell Migration
Cells were cultured for 5 days in 24-well plates to result in a tight cell layer. The culture medium was aspirated and the cell layer was wounded by use of a plastic tip. Four diameters, regularly distanced by about 45°, were removed. The remaining cells were washed twice with culture medium to remove cell debris and incubated at 37°C in culture medium. At the indicated time intervals, cells were fixed with Fast Green FCF (0.02% in methanol) and stained with crystal violet (0.5% in methanol/water 20:80). The front of migrating cells was very distinguishable because it presented a light staining in comparison to the heavy staining of the cell layer at the original front edge. The distance migrated by the cells was measured by use of a micrograduated scale (Nikon) adapted in the ocular of a Nikon inverted microscope under phase contrasts (magnification x100). Twelve values, obtained in three parallel wells, were recorded for each cell type at each time interval.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Nucleotide Sequence of VE-Cadherin
The amino terminal and five internal peptide sequences of the affinity-purified human 7B4 antigen18 were revealed to be identical to the putative amino acid sequence (called cadherin-5) of a human cDNA previously described.15 We therefore speculated that 7B4 antigen could be cadherin-5.18 To test this hypothesis, we isolated from human ECs the full-length cDNA of VE-cadherin. The cDNA clone (Fig 1Up) is 4000 bp long and very close in size to the signal observed in Northern blot analysis (Fig 2BDown, lane EC, and Reference 1515 ).



View larger version (66K):
[in this window]
[in a new window]
 
Figure 2. Photographs show vascular endothelial cadherin (VE-cadherin) protein and mRNA expression in Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants). Western immunoblot analysis (A) of three independent clones of VE-transfectants (9c, 5a, and 3g) shows a 135 kD protein identical to endothelial VE-cadherin (EC). Extracts from the same number of cells (3x105) have been separated in each lane (molecular size markers are indicated). Northern blot analysis (B) shows that VE-cadherin mRNA of VE-transfectants and EC run to positions corresponding to 2500 bp and 4100 bp, respectively. A total of 10 µg RNA was loaded in each lane. Control clone 1{alpha} does not express either VE-cadherin mRNA or protein.

As shown in Fig 1Up, the 4000-bp sequence contains 24 bp of putative 5' untranslated region, an open reading frame of 2352 bp that encodes for a polypeptide 784 amino acids long, and a 1621-bp 3' untranslated region. Comparison of the VE-cadherin cDNA sequence with the published cadherin-5 cDNA sequence15 reveals several differences: (1) VE-cadherin cDNA is 67 nucleotides shorter than the previously published cDNA at its 5' end. (2) Three changes at the nucleotide level are observed: two, at positions 408 and 1032 of VE-cadherin, do not modify the coded amino acids, and the third, at position 1574, changes isoleucine, the amino acid at position 513 in the cadherin-5 protein sequence, into threonine. (3) We report a 3' untranslated sequence about 900 nucleotides longer than the published cDNA, containing the polyadenylation signal and the poly(A) tail. (4) The presence at position 36 of a nucleotide, not previously described,15 introduces a frame elongation in VE-cadherin. A new putative first methionine four amino acids upstream of that previously described could be used to initiate translation. The new putative first ATG, as well as the other ATG described,15 conforms to the Kozak consensus sequences for initiation of translation.34 It has been noted that the newly observed ATG is the only one conserved in the murine VE-cadherin cDNA (F.B., unpublished data, 1995). The characteristics of the VE-cadherin cDNA described above have been confirmed in two independent PCR amplifications and in three independently isolated cDNA clones.

Expression of VE-Cadherin in CHO Cells
To gain information on VE-cadherin biological activity and to confirm the validity of our cDNA sequence, we transfected CHO cells with a pECE–VE-cadherin plasmid that contained a fragment from nucleotide 1 to nucleotide 2454 of the reported VE-cadherin cDNA (Fig 1Up). pSV2neo plasmid, for neomycin resistance, was cotransfected for selection. Successful transfection and selective procedures were validated by Western and Northern blot analyses of VE-transfectant clones (Fig 2AUp and 2BUp, respectively). As indicated in Fig 2BUp, a band of RNA approximately 2500 bp in size was evident in the VE-transfectants and absent in control cells (CHO cells transfected with the neomycin-resistance gene only). The size of mRNA observed was consistent with the introduced cDNA (about 2500 nucleotides long). By comparison, the endogenous endothelial mRNA is about 4100 bp long (Fig 2BUp).

CHO cells did not normally express any cadherin, as indicated by the absence of reactivity to a pan-cadherin antibody directed against the conserved cytoplasmic domain of all known cadherins,20 including VE-cadherin,18 both in immunofluorescence microscopy and in Western blot analysis (data not shown). Control cells did not show reactivity to VE-cadherin mAbs in Western blot analysis (Fig 2AUp for the typical clone 1{alpha}; comparable results have been obtained with the other control clones 2ß and 3{alpha}).

As shown in Fig 2AUp, some typical VE-cadherin positive clones (9c, 5a, 3g) presented upon Western blot analysis a band of 135 kD (apparent) comigrating with the immunoreactive band observed in human umbilical vein ECs. Occasionally a smaller band of about 120 kD could be detected in VE-transfectants and in ECs (Fig 2AUp, clones 9c and 5a, and data not shown). This band probably corresponds to a degradation product of the molecule.

The antibodies (TEA 1.31, BV6, and BV9) also immunoprecipitated from [35S]methionine–metabolically labeled VE-transfectants a protein of molecular weight identical to that of endothelial VE-cadherin (data not shown). Our VE-cadherin–transfected clones showed comparable levels of mRNA and protein with respect to the endogenous endothelial gene (Fig 2BUp and 2AUp). In addition, when adherent monolayers were observed, both VE-transfectants (Fig 3dDown) and ECs (Fig 3fDown) appeared to be 100% positive. Moreover, a comparable amount of VE-cadherin could be immunoprecipitated from 125I–surface-labeled VE-transfectants and ECs (data not shown). These data strongly suggest that our cDNA clone is able to direct normal expression and posttranslational processing of VE-cadherin gene in CHO cells.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 3. Photographs show vascular endothelial cadherin (VE-cadherin) localization at intercellular contacts. Phase-contrast photomicrographs are shown (a, b, and c). Indirect immunofluorescence microscopy shows that VE-cadherin expressed by Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants) (d) is localized at intercellular contacts in a way comparable to that in endothelial cells (f). The endogenous cytoplasmic protein {alpha}-catenin also codistributes at cell-to-cell contacts in VE-transfectants expressing the heterologous VE-cadherin (g). {alpha}-Catenin is also found at intercellular contacts in endothelial cells (i). Control cells, negative for VE-cadherin (e), do not show {alpha}-catenin at intercellular contacts (h). In the figure, VE-transfectants are from clone 5a and control cells are from clone 1{alpha}. The same results were obtained with all the other VE-transfectants or control clones used in this study. Immunofluorescence bar indicates 20 µm; phase contrast bar, 60 µm.

