Articles |
From the Istituto di Ricerche Farmacologiche Mario Negri, Milano, Italy (F.B., L.C., M.C., I.M.-P., P.N., J.G., M.I., M.G.L., E.D.), and CEA-CENG, Laboratoire d'Hématologie, DBMS, INSERM U217, Grenoble, France (D.G., E.D.).
Correspondence to E. Dejana, CEA-CENG, Laboratoire d'Hématologie, DBMS, INSERM U217, 17, rue des Martyrs, 38054 Grenoble, Cedex 9, France. E-mail elisabetta@bossons.ceng.cea.fr.
| Abstract |
|---|
|
|
|---|
-catenin.
VE-cadherin conferred adhesive properties to transfected cells. It
mediated homophilic, calcium-dependent aggregation and cell-to-cell
adhesion. In addition, it decreased intercellular permeability to
highmolecular weight molecules and reduced cell migration rate across
a wounded area. Thus, VE-cadherin may exert a relevant role in
endothelial cell biology through control of the
cohesion and organization of the intercellular junctions.
Key Words: cadherin endothelium transfection
| Introduction |
|---|
|
|
|---|
Many cell-adhesive molecules belonging to the integrin,5
immunoglobulin, or cadherin6 7 families have been
localized at intercellular junctions in epithelial cells. Cadherins are
calcium-dependent and protease-sensitive adhesive proteins that mediate
homotypic cell-to-cell adhesion.8 9 10 Structurally,
cadherins are single-chain transmembrane glycoproteins localized at
specialized structures such as adherence junctions in cardiac cells and
intermediate junctions in intestinal epithelia.11 12 The
intracellular domain of cadherins is linked to specific cytoplasmic
proteins named catenins. Three different catenins have been identified:
, ß, and
(or plakoglobin). Catenins are highly conserved along
the phylogenetic tree and amongst different cell
types.13 14 The most important biological role of
cadherins is to support homotypic cell aggregation and segregation,
which during embryogenesis promote the formation of defined tissues and
organs. Despite their similar biochemical properties, each cadherin is
characterized by a different spatiotemporal pattern of expression and
cell-binding specificity. In humans, E-cadherin, or uvomorulin, is
essentially found in epithelia and in subsets of neurons, N-cadherin is
expressed in the nervous system and in skeletal and cardiac muscles,
and P-cadherin exhibits a widespread distribution.9 Recent
studies identified many additional vertebrate and invertebrate
proteins15 16 17 that are included in the cadherin gene
family on the basis of their structural homologies. However, in most
cases their functions as adhesive molecules remain to be defined.
In a previous article we identified a monoclonal antibody, 7B4, that recognizes a protein present at the intercellular junctions of human ECs both in vitro and in vivo.18 From results of an analysis of a large series of normal and pathological tissues, this antigen appeared to be expressed only on the endothelium of all types of vessels. The amino terminal and some internal peptide sequences of the affinity-purified human 7B4 antigen18 were found to be identical to the cDNA-deduced amino acid sequence of a member of the cadherin family called cadherin-5.15 Further work indicated that the 7B4 antigen is localized at the intercellular junctions of the endothelium only when the cells come into contact with one another, and its distribution is modified after treatment of the cells with permeability-increasing agents.18 These results suggested that the 7B4 antigen is involved in endothelial cell-to-cell adhesion. However, direct data on the functional role of this molecule are not available.
In this report we describe the isolation, from human ECs, of the full-length cDNA of 7B4/cadherin-5 and the expression of its coding region in heterologous Chinese hamster ovary (CHO) cells after transfection. The analysis of different biological properties of transfectants indicates that 7B4 antigen has adhesive properties and controls a series of functions potentially relevant in EC biology. Given its selective expression in ECs, we propose for 7B4/cadherin-5 the name VE-cadherin (vascular endothelial cadherin).
| Methods |
|---|
|
|
|---|
-catenin (clone
18) was kindly donated by Dr A. Nagafuchi
(National Institute for Physiological Sciences,
Okazaki, Japan).
Recombinant fragments spanning the extracellular domains of either
VE-cadherin or the GpIIIa subunit were produced in Escherichia
coli cDNA fragments encoding partial VE-cadherin or GpIIIa
sequences were generated by polymerase chain reaction (PCR). For each
fragment, the primers were designed to create, at the 5' end, an
EcoRI site and, at the 3' end, an in-frame stop codon
followed by a HindIII restriction site. cDNA fragments
containing the sequences from nucleotide 166 to
nucleotide 1482 for VE-cadherin (Fig 1
) and
from nucleotide 658 to nucleotide 1200 for the
GpIIIa subunit21 were generated. The fragments were then
cloned into the expression vector pTG1924 containing the heat-inducible
promoter PL and sequenced to verify that no spontaneous
mutation had arisen during PCR reaction. The resulting pTG-derived
vectors expressed VE-cadherin (D48-K486) and GpIIIa (F214-L394).
Production and purification of these two recombinant proteins
were made as previously described.22
|
Cells
Human ECs from umbilical cord vein were isolated and cultured as
previously described.18 CHO cells were cultured in
Dulbecco modified Eagle's medium (DMEM) with 10% fetal calf serum
(FCS) (culture medium). CHO cells transfected with the full-length cDNA
of human N-cadherin23 were kindly provided by Dr B. Geiger
and Dr O. Ayalon, (Weizmann Institute) and CHO cells transfected with
ß1 integrin chain cDNA were a kind gift of Dr G. Tarone
(Universitá di Torino, Italy).24 Sterile plasticware
was from Falcon (Becton Dickinson); culture medium and serum were from
GIBCO.
RNA Extraction and Northern Blot Analysis
Total RNA was extracted and purified by use of the guanidinium
isothiocyanate/CsCl2 method as described,25
and 10 µg was run in a standard formaldehyde/agarose gel, blotted
onto nitrocellulose membrane (Schleicher and Schuell), and fixed at
80°C under vacuum for 2 hours. Hybridization and washing conditions
were as described.25
PCR Amplification
On the basis of the cDNA sequence previously
published15 we amplified, from human EC RNA, the coding
region of human cadherin-5 (from nucleotide 103 to
nucleotide 2442). This was done according to the protocol
of the GeneAMP RNA PCR kit (Perkin Elmer Cetus) with the
oligonucleotides pGCACGATCTGTTCCTCCTGGGAAG
(nucleotides 68 to 91) and pGCTGTGGTGCCTGGAGTCTGACTGGCCTGGG
(nucleotides 2490 to 2520). The PCR products were
subcloned into the pCRII plasmid by use of the TA cloning kit
(Invitrogen Corporation). A clone containing the human VE-cadherin
coding sequence was identified and sequenced by use of the
dideoxynucleotide chain termination method26
and was called pORFcad.
Library Screening, DNA Sequencing, and Computer
Analysis
A cDNA library from human ECs was screened as previously
described27 with the clone pORFcad used as a probe.
Plaques showing a strong positive hybridization signal were screened
three times to obtain a single clone. Phage inserts were rescued in the
pBluescript vector and sequenced as described above. The
nucleotide and deduced protein sequences were screened
against the EMBL and Swissprot DataBank by use of a FASTA
program28 as implemented on the EMBL net
computer resource.29 Detailed sequence analyses
were carried out with the PC/Gene sequence analysis package
(Intelligenetics Corp).
Constructs and Transfections
The pORFcad plasmid was cut with EcoRI and the
insert subcloned into the pECE eukaryotic expression
vector30 to give the pECEVE-cadherin construct. CHO
cells were plated at 3x106 to
4x106 cells per 100-mm Petri dish in DMEM with 10%
FCS. After 18 to 24 hours they were transfected by calcium phosphate
precipitation with 17 µg pECEVE-cadherin and 3 µg pSV2neo
plasmids. Cells were washed once 24 hours later with serum-free medium
and cultured for another 48 hours in DMEM with 10% FCS. They were then
detached, plated at 1x106 per 100-mm Petri dish,
and cultured in the presence of 1 mg/mL G-418 (Geneticin, GIBCO). After
about 10 days in selective medium, the surviving colonies were ring
cloned. G-418resistant clones were screened for VE-cadherin
expression by indirect immunofluorescence microscopy. The cells
treated in this manner (VE-transfectants) were expanded in the presence
of G-418 (800 µg/mL) before being frozen for stock storage. Upon
being thawed, the cells were cultured in the absence of G-418.