Transfected VE-Cadherin Localizes at Intercellular Junctions and Codistributes With {alpha}-Catenin
VE-cadherin staining with specific mAbs (clones TEA 1.31, BV6, and BV9) showed selective localization of the antigen at cell-to-cell junctions (Fig 3dUp) with a pattern very similar to that observed in ECs (Fig 3fUp). VE-cadherin staining was absent in control cells (Fig 3eUp). The pan-cadherin antibody immunostained cell-to-cell contacts of VE-transfectants (data not shown), further indicating that the cytoplasmic tail of the molecule was correctly expressed. In addition, to analyze the association of human VE-cadherin with cytoplasmic regulatory proteins, as for other cadherins,10 we studied the distribution of {alpha}-catenin both in VE-transfectants and ECs. As reported in Fig 3gUp and 3iUp, {alpha}-catenin was found to be localized at cell-to-cell junctions in both cell types. Control cells did not show any significant staining with {alpha}-catenin antibody (Fig 3hUp). Moreover, {alpha}-catenin coimmunoprecipitated with VE-cadherin both in VE-cadherin transfectants and in ECs (Fig 4Down).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 4. Western blots show coimmunoprecipitation of {alpha}-catenin with vascular endothelial cadherin (VE-cadherin) in Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants) and endothelial cells (ECs). Cell extracts from VE-transfectants, control transfectants, and ECs were immunoprecipitated with antibodies to VE-cadherin. The immunoprecipitates and aliquots of the initial cell extracts (total) were separated by SDS electrophoresis, transferred to nitrocellulose by Western blotting, and reacted with antibodies to {alpha}-catenin. A band of about 100 kD was detected both in VE-cadherin immunoprecipitates and in total cell extracts of VE-transfectants and ECs. As expected, no reactivity was observed in the immunoprecipitate of control transfectants. In these cells a low level of {alpha}-catenin was detected in the total cell extract. We used 5x106 and 3x105 cells for each immunoprecipitate and total sample, respectively. The heavy bands at about 50 kD in the immunoprecipitate lanes are the immunoglobulins to VE-cadherin introduced into the samples at the immunoprecipitation step. The position of molecular weight markers is shown on the left.

Control cells presented a low level of {alpha}-catenin in the total cell extract (Fig 4Up). It remains to be established whether VE-cadherin induces transcription of {alpha}-catenin mRNA or stabilizes the protein, as reported.35 Overall, these data suggest that transfected VE-cadherin had a normal association with cytoplasmic modulators and indicate that it was able to interact with both hamster and human {alpha}-catenin.

The junctional localization of VE-cadherin required cell homotypic interaction. When a cluster of VE-transfectants came into contact with control cells (in coculture assay), no junctional localization of the molecule was observed (Fig 5aDown). However, this typical localization was present when the same VE-transfectants were in contact with other VE-transfectants (Fig 5aDown). After coculture of VE-transfectants with EC (Fig 5bDown), VE-cadherin was localized at junctions between the two cell types, indicating that the ectopically expressed protein was able to interact with its natural putative counterreceptor in ECs.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 5. Indirect immunofluorescence photomicrographs show vascular endothelial cadherin (VE-cadherin) distribution in mixed cell cultures. Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants) (clone 5a) were cocultured with control cells (clone 1{alpha}) (a) or endothelial cells (ECs) (b and c). VE-transfectants concentrate the protein exclusively in the regions of contacts with other VE-cadherin–expressing cells (either VE-transfectants or ECs). In c, ECs (on the left) can be distinguished from VE-transfectants (on the right) because they are von Willebrand factor–positive (c shows the same field as in b of cells double labeled for VE-cadherin and von Willebrand factor). The border between ECs and VE-cadherin transfectants is indicated by arrows (b). Bar indicates 20 µm in a and 10 µm in b and c.

VE-Cadherin Mediates Adhesion Between Transfected Cells
To evaluate whether VE-cadherin is competent in mediating adhesive interactions, we examined VE-transfectants for their ability to aggregate from a single cell suspension. VE-transfectants formed small aggregates in the presence of calcium, whereas control cells remained mostly single. In the presence of calcium, VE-transfectants aggregated three to four times more effectively than control transfectants (Fig 6Down). To test the specificity of the aggregation, we added a soluble recombinant fragment of VE-cadherin corresponding to the amino terminal domain of the molecule (see "Methods") to the cells before the aggregation assay. As shown in Fig 6Down, the soluble fragment was able to inhibit CHO cell aggregation. A control fragment corresponding to part of the GpIIIa sequence was ineffective. Unfortunately, none of the three mAbs used in this study (TEA 1.31, BV9, and BV6) was able to affect aggregation at levels of IgG up to 100 µg/mL.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Bar graph shows effect of vascular endothelial cadherin (VE-Cad) transfection on cell aggregation. Aggregation was quantified as described in "Methods." Only Chinese hamster ovary cells transfected with VE-Cad (VE-transfectants) express significative Ca2+-dependent aggregation. VE-Cad but not GpIIIa-soluble recombinant fragments (Cad 1 and GpIIIa, respectively) inhibited transfectant aggregation in a concentration-dependent way. Data are shown from a representative experiment of five done with the same clones (1{alpha}, of control cells, and 5a, of VE-transfectants). Comparable results were obtained with two additional VE-transfectant clones (9c and 3g) and one control clone (2ß). Values are mean±SD from triplicates. *P<.01 vs control by ANOVA and Duncan's test.

We then investigated whether VE-cadherin binding was homophilic. Aggregation assays were performed after mixing of control and VE-cadherin–transfected cells. To distinguish between the two cell types, control cells were vitally labeled with the fluorescent dye BCECFAM. Aggregates were examined by fluorescence microscopy. A homophilic adhesion mechanism would produce mostly aggregates of unlabeled VE-transfectants, whereas a heterophilic adhesion mechanism would produce mixed aggregates of unlabeled VE-transfectants and labeled control cells. The results of such experiments, reported in Fig 7BDown, showed that aggregation was essentially homophilic; ie, only VE-cadherin–expressing cells were present in the aggregates whereas control cells remained mostly single. Only occasionally were a few control cells observed attached at the periphery of the aggregates. Mixing BCECFAM-labeled and -unlabeled VE-transfectants produced mixed aggregates with the frequency of distribution expected for homophilic aggregation (Fig 7ADown; see Reference 3232 ). Finally, to further confirm the adhesive property of VE-cadherin in a different system, we incubated monolayers of control cells, VE-transfectants, N-cadherin transfectants, and ECs with radiolabeled suspensions of control cells, VE-transfectants, or N-cadherin transfectants. As shown in Fig 8Down, VE-transfectants adhered more efficiently to VE-transfectant and EC monolayers than to control and N-cadherin cell monolayers. Conversely, control cells adhered poorly to any cell type tested. N-cadherin transfectants recognized N-cadherin transfectants more efficiently than heterologous cell monolayers. These data show that VE-cadherin in cell monolayers is available for binding to cells in suspension and support the idea that VE-cadherin retains adhesive properties and promotes homotypic cell interaction. We suggest that VE-cadherin molecules are also present at the apical surfaces of both VE-transfectant and EC monolayers to sustain the adhesive interaction observed. A similar mechanism would explain the homophilic adhesion of N-cadherin transfectants.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Bar graphs show data for homophilic aggregation of Chinese hamster ovary cells transfected with vascular endothelial (VE) cadherin (VE-transfectants). VE-transfectants (clone 5a) were mixed with the same number of either VE-transfectants (A) or control cells (clone 1{alpha}) (B) labeled with the fluorescent probe BCECFAM (indicated by an asterisk). Cells were left to aggregate in the presence of Ca2+ as in Fig 6Up. The composition of aggregates was observed by fluorescence microscopy. The number of aggregates (x axis) that had the reported frequency of labeled and unlabeled cells (y axis) for randomly chosen aggregates of six cells is shown. Comparable results were obtained with aggregates of 4, 5, 7, and 8 cells. VE-transfectants form homotypic aggregates with VE-transfectants (A) but segregate from control cells (B).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 8. Bar graphs show homophilic adhesion of vascular endothelial cadherin (VE-cadherin)–transfected cells. Cell suspensions of either control cells (clone 1{alpha}), Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants) (clone 5a), or N-cadherin transfectants were seeded on cell layers of controls, VE-transfectants, N-cadherin transfectants, or endothelial cells (EC). VE-transfectants significantly adhered to either homologous VE-transfectant or EC monolayers, whereas control cells adhered poorly to any cell type. N-cadherin transfectants attached effectively only to N-cadherin transfectant monolayers. Data from a representative experiment are reported. Values are mean±SD from triplicates. Adhesion of VE-transfectants on either homologous VE-transfectants or EC and of N-cadherin transfectants on homologous N-cadherin transfectants was statistically different with respect to adhesion of any other cell pair (*P<.01 by ANOVA and Duncan's test).

VE-Cadherin Decreases the Passage of High–Molecular Weight Molecules Through the Cell Monolayer
To evaluate whether VE-cadherin expression could increase the cohesion of cell-to-cell contacts, we used an in vitro assay to quantify the passage of high–molecular weight molecules through the cell monolayer. VE-transfectants and control cells were cultured on Transwell filters and the passage of HRP conjugated to HRPIg through the cell monolayers was quantified. In preliminary experiments conditions to ensure a comparable number of cells on the filters and a similar degree of confluency were established. Cells on the filters essentially appeared in monolayers when fixed and stained with crystal violet and examined by phase-contrast microscopy.

As shown in Fig 9Down, permeation of HRPIg through VE-transfectant monolayers was significantly reduced in comparison to control cell monolayers. This difference was lost when 5 mmol/L EGTA was added to the culture medium to reduce calcium concentration during the assay. In preliminary experiments this condition did not cause a significant cell retraction or detachment from the substratum. In Fig 9Down are reported the data obtained in a typical experiment; a consistent and statistically significant decrease in permeability of 40% to 50% was always observed in six additional experiments in which four separate VE-cadherin transfectant clones were used. Comparable results were obtained when a smaller molecule, unconjugated HRP, was used as a permeation marker (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 9. Bar graph shows effect of vascular endothelial cadherin (VE-cadherin) transfection on cell junction permeability. A monolayer of Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants) (clone 5a) on a Transwell filter reduces the permeation of a high–molecular weight probe (see "Methods") in comparison to a monolayer of control transfectants (1{alpha}). Addition of EGTA (5 mmol/L) abolished this difference. Results of one representative experiment of seven performed with the same clones are shown. Comparable results were obtained with additional VE-transfectant clones (9c, 3c, and 10a) and a control (2ß) clone. The values are mean±SD from triplicates. *P<.01 VE-transfectants vs controls by ANOVA and Duncan's test.

VE-Cadherin Transfection Reduces the Migration Rate of the Cells
As a further indication of the strength of intercellular contacts in VE-transfectants, we analyzed the capacity of the cells to migrate into a "wounded" area produced in the cultured monolayer. Monolayers were scratched to form a uniform cell-free lesion of determined size. At different times after the lesion, the distance covered by the migrating front was measured. As shown in Fig 10ADown, VE-transfectants had a lower migration rate and showed a tighter cell front compared with the control cells. Fig 10BDown shows the time course of the migration of control and VE-transfectants. For up to 20 hours, VE-transfectants covered a distance significantly shorter than controls. The observed changes in cell migration were not due to differences in the proliferative rates of the various clones because within the time course of the experiment (20 hours) the number of VE-transfectants was not significantly different from control cells (data not shown).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 10. Phase-contrast microscopy shows effect of vascular endothelial cadherin (VE-cadherin) transfection on wound repair (A). Layers of Chinese hamster ovary cells transfected with VE-cadherin (VE-transfectants) (clone 5a) or control cells (clone 1{alpha}) were wounded and migration of cells out of the wound edge was observed at different times. Crystal violet staining was used to show the morphology of the migrating front 4 hours after a "wounded" area was produced in the cultured monolayer. B, Graph shows the time course of the migration of VE-transfectants (5a; {triangleup}) and control cells (1{alpha}; {blacksquare}) out of the wound edge quantified as described in "Methods." The values are mean±SD of four experiments, each done in triplicate. At all the times, migration values for VE-transfectants were significantly different from the migration values of control transfectants (*P<.01 ANOVA and Duncan's test).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
This article analyzes the biological activity of VE-cadherin. The relevance of this molecule is that it is selectively expressed in ECs.18 In these cells it is strictly concentrated at the interendothelial junctions, suggesting that it may play a role in cell-to-cell adhesion and in maintaining the normal architecture of the blood vessels.

In this study we expressed human VE-cadherin in heterologous cells and directly evaluated its biological properties. For transfection, the full-length cDNA of human VE-cadherin was cloned and sequenced. Sequence analysis revealed few differences with respect to the previously reported sequence of cadherin-5.15 Most importantly, the sequence was completed by addition of a 3' nucleotide tail containing the polyadenylation signal and the poly(A) tail (lacking in the previously described cadherin-5 cDNA), and a novel putative ATG initiation codon was identified.

We found that VE-transfectants acquired homotypic cell-to-cell adhesive properties. In the classical test of single-cell aggregation in the presence of calcium8 the aggregates formed were relatively small (the majority were composed of 5 to 10 cells). A soluble fragment corresponding to the amino terminal domain of the molecule was able to inhibit cell aggregation, demonstrating the specificity of the effect. The three mAbs used in this study (TEA 1.31, BV9, and BV6) did not inhibit aggregation. The easiest explanation for this is that they recognize a molecular domain of VE-cadherin that is not relevant for the adhesive properties of the molecule. Alternatively, VE-cadherin homotypic binding might be due to the multiple interactions of different molecular epitopes. In this case different binding sites need to be blocked at the same time. One mAb or even the cocktail of the three might not be sufficient for this purpose.

The adhesive properties of VE-cadherin could be also demonstrated when single cell suspensions of VE-transfectants were added to a monolayer of homotypic VE-transfectants (see Fig 8Up). In these conditions VE-cadherin transfectants adhered more effectively to homotypic than to N-cadherin or control transfectants. This observation further supports the idea that VE-cadherin promotes a homotypic type of recognition. These experiments also suggest that VE-cadherin localization is not exclusively at junctions but that VE-cadherin could be found on the apical surface of the transfectants promoting adhesion of cells in suspension.