VE-cadherin expression was stable for at least 20 in vitro passages
(splitting ratio, 1:15 to 1:20).
The VE-transfectants were regularly checked for Mycoplasma contamination. Control cells, CHOs transfected with the empty pECE and pSV2neo plasmids, were selected, cloned, and cultured in the same way.
Western Blot
Cells grown to tight confluency were washed twice with
Ca2+- and Mg2+-PBS and twice with
serum-free DMEM. Cells were extracted with 1% Nonidet P40, 0.5% SDS
in Tris-buffered saline (10 mmol/L Tris HCl and 150 mmol/L NaCl, pH
7.5), 1 mmol/L PMSF, and 20 U/mL aprotinin for 20 minutes on ice. Cell
extracts were passed through a 21-gauge needle to shear DNA and
centrifuged at 13 000 rpm for 5 minutes at 4°C. The
supernatants corresponding to 3x105 cells were separated
by SDS-electrophoresis on a 7.5% SDS-polyacrylamide gel under
reducing conditions. The gel was then incubated for 30 minutes (2x 15
minutes) in transfer buffer (50 mmol/L Tris HCl, 95 mmol/L glycine, and
1 mmol/L CaCl2). Proteins were electrotransferred onto
nitrocellulose (Bio-Rad Laboratories), which was blocked with 10%
low-fat milk (Magist, Gespal) in Ca2+- and
Mg2+-PBS (blocking buffer) and incubated overnight
with the appropriate antibody (TEA 1.31, BV6, or BV9 hybridoma culture
supernatant, diluted 1:2 in blocking buffer). This was sequentially
followed by 60 minutes of incubation with rabbit anti-mouse IgG (20
µg/mL, Dako) and 90 minutes of incubation with
125I-labeled protein A (about 105 cpm/mL;
Amersham International). Between the various steps the
nitrocellulose was washed several times with blocking buffer
containing 0.1% Tween 20. The immunoreactive bands were revealed by
autoradiography. In some experiments cell extracts,
obtained as above but in the absence of SDS, were immunoprecipitated
with antibodies to VE-cadherin as described18 before being
immunoblotted with antibodies to
-catenin.
Immunofluorescence Microscopy
CHO cells were cultured on glass coverslips (13 mm in diameter)
set in a well of a 24-well plate. For EC culturing (either pure culture
or coculture with VE-transfectants), glass coverslips were coated with
human plasma fibronectin (7 µg/mL). Cells were fixed with 3%
paraformaldehyde, permeabilized with
0.5% TX-100, and processed for indirect immunofluorescence
microscopy.18 Incubation with the primary antibody was
followed by incubation with rhodamine-conjugated secondary antibody
(Dakopatts) in the presence of fluorescein-labeled
phalloidin (Sigma Chemical Co) with several washes in 0.1% BSA-TBS
between the various steps. Coverslips were then mounted in Mowiol 4-88
(Calbiochem). A Zeiss Axiophot microscope was used for observation and
image recording on Kodak TMax P3200 films.
Cell Aggregation
VE-cadherin is particularly sensitive to trypsin even in the
presence of calcium18 ; therefore, preliminary experiments
were performed to establish the detaching protocol that maximally
preserved VE-cadherin antigen on the cell surface while maintaining
virtually 100% cell viability. In particular, the cell layer was
washed several times with Ca2+- and
Mg2+-PBS and further incubated in the same buffer
for 15 minutes at 37°C. Trypsin (0.01%; from bovine pancreas, type
III, Sigma Chemical Co) in Hank's balanced salt solution with 25
mmol/L HEPES (HHBSS), 10 mmol/L CaCl2, and 5 mmol/L
MgCl2 was then added and maintained on the cells for the
shortest interval after which initial intercellular retraction appeared
(usually 5 to 7 minutes; the progression of trypsin effect was
carefully monitored under the microscope). Cells were completely and
rapidly detached by vigorous shaking of the flasks. Trypsin action was
stopped by addition of DMEM with 10% FCS and 0.1% soybean trypsin
inhibitor (Sigma Chemical Co). Cells were then
centrifuged and resuspended in HHBSS without
Ca2+ and Mg2+ to obtain a single
cell suspension. Cells were further centrifuged and resuspended
in 1% BSA in Ca2+- and Mg2+-free
HHBSS at a concentration of 4x105/mL. Cell
suspension (0.5 mL/well) was seeded in a 24-well plate previously
coated with 1% BSA to prevent cell adhesion.31
CaCl2 (2 mmol/L) was added to start calcium-dependent
aggregation. Controls without calcium addition were always run in
parallel. Incubation was for 90 minutes at 37°C on a rotating
platform (80 rpm). The reaction was stopped with 5%
glutaraldehyde (electron microscopy grade, Sigma
Chemical Co; 0.5 mL/well).