VE-cadherin presumably exerts its physiological role in cells attached to the extracellular matrix. In adherent cells the complete organization of adhesive molecules, as well as related cytoplasmic and cytoskeletal proteins at junctions, is required for sustaining a stable intercellular adhesion.36 37 In contrast, cell aggregation is a short-term effect that needs to counteract dynamic disrupting forces and during which a proper organization of intercellular junctions cannot occur. It was therefore of importance to investigate, in substrate-adherent cells, whether VE-cadherin transfection could change the organization and biological activity of cell junctions. As in ECs, in confluent VE-transfectants the molecule was localized at the intercellular contacts in a homotypic way. The cytoplasmic domain of cadherins mediates binding to the cytoskeleton and is required for normal functioning of these adhesive molecules.13 In this article we showed by immunofluorescence microscopy that {alpha}-catenin, one of the specific cytoplasmic proteins connecting cadherins to the cytoskeleton,13 14 codistributed with VE-cadherin in both ECs and VE-transfectants. In addition, {alpha}-catenin coimmunoprecipitated with VE-cadherin in both ECs and VE-transfectants, indicating a physical linkage between the two molecules. These data indirectly indicate that the ectopically expressed VE-cadherin was regularly associated with catenins, as happens in ECs, and suggest that the intercellular junctions of VE-transfectants were properly organized.

To evaluate whether VE-cadherin expression could increase cohesion of intercellular junctions in adherent cells, we measured the permeation of high–molecular weight proteins through VE-transfectant monolayers. VE-transfectants showed a significant decrease in permeability compared with control cells, and this effect was abolished in conditions of low calcium concentration. These data suggest that VE-cadherin could contribute to the regulation of junctional permeability. This is of particular relevance for the endothelium, which acts as a permselective barrier between plasma and tissues.4 Of course, much caution is necessary for extrapolation from an in vitro assay with an experimental cell line to the in vivo behavior of the physiologically regulated endothelium. We have previously shown that agents able to increase EC permeability in vitro and in vivo induced a disruption of VE-cadherin organization at intercellular junctions.18 This was an indirect proof that this molecule could play a relevant role in the regulation of cell permeability. The data reported here provide a more direct support for this hypothesis.

EC migration is another important process necessary in embryonic development, repair of vascular injury, and angiogenesis.38 The appropriate movements of individual cells are guided by their interaction with the extracellular matrix and with neighboring cells. To build up new vascular structures, ECs need to disrupt intercellular junctions, detach from the cell monolayers, and invade the underlying tissues. We show here that VE-cadherin transfection decreases the rate of cell migration. The mechanism by which VE-cadherin exerts this effect is not known. The easiest explanation is that by enhancing cell-to-cell adhesion it physically tethers adjacent cells together and prevents cell-from-cell separation required for sheet migration. Immunofluorescence microscopy showed that, during EC migration into a wounded area, VE-cadherin becomes disorganized from cell-to-cell borders (M.G.L., unpublished data, 1995). Overall, these data suggest that VE-cadherin redistribution and inactivation favor EC detachment and migration.

Transfection of E-cadherin into mouse L cells inhibits their capacity to migrate.39 In general, the loss of cadherins and, in particular, of E-cadherin increases the invasiveness of tumor cells.17 Similar functional properties of cadherins might have different biological consequences specific for the cell type in which the cadherin is expressed. In ECs, inhibition of cell migration would be related to inhibition of new vessel formation or repair of a vascular injury, whereas in tumor cells it would be related to a less invasive and metastatic phenotype.17

While this article was in preparation Tanihara et al40 reported that cell transfection of VE-cadherin/cadherin-5 did not cause cell aggregation. An easy explanation for the discrepancy between our results and theirs is that VE-cadherin is particularly sensitive to trypsin digestion,18 and because Tanihara et al detached the cells with trypsin and EDTA most of the molecule was lost on the cell surface. ECs express two other cadherins, N- and P-cadherin,23 41 which are not specific for ECs.9 10 In addition, Heimark et al42 described the presence of an endothelial cadherin-like molecule in bovine endothelium. They reported downregulation of the activity and level of this protein in response to the mitogenic effects of acidic and basic fibroblast growth factors.43

Other noncadherin molecules, such as integrins44 and platelet endothelial cell adhesion molecule (PECAM),45 46 have been found to be localized at intercellular junctions in the endothelium. PECAM plays a role in leukocyte extravasation47 and EC wound repair.48 49 The reciprocal role of these molecules in regulating junction organization and biological activity in the endothelium remains to be clarified.


*    Acknowledgments
 
This work was supported by the Italian National Research Council (special project: Applicazioni Cliniche della Ricerca Oncologica), the Associazione Italiana per la Ricerca sul Cancro. Dr Caveda is on leave of absence from the Center of Pharmaceutical Chemistry, Havana, Cuba. Dr Navarro is a recipient of a Human Capital and Mobility fellowship from the European Economic Community.

Received December 12, 1994; accepted April 12, 1995.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Lampugnani MG, Caveda L, Breviario F, Del Maschio A, Dejana E. Endothelial cell-to-cell junctions: structural characteristics and functional role in the regulation of vascular permeability and leukocyte extravasation. In: Caen JP, Tobelem G, eds. Bailliere's Clinical Haematology. London, UK: Ballière Tindall; 1993;6:539-558.

2. Rippe B, Haraldsson B. Transport of macromolecules across microvascular walls: the two-pore theory. Physiol Rev.. 1994;74:163-219. [Abstract/Free Full Text]

3. Franke WW, Cowin P, Grund C, Kuhn C, Kapprell HP. The endothelial junction: the plaque and its components. In: Simionescu N, Simionescu M, eds. Endothelial Cell Biology in Health and Disease. New York, NY: Plenum Publishing Corp; 1988:147-166.

4. Simionescu N, Simionescu M. Endothelial transport macromolecules: transcytosis and endocytosis. Cell Biol Rev.. 1991;25:5-80. [Medline] [Order article via Infotrieve]

5. Carter WG, Wayner EA, Bouchard TS, Kaur P. The role of integrins {alpha}2ß1 and {alpha}3ß1 in cell-cell and cell-substrate adhesion of human epidermal cells. J Cell Biol.. 1990;110:1387-1404. [Abstract/Free Full Text]

6. Geiger B, Ayalon O. Cadherins. Annu Rev Cell Biol.. 1992;8:307-332.

7. Kemler R. Classical cadherins. Semin Cell Biol.. 1992;3:149-155. [Medline] [Order article via Infotrieve]

8. Nose A, Nagafuchi A, Takeichi M. Expressed recombinant cadherins mediate cell sorting in model system. Cell.. 1988;54:993-1001. [Medline] [Order article via Infotrieve]

9. Takeichi M. Cadherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biochem.. 1990;59:237-252. [Medline] [Order article via Infotrieve]

10. Grunwald GB. The structural and functional analysis of cadherin calcium-dependent cell adhesion molecules. Curr Opin Cell Biol.. 1993;5:797-805. [Medline] [Order article via Infotrieve]