The initial number of particles (Nt0) and the number of particles at 90 minutes (Nt90) were counted with a ZM Coulter Counter (window set at 6 to 100 µm). Aggregation was estimated by use of the formula (Nt0-Nt90)/(Nt0)x100 as described.8
To evaluate the formation of homophilic/heterophilic aggregates, either control or VE-transfectants in suspension (8x105/mL) were labeled with 2 µmol/L BCECF acetoxymethylester; Molecular Probes for 10 minutes at 37°C. Cells were then washed twice with 1% BSA-HHBSS and resuspended at 8x105/mL in 1% BSA-HHBSS. Labeled cells (0.25 mL) were mixed with 0.25 mL unlabeled VE-transfectants (8x105/mL) in a well of a 24-well plate. Aggregation was as described above in the presence of 2 mmol/L CaCl2. Aggregates were observed by both phase-contrast and fluorescence microscopy. The number of labeled and unlabeled cells in each aggregate was recorded and quantitative analysis of the aggregate composition was as described.32
Cell Adhesion
The adherent cell layer was obtained by culturing both CHO cells
and ECs (3x103/well at seeding) in 96-well plates
for 4 to 5 days to confluency. Cells to be used in suspension were
labeled overnight with [125I]iododeoxyuridine (1
µCi/mL, Amersham). Detachment was as described above to preserve
VE-cadherin on the cell surface. Labeled cell suspensions
(3x104 cells in 100 µL DMEM with 10% FCS for each well)
were added on the top of adherent cells (from which culture medium had
been removed with no rinsing).33 Incubation was for 30
minutes at 37°C. Nonadherent cells were removed by three washes with
Ca2+- and Mg2+-PBS containing
10% FCS. The well content was then solubilized with 1 mol/L NaOH/0.1%
SDS (50 µL) and counted for radioactivity.33
Permeability Assay
Cells (1.5x104 at seeding) were cultured for 5 days
in Transwell units (with polycarbonate filters, 0.4-µm pores;
Costar). Culture medium was replaced, without washing, with serum-free
medium (0.1 mL upper chamber and 0.6 mL lower chamber). Horseradish
peroxidase (HRP) (0.126 µmol/L initial concentration in the upper
chamber, type VI-A, 44 kD, specific activity 250 U/mg; Sigma Chemical
Co) or HRP conjugated to goat immunoglobulin (HRPIg) (8 µg/mL initial
concentration in the upper chamber, 200 kD minimum [calculated],
specific activity 28 U/mg; Sigma Chemical Co) was added to the upper
compartment. After 2 hours of incubation at 37°C, the medium in the
lower compartment was assayed photometrically for the presence of HRP
activity either with guajacol as a substrate18 when HRP
was used or with o-phenylenediamine dihydrochloride as a
substrate when HRPIg was used, according to the manufacturer's
instructions (Sigma Chemical Co).