11. Boller K, Vestweber D, Kemler R. Cell-adhesion molecule uvomorulin is localized in the intermediate junctions of adult intestinal epithelial cells. J Cell Biol.. 1985;100:327-332. [Abstract/Free Full Text]

12. Takeichi M. Cadherin cell adhesion receptors as a morphogenic regulator. Science.. 1991;251:1451-1455. [Abstract/Free Full Text]

13. Nagafuchi A, Takeichi M. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO J.. 1988;7:3679-3684. [Medline] [Order article via Infotrieve]

14. Ozawa M, Baribault H, Kemler R. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J.. 1989;8:1711-1717. [Medline] [Order article via Infotrieve]

15. Suzuki S, Sano K, Tanihara H. Diversity of the cadherin family: evidence for eight new cadherins in nervous tissue. Cell Regul.. 1991;2:261-270. [Medline] [Order article via Infotrieve]

16. Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system. EMBO J.. 1993;12:2249-2256. [Medline] [Order article via Infotrieve]

17. Takeichi M. Cadherins in cancer: implications for invasion and metastasis. Curr Opin Cell Biol.. 1993;5:806-811. [Medline] [Order article via Infotrieve]

18. Lampugnani MG, Resnati M, Raiteri M, Pigott R, Pisacane A, Houen G, Ruco LP, Dejana E. A novel endothelial-specific membrane protein as a marker of cell-cell contacts. J Cell Biol.. 1992;118:1511-1522. [Abstract/Free Full Text]

19. Leach L, Clark P, Lampugnani MG, Arroyo AG, Dejana E, Firth JA. Immunoelectron characterization of the inter-endothelial junctions of human term placenta. J Cell Sci.. 1993;104:1073-1081. [Abstract]

20. Geiger B, Volberg T, Ginsberg D, Bitzur S, Sabanay I, Hines RO. Broad spectrum pan-cadherin antibodies, reactive with the C-terminal 24 amino acid residues of N-cadherin. J Cell Sci.. 1990;97:607-614. [Abstract/Free Full Text]

21. Frachet P, Uzan G, Thevenon D, Denarier E, Prandini MH, Marguerie G. GPIIb and GPIIIa amino acid sequences deduced from human megakaryocytes cDNAs. Mol Biol Rep.. 1990;14:27-33. [Medline] [Order article via Infotrieve]

22. Gulino D, Boudignon C, Zhang L, Concord E, Rabiet MJ, Marguerie G. Ca2+-binding properties of the platelet glycoprotein IIb ligand-interacting domain. J Biol Chem.. 1992;267:1001-1007. [Abstract/Free Full Text]

23. Salomon D, Ayalon O, Patel-King R, Hynes RO, Geiger B. Extrajunctional distribution of N-cadherin in cultured human endothelial cells. J Cell Sci.. 1992;102:7-17. [Abstract/Free Full Text]

24. Balzac F, Belkin AM, Koteliansky VE, Bolanov YV, Altruda F, Silengo L, Tarone G. Expression and functional analysis of a cytoplasmic variant of the ß1 integrin subunit. J Cell Biol.. 1993;121:171-178. [Abstract/Free Full Text]

25. Golay J, Capucci A, Arsura M, Castellano M, Rizzo V, Introna M. Expression of c-myb and B-myb, but not A-myb, correlates with proliferation in human hematopoietic cells. Blood.. 1991;77:149-158. [Abstract/Free Full Text]

26. Tabor S. Richardson CC. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci U S A.. 1987;84:4767-4771. [Abstract/Free Full Text]

27. Breviario F, d'Aniello EM, Golay J, Peri G, Bottazzi B, Bairoch A, Saccone S, Marzella R, Predazzi V, Rocchi M, Della Valle G, Dejana E, Mantovani A, Introna M. Interleukin-1-inducible genes in endothelial cells: cloning of a new gene related to C-reactive protein and serum amyloid P component. J Biol Chem.. 1992;267:22190-22197. [Abstract/Free Full Text]

28. Pearson WR, Lipman DJ. Improved tools for biological sequence comparison. Proc Natl Acad Sci U S A.. 1988;85:2444-2448. [Abstract/Free Full Text]

29. Stoehr PJ, Omond R. In: Collins J, Driesel AJ eds. Genome Analysis: From Sequence to Functions. Heidelberg, Germany: Huetlrig Buch Verlag; 1991;177.

30. Ellis L, Clauser E, Morgan DO, Edery M, Roth RA, Rutter WJ. Replacement of insulin receptor tyrosine residues 1162 and 1163 compromises insulin-stimulated kinase activity and uptake of 2-deoxyglucose. Cell.. 1986;45:721-732. [Medline] [Order article via Infotrieve]

31. Takeichi M. Functional correlation between cell adhesive properties and some cell surface proteins. J Cell Biol.. 1977;75:464-474. [Abstract/Free Full Text]

32. Sieber F, Roseman S. Quantitative analysis of intercellular adhesive specificity in freshly explanted and cultured cells. J Cell Biol.. 1981;90:55-62. [Abstract/Free Full Text]

33. Lauri D, Martin-Padura I, Biondelli T, Rossi G, Bernasconi S, Giavazzi R, Passerini F, Van Hinsbergh V, Dejana E. Role of ß1 integrins in tumor cell adhesion to cultured human endothelial cells. Lab Invest.. 1991;65:525-531. [Medline] [Order article via Infotrieve]

34. Kozak M. The scanning model for translation: an update. J Cell Biol.. 1989;108:229-241. [Abstract/Free Full Text]

35. Nagafuchi A, Takeichi M, Tsukita S. The 102 kd cadherin-associated protein: similarity to vinculin and posttranscriptional regulation of expression. Cell.. 1991;65:849-857. [Medline] [Order article via Infotrieve]

36. McNeill H, Ryan TA, Smith SJ, Nelson WJ. Spatial and temporal direction of immediate and early events following cadherin-mediated epithelial cell adhesion. J Cell Biol.. 1993;120:1217-1226. [Abstract/Free Full Text]

37. Tsukita S, Tsukita S, Nagafuchi A, Yonemura S. Molecular linkage between cadherins and actin filaments in cell-cell adherent junctions. Curr Opin Cell Biol.. 1992;4:834-839. [Medline] [Order article via Infotrieve]

38. Folkman J, Shing Y. Angiogenesis. J Biol Chem.. 1992;267:10931-10934. [Free Full Text]

39. Chen WC, Obrink B. Cell-cell contacts mediated by E-cadherin (uvomorulin) restrict invasive behavior of L-cells. J Cell Biol.. 1991;114:319-327. [Abstract/Free Full Text]

40. Tanihara H, Kido M, Obata S, Heimark RL, Davidson M, St John T, Suzuki S. Characterization of cadherin-4 and cadherin-5 reveals new aspects of cadherins. J Cell Sci.. 1994;107:1697-1704. [Abstract]

41. Liaw CW, Cannon C, Power MD, Kiboneka PK, Rubin LL. Identification and cloning of two species of cadherins in bovine endothelial cells. EMBO J.. 1990;9:2701-2708. [Medline] [Order article via Infotrieve]