Cell Migration
Cells were cultured for 5 days in 24-well plates to result in a
tight cell layer. The culture medium was aspirated and the cell layer
was wounded by use of a plastic tip. Four diameters, regularly
distanced by about 45°, were removed. The remaining cells were washed
twice with culture medium to remove cell debris and incubated at 37°C
in culture medium. At the indicated time intervals, cells were fixed
with Fast Green FCF (0.02% in methanol) and stained with crystal
violet (0.5% in methanol/water 20:80). The front of migrating cells
was very distinguishable because it presented a light staining
in comparison to the heavy staining of the cell layer at the original
front edge. The distance migrated by the cells was measured by use of a
micrograduated scale (Nikon) adapted in the ocular of a Nikon inverted
microscope under phase contrasts (magnification x100). Twelve values,
obtained in three parallel wells, were recorded for each cell type
at each time interval.
| Results |
|---|
|
|
|---|
|
As shown in Fig 1
, the 4000-bp sequence contains 24 bp of putative 5'
untranslated region, an open reading frame of 2352 bp that encodes for
a polypeptide 784 amino acids long, and a 1621-bp 3' untranslated
region. Comparison of the VE-cadherin cDNA sequence with the published
cadherin-5 cDNA sequence15 reveals several differences:
(1) VE-cadherin cDNA is 67 nucleotides shorter than the
previously published cDNA at its 5' end. (2) Three changes at the
nucleotide level are observed: two, at positions 408 and
1032 of VE-cadherin, do not modify the coded amino acids, and the
third, at position 1574, changes isoleucine, the amino acid at position
513 in the cadherin-5 protein sequence, into threonine. (3) We report a
3' untranslated sequence about 900 nucleotides longer than
the published cDNA, containing the polyadenylation signal and the
poly(A) tail. (4) The presence at position 36 of a
nucleotide, not previously described,15
introduces a frame elongation in VE-cadherin. A new putative first
methionine four amino acids upstream of that previously described could
be used to initiate translation. The new putative first ATG, as well as
the other ATG described,15 conforms to the Kozak consensus
sequences for initiation of translation.34 It has been
noted that the newly observed ATG is the only one conserved in the
murine VE-cadherin cDNA (F.B., unpublished data, 1995). The
characteristics of the VE-cadherin cDNA described above have been
confirmed in two independent PCR amplifications and in three
independently isolated cDNA clones.
Expression of VE-Cadherin in CHO Cells
To gain information on VE-cadherin biological activity and to
confirm the validity of our cDNA sequence, we transfected CHO cells
with a pECEVE-cadherin plasmid that contained a fragment from
nucleotide 1 to nucleotide 2454 of the reported
VE-cadherin cDNA (Fig 1
). pSV2neo plasmid, for neomycin resistance, was
cotransfected for selection. Successful transfection and selective
procedures were validated by Western and Northern blot analyses
of VE-transfectant clones (Fig 2A
and 2B
, respectively). As indicated
in Fig 2B
, a band of RNA approximately 2500 bp in size was evident in
the VE-transfectants and absent in control cells (CHO cells transfected
with the neomycin-resistance gene only). The size of mRNA observed was
consistent with the introduced cDNA (about 2500
nucleotides long). By comparison, the
endogenous endothelial mRNA is about 4100
bp long (Fig 2B
).
CHO cells did not normally express any cadherin, as indicated by the
absence of reactivity to a pan-cadherin antibody directed against the
conserved cytoplasmic domain of all known cadherins,20
including VE-cadherin,18 both in
immunofluorescence microscopy and in Western blot
analysis (data not shown). Control cells did not show
reactivity to VE-cadherin mAbs in Western blot analysis (Fig 2A
for the typical clone 1
; comparable results have been obtained with
the other control clones 2ß and 3
).
As shown in Fig 2A
, some typical VE-cadherin positive clones (9c, 5a,
3g) presented upon Western blot analysis a band of 135
kD (apparent) comigrating with the immunoreactive band observed in
human umbilical vein ECs. Occasionally a smaller band of about 120 kD
could be detected in VE-transfectants and in ECs (Fig 2A
, clones 9c and
5a, and data not shown). This band probably corresponds to a
degradation product of the molecule.