42. Heimark RL, Degner M, Schwartz SM. Identification of a Ca2+-dependent cell-cell adhesion molecule in endothelial cells. J Cell Biol.. 1990;110:1745-1756. [Abstract/Free Full Text]

43. Bavisotto LM, Schwartz SM, Heimark R. Modulation of Ca2+-dependent intercellular adhesion in bovine aortic and human umbilical vein endothelial cells by heparin-binding growth factors. J Cell Physiol.. 1990;143:39-51. [Medline] [Order article via Infotrieve]

44. Lampugnani MG, Resnati M, Dejana E, Marchisio PC. The role of integrins in the maintenance of endothelial monolayer integrity. J Cell Biol.. 1991;112:479-490. [Abstract/Free Full Text]

45. Muller WA, Ratti CM, McDonnell SL, Cohn ZA. A human endothelial cell-restricted, externally disposed plasmalemmal protein enriched in intercellular junctions. J Exp Med.. 1989;170:399-414. [Abstract/Free Full Text]

46. Albelda SM, Oliver PD, Romer LH, Buck CA. EndoCAM: a novel endothelial cell-cell adhesion molecule. J Cell Biol.. 1990;110:1227-1237. [Abstract/Free Full Text]

47. Muller WA, Weigl SA, Deng X, Phillips DM. PECAM-1 is required for transendothelial migration of leukocytes. J Exp Med.. 1993;178:449-460. [Abstract/Free Full Text]

48. Schimmenti LA, Yan HC, Madri JA, Albelda SM. Platelet endothelial cell adhesion molecule, PECAM-1, modulates cell migration. J Cell Physiol.. 1992;153:417-428. [Medline] [Order article via Infotrieve]

49. Vaporcyan AA, DeLisser HM, Yan HC, Mendiguren II, Thorm SR, Jones ML, Ward PA, Albelda SM. Involvement of platelet-endothelial cell adhesion molecule-1 in neutrophil recruitment in vivo. Science.. 1993;262:1580-1582.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Reproductive SciencesHome page
Yang Gu, D. F. Lewis, J. S. Alexander, and Yuping Wang
Placenta-derived Chymotrypsin-like Protease (CLP) Disturbs Endothelial Junctional Structure in Preeclampsia
Reproductive Sciences, May 1, 2009; 16(5): 479 - 488.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Bardin, M. Blot-Chabaud, N. Despoix, A. Kebir, K. Harhouri, J.-P. Arsanto, L. Espinosa, P. Perrin, S. Robert, F. Vely, et al.
CD146 and its Soluble Form Regulate Monocyte Transendothelial Migration
Arterioscler Thromb Vasc Biol, May 1, 2009; 29(5): 746 - 753.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. S. Funa, V. Kriz, G. Zang, G. Calounova, B. Akerblom, J. Mares, E. Larsson, Y. Sun, C. Betsholtz, and M. Welsh
Dysfunctional Microvasculature as a Consequence of Shb Gene Inactivation Causes Impaired Tumor Growth
Cancer Res., March 1, 2009; 69(5): 2141 - 2148.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. A. Mourad-Zeidan, V. O. Melnikova, H. Wang, A. Raz, and M. Bar-Eli
Expression Profiling of Galectin-3-Depleted Melanoma Cells Reveals its Major Role in Melanoma Cell Plasticity and Vasculogenic Mimicry
Am. J. Pathol., December 1, 2008; 173(6): 1839 - 1852.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. F. Nottebaum, G. Cagna, M. Winderlich, A. C. Gamp, R. Linnepe, C. Polaschegg, K. Filippova, R. Lyck, B. Engelhardt, O. Kamenyeva, et al.
VE-PTP maintains the endothelial barrier via plakoglobin and becomes dissociated from VE-cadherin by leukocytes and by VEGF
J. Exp. Med., November 24, 2008; 205(12): 2929 - 2945.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Schulz, J. Pruessmeyer, T. Maretzky, A. Ludwig, C. P. Blobel, P. Saftig, and K. Reiss
ADAM10 Regulates Endothelial Permeability and T-Cell Transmigration by Proteolysis of Vascular Endothelial Cadherin
Circ. Res., May 23, 2008; 102(10): 1192 - 1201.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. S. Barbieri, L. Ruggiero, E. Tremoli, and B. B. Weksler
Suppressing PTEN Activity by Tobacco Smoke Plus Interleukin-1{beta} Modulates Dissociation of VE-Cadherin/{beta}-Catenin Complexes in Endothelium
Arterioscler Thromb Vasc Biol, April 1, 2008; 28(4): 732 - 738.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. E. Dewi, T. Takasaki, and I. Kurane
Peripheral blood mononuclear cells increase the permeability of dengue virus-infected endothelial cells in association with downregulation of vascular endothelial cadherin
J. Gen. Virol., March 1, 2008; 89(3): 642 - 652.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Labelle, H. J. Schnittler, D. E. Aust, K. Friedrich, G. Baretton, D. Vestweber, and G. Breier
Vascular Endothelial Cadherin Promotes Breast Cancer Progression via Transforming Growth Factor {beta} Signaling
Cancer Res., March 1, 2008; 68(5): 1388 - 1397.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. J. Najy, K. C. Day, and M. L. Day
ADAM15 Supports Prostate Cancer Metastasis by Modulating Tumor Cell-Endothelial Cell Interaction
Cancer Res., February 15, 2008; 68(4): 1092 - 1099.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Vestweber
VE-Cadherin: The Major Endothelial Adhesion Molecule Controlling Cellular Junctions and Blood Vessel Formation
Arterioscler Thromb Vasc Biol, February 1, 2008; 28(2): 223 - 232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. M. Shasby
Cell-cell adhesion in lung endothelium
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L593 - L607.
[Abstract] [Full Text] [PDF]


Home page
Exp Biol MedHome page
L. Hu, N. Ferrara, and R. B. Jaffe
Paracrine VEGF/VE-Cadherin Action on Ovarian Cancer Permeability
Exp Biol Med, November 1, 2006; 231(10): 1646 - 1652.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
A. P. Hall, F. R. Westwood, and P. F. Wadsworth
Review of the Effects of Anti-Angiogenic Compounds on the Epiphyseal Growth Plate
Toxicol Pathol, February 1, 2006; 34(2): 131 - 147.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Xiao, J. Garner, K. M. Buckley, P. A. Vincent, C. M. Chiasson, E. Dejana, V. Faundez, and A. P. Kowalczyk
p120-Catenin Regulates Clathrin-dependent Endocytosis of VE-Cadherin
Mol. Biol. Cell, November 1, 2005; 16(11): 5141 - 5151.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
H. Hudry-Clergeon, D. Stengel, E. Ninio, and I. Vilgrain
Platelet-activating factor increases VE-cadherin tyrosine phosphorylation in mouse endothelial cells and its association with the PtdIns3'-kinase
FASEB J, April 1, 2005; 19(6): 512 - 520.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Lambeng, Y. Wallez, C. Rampon, F. Cand, G. Christe, D. Gulino-Debrac, I. Vilgrain, and P. Huber
Vascular Endothelial-Cadherin Tyrosine Phosphorylation in Angiogenic and Quiescent Adult Tissues
Circ. Res., February 18, 2005; 96(3): 384 - 391.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Sengupta, S. Caballero, R. N. Mames, A. M. Timmers, D. Saban, and M. B. Grant
Preventing Stem Cell Incorporation into Choroidal Neovascularization by Targeting Homing and Attachment Factors
Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 343 - 348.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Iyer, D. M. Ferreri, N. C. DeCocco, F. L. Minnear, and P. A. Vincent
VE-cadherin-p120 interaction is required for maintenance of endothelial barrier function
Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1143 - L1153.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Wang, D. F. Lewis, Y. Gu, Y. Zhang, J. S. Alexander, and D. N. Granger
Placental Trophoblast-Derived Factors Diminish Endothelial Barrier Function
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2421 - 2428.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. A. Vincent, K. Xiao, K. M. Buckley, and A. P. Kowalczyk
VE-cadherin: adhesion at arm's length
Am J Physiol Cell Physiol, May 1, 2004; 286(5): C987 - C997.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Spagnuolo, M. Corada, F. Orsenigo, L. Zanetta, U. Deuschle, P. Sandy, C. Schneider, C. J. Drake, F. Breviario, and E. Dejana
Gas1 is induced by VE-cadherin and vascular endothelial growth factor and inhibits endothelial cell apoptosis
Blood, April 15, 2004; 103(8): 3005 - 3012.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. M. Nelson and C. S. Chen
VE-cadherin simultaneously stimulates and inhibits cell proliferation by altering cytoskeletal structure and tension
J. Cell Sci., September 1, 2003; 116(17): 3571 - 3581.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Xiao, D. F. Allison, M. D. Kottke, S. Summers, G. P. Sorescu, V. Faundez, and A. P. Kowalczyk
Mechanisms of VE-cadherin Processing and Degradation in Microvascular Endothelial Cells
J. Biol. Chem., May 23, 2003; 278(21): 19199 - 19208.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. C. Calkins, B. L. Hoepner, C. M. Law, M. R. Novak, S. V. Setzer, M. Hatzfeld, and A. P. Kowalczyk
The Armadillo Family Protein p0071 Is a VE-cadherin- and Desmoplakin-binding Protein
J. Biol. Chem., January 10, 2003; 278(3): 1774 - 1783.
[Abstract] [Full Text] [PDF]


Home page
Exp Biol MedHome page
M. L. C. Albuquerque and A. S. Flozak
Wound Closure in Sheared Endothelial Cells Is Enhanced by Modulation of Vascular Endothelial-Cadherin Expression and Localization
Exp Biol Med, December 1, 2002; 227(11): 1006 - 1016.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Venkiteswaran, K. Xiao, S. Summers, C. C. Calkins, P. A. Vincent, K. Pumiglia, and A. P. Kowalczyk
Regulation of endothelial barrier function and growth by VE-cadherin, plakoglobin, and beta -catenin
Am J Physiol Cell Physiol, September 1, 2002; 283(3): C811 - C821.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Corada, L. Zanetta, F. Orsenigo, F. Breviario, M. G. Lampugnani, S. Bernasconi, F. Liao, D. J. Hicklin, P. Bohlen, and E. Dejana
A monoclonal antibody to vascular endothelial-cadherin inhibits tumor angiogenesis without side effects on endothelial permeability
Blood, July 18, 2002; 100(3): 905 - 911.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Zanetti, M. G. Lampugnani, G. Balconi, F. Breviario, M. Corada, L. Lanfrancone, and E. Dejana
Vascular Endothelial Growth Factor Induces Shc Association With Vascular Endothelial Cadherin: A Potential Feedback Mechanism to Control Vascular Endothelial Growth Factor Receptor-2 Signaling
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 617 - 622.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. G. Lampugnani, A. Zanetti, F. Breviario, G. Balconi, F. Orsenigo, M. Corada, R. Spagnuolo, M. Betson, V. Braga, and E. Dejana
VE-Cadherin Regulates Endothelial Actin Activating Rac and Increasing Membrane Association of Tiam
Mol. Biol. Cell, April 1, 2002; 13(4): 1175 - 1189.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. van Wetering, J. D. van Buul, S. Quik, F. P. J. Mul, E. C. Anthony, J.-P. t. Klooster, J. G. Collard, and P. L. Hordijk
Reactive oxygen species mediate Rac-induced loss of cell-cell adhesion in primary human endothelial cells
J. Cell Sci., January 5, 2002; 115(9): 1837 - 1846.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Bardin, F. Anfosso, J.-M. Masse, E. Cramer, F. Sabatier, A. L. Bivic, J. Sampol, and F. Dignat-George
Identification of CD146 as a component of the endothelial junction involved in the control of cell-cell cohesion
Blood, December 15, 2001; 98(13): 3677 - 3684.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. K. Shaw, P. S. Bamba, B. N. Perkins, and F. W. Luscinskas
Real-Time Imaging of Vascular Endothelial-Cadherin During Leukocyte Transmigration Across Endothelium
J. Immunol., August 15, 2001; 167(4): 2323 - 2330.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Corada, F. Liao, M. Lindgren, M. G. Lampugnani, F. Breviario, R. Frank, W. A. Muller, D. J. Hicklin, P. Bohlen, and E. Dejana
Monoclonal antibodies directed to different regions of vascular endothelial cadherin extracellular domain affect adhesion and clustering of the protein and modulate endothelial permeability
Blood, March 15, 2001; 97(6): 1679 - 1684.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M Yanez-Mo, R Tejedor, P Rousselle, and F Sanchez -Madrid
Tetraspanins in intercellular adhesion of polarized epithelial cells: spatial and functional relationship to integrins and cadherins
J. Cell Sci., January 2, 2001; 114(3): 577 - 587.
[Abstract] [PDF]


Home page
Cancer Res.Home page
F. Liao, Y. Li, W. O’Connor, L. Zanetta, R. Bassi, A. Santiago, J. Overholser, A. Hooper, P. Mignatti, E. Dejana, et al.
Monoclonal Antibody to Vascular Endothelial-cadherin Is a Potent Inhibitor of Angiogenesis, Tumor Growth, and Metastasis
Cancer Res., December 1, 2000; 60(24): 6805 - 6810.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
X. Gao, P. Kouklis, N. Xu, R. D. Minshall, R. Sandoval, S. M. Vogel, and A. B. Malik
Reversibility of increased microvessel permeability in response to VE-cadherin disassembly
Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1218 - L1225.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. R. Allport, W. A. Muller, and F. W. Luscinskas
Monocytes Induce Reversible Focal Changes in Vascular Endothelial Cadherin Complex during Transendothelial Migration under Flow
J. Cell Biol., January 10, 2000; 148(1): 203 - 216.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. A. Castilla, M. V. A. Arroyo, E. Aceituno, P. Aragoncillo, F. R. Gonzalez-Pacheco, E. Texeiro, R. Bragado, and C. Caramelo
Disruption of Cadherin-Related Junctions Triggers Autocrine Expression of Vascular Endothelial Growth Factor in Bovine Aortic Endothelial Cells : Effects on Cell Proliferation and Death Resistance
Circ. Res., December 3, 1999; 85(12): 1132 - 1138.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Noria, D. B. Cowan, A. I. Gotlieb, and B. L. Langille
Transient and Steady-State Effects of Shear Stress on Endothelial Cell Adherens Junctions
Circ. Res., September 17, 1999; 85(6): 504 - 514.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. V Bobryshev, S. M Cherian, S. J Inder, and R. S.A Lord
Neovascular expression of VE-cadherin in human atherosclerotic arteries and its relation to intimal inflammation
Cardiovasc Res, September 1, 1999; 43(4): 1003 - 1017.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Corada, M. Mariotti, G. Thurston, K. Smith, R. Kunkel, M. Brockhaus, M. G. Lampugnani, I. Martin-Padura, A. Stoppacciaro, L. Ruco, et al.
Vascular endothelial-cadherin is an important determinant of microvascular integrity in vivo
PNAS, August 17, 1999; 96(17): 9815 - 9820.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
V Noe, J Willems, J Vandekerckhove, F. Roy, E Bruyneel, and M Mareel
Inhibition of adhesion and induction of epithelial cell invasion by HAV-containing E-cadherin-specific peptides
J. Cell Sci., January 1, 1999; 112(1): 127 - 135.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
T. L. Bach, C. Barsigian, C. H. Yaen, and J. Martinez
Endothelial Cell VE-cadherin Functions as a Receptor for the beta 15-42 Sequence of Fibrin
J. Biol. Chem., November 13, 1998; 273(46): 30719 - 30728.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Gulino, E. Delachanal, E. Concord, Y. Genoux, B. Morand, M.-O. Valiron, E. Sulpice, R. Scaife, M. Alemany, and T. Vernet
Alteration of Endothelial Cell Monolayer Integrity Triggers Resynthesis of Vascular Endothelium Cadherin
J. Biol. Chem., November 6, 1998; 273(45): 29786 - 29793.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
I. Martin-Padura, S. Lostaglio, M. Schneemann, L. Williams, M. Romano, P. Fruscella, C. Panzeri, A. Stoppacciaro, L. Ruco, A. Villa, et al.
Junctional Adhesion Molecule, a Novel Member of the Immunoglobulin Superfamily That Distributes at Intercellular Junctions and Modulates Monocyte Transmigration
J. Cell Biol., July 13, 1998; 142(1): 117 - 127.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Telo', F. Breviario, P. Huber, C. Panzeri, and E. Dejana
Identification of a Novel Cadherin (Vascular Endothelial Cadherin-2) Located at Intercellular Junctions in Endothelial Cells
J. Biol. Chem., July 10, 1998; 273(28): 17565 - 17572.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. Yanez-Mo, A. Alfranca, C. Cabanas, M. Marazuela, R. Tejedor, M. Angeles Ursa, L. K. Ashman, M. O. de Landazuri, and F. Sanchez-Madrid
Regulation of Endothelial Cell Motility by Complexes of Tetraspan Molecules CD81/TAPA-1 and CD151/PETA-3 with {alpha}3{beta}1 Integrin Localized at Endothelial Lateral Junctions
J. Cell Biol., May 4, 1998; 141(3): 791 - 804.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
P. Navarro, L. Ruco, and E. Dejana
Differential Localization of VE- and N-Cadherins in Human Endothelial Cells: VE-Cadherin Competes with N-Cadherin for Junctional Localization
J. Cell Biol., March 23, 1998; 140(6): 1475 - 1484.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Gory, J. Dalmon, M.-H. Prandini, T. Kortulewski, Y. de Launoit, and P. Huber
Requirement of a GT Box (Sp1 Site) and Two Ets Binding Sites for Vascular Endothelial Cadherin Gene Transcription
J. Biol. Chem., March 20, 1998; 273(12): 6750 - 6755.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Kowalczyk, P Navarro, E Dejana, E. Bornslaeger, K. Green, D. Kopp, and J. Borgwardt
VE-cadherin and desmoplakin are assembled into dermal microvascular endothelial intercellular junctions: a pivotal role for plakoglobin in the recruitment of desmoplakin to intercellular junctions
J. Cell Sci., January 10, 1998; 111(20): 3045 - 3057.
[Abstract] [PDF]


Home page
J. Cell Sci.Home page
S Esser, M. Lampugnani, M Corada, E Dejana, and W Risau
Vascular endothelial growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cells
J. Cell Sci., January 7, 1998; 111(13): 1853 - 1865.
[Abstract] [PDF]


Home page
JEMHome page
J. R. Allport, H. Ding, T. Collins, M. E. Gerritsen, and F. W. Luscinskas
Endothelial-dependent Mechanisms Regulate Leukocyte Transmigration: A Process Involving the Proteasome and Disruption of the Vascular Endothelial-Cadherin Complex at Endothelial Cell-to-Cell Junctions
J. Exp. Med., August 18, 1997; 186(4): 517 - 527.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Q. G. Dong, S. Bernasconi, S. Lostaglio, R. Wainstok De Calmanovici, I. Martin-Padura, F. Breviario, C. Garlanda, S. Ramponi, A. Mantovani, and A. Vecchi
A General Strategy for Isolation of Endothelial Cells From Murine Tissues : Characterization of Two Endothelial Cell Lines From the Murine Lung and Subcutaneous Sponge Implants
Arterioscler Thromb Vasc Biol, August 1, 1997; 17(8): 1599 - 1604.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
M. Lampugnani, M Corada, P Andriopoulou, S Esser, W Risau, and E Dejana
Cell confluence regulates tyrosine phosphorylation of adherens junction components in endothelial cells
J. Cell Sci., January 9, 1997; 110(17): 2065 - 2077.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
S. Corvera, C. DiBonaventura, and H. S. Shpetner
Cell Confluence-dependent Remodeling of Endothelial Membranes Mediated by Cholesterol
J. Biol. Chem., September 29, 2000; 275(40): 31414 - 31421.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Legrand, S. Bibert, M. Jaquinod, C. Ebel, E. Hewat, F. Vincent, C. Vanbelle, E. Concord, T. Vernet, and D. Gulino
Self-assembly of the Vascular Endothelial Cadherin Ectodomain in a Ca2+-dependent Hexameric Structure
J. Biol. Chem., January 26, 2001; 276(5): 3581 - 3588.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Bazzoni, O. M. Martinez-Estrada, F. Orsenigo, M. Cordenonsi, S. Citi, and E. Dejana
Interaction of Junctional Adhesion Molecule with the Tight Junction Components ZO-1, Cingulin, and Occludin
J. Biol. Chem., June 30, 2000; 275(27): 20520 - 20526.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Zanetti, M. G. Lampugnani, G. Balconi, F. Breviario, M. Corada, L. Lanfrancone, and E. Dejana
Vascular Endothelial Growth Factor Induces Shc Association With Vascular Endothelial Cadherin: A Potential Feedback Mechanism to Control Vascular Endothelial Growth Factor Receptor-2 Signaling
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 617 - 622.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Breviario, F.
Right arrow Articles by Dejana, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Breviario, F.
Right arrow Articles by Dejana, E.