The antibodies (TEA 1.31, BV6, and BV9) also immunoprecipitated
from [35S]methioninemetabolically labeled
VE-transfectants a protein of molecular weight identical to that of
endothelial VE-cadherin (data not shown). Our VE-cadherintransfected
clones showed comparable levels of mRNA and protein with respect to the
endogenous endothelial gene (Fig 2B
and 2A
). In addition, when adherent monolayers were observed, both
VE-transfectants (Fig 3d
) and ECs (Fig 3f
) appeared to
be 100% positive. Moreover, a comparable amount of VE-cadherin could
be immunoprecipitated from 125Isurface-labeled
VE-transfectants and ECs (data not shown). These data strongly suggest
that our cDNA clone is able to direct normal expression and
posttranslational processing of VE-cadherin gene in CHO cells.
|
Transfected VE-Cadherin Localizes at Intercellular Junctions and
Codistributes With
-Catenin
VE-cadherin staining with specific mAbs (clones TEA 1.31, BV6, and
BV9) showed selective localization of the antigen at cell-to-cell
junctions (Fig 3d
) with a pattern very similar to that observed in ECs
(Fig 3f
). VE-cadherin staining was absent in control cells (Fig 3e
).
The pan-cadherin antibody immunostained cell-to-cell
contacts of VE-transfectants (data not shown), further indicating that
the cytoplasmic tail of the molecule was correctly expressed. In
addition, to analyze the association of human VE-cadherin with
cytoplasmic regulatory proteins, as for other cadherins,10
we studied the distribution of
-catenin both in VE-transfectants and
ECs. As reported in Fig 3g
and 3i
,
-catenin was found to be
localized at cell-to-cell junctions in both cell types. Control cells
did not show any significant staining with
-catenin antibody (Fig 3h
). Moreover,
-catenin coimmunoprecipitated with VE-cadherin both
in VE-cadherin transfectants and in ECs (Fig 4
).
|
Control cells presented a low level of
-catenin in the total
cell extract (Fig 4
). It remains to be established whether VE-cadherin
induces transcription of
-catenin mRNA or stabilizes the protein, as
reported.35 Overall, these data suggest that transfected
VE-cadherin had a normal association with cytoplasmic modulators and
indicate that it was able to interact with both hamster and human
-catenin.
The junctional localization of VE-cadherin required cell homotypic
interaction. When a cluster of VE-transfectants came into contact with
control cells (in coculture assay), no junctional localization of the
molecule was observed (Fig 5a
). However, this typical
localization was present when the same VE-transfectants were in
contact with other VE-transfectants (Fig 5a
). After coculture of
VE-transfectants with EC (Fig 5b
), VE-cadherin was localized at
junctions between the two cell types, indicating that the ectopically
expressed protein was able to interact with its natural putative
counterreceptor in ECs.
|
VE-Cadherin Mediates Adhesion Between Transfected
Cells
To evaluate whether VE-cadherin is competent in mediating adhesive
interactions, we examined VE-transfectants for their ability to
aggregate from a single cell suspension. VE-transfectants formed small
aggregates in the presence of calcium, whereas control cells remained
mostly single. In the presence of calcium,
VE-transfectants aggregated three to four times more effectively than
control transfectants (Fig 6
). To test the specificity of the
aggregation, we added a soluble recombinant fragment of VE-cadherin
corresponding to the amino terminal domain of the molecule (see
"Methods") to the cells before the aggregation assay. As shown in
Fig 6
, the soluble fragment was able to inhibit CHO cell aggregation. A
control fragment corresponding to part of the GpIIIa sequence was
ineffective. Unfortunately, none of the three mAbs used in this study
(TEA 1.31, BV9, and BV6) was able to affect aggregation at levels of
IgG up to 100 µg/mL.
|
We then investigated whether VE-cadherin binding was homophilic.
Aggregation assays were performed after mixing of control and
VE-cadherintransfected cells. To distinguish between the two cell
types, control cells were vitally labeled with the fluorescent
dye BCECFAM. Aggregates were examined by fluorescence
microscopy. A homophilic adhesion mechanism would produce mostly
aggregates of unlabeled VE-transfectants, whereas a heterophilic
adhesion mechanism would produce mixed aggregates of unlabeled
VE-transfectants and labeled control cells. The results of such
experiments, reported in Fig 7B
, showed that aggregation
was essentially homophilic; ie, only VE-cadherinexpressing cells were
present in the aggregates whereas control cells remained mostly
single. Only occasionally were a few control cells observed attached at
the periphery of the aggregates. Mixing BCECFAM-labeled and -unlabeled
VE-transfectants produced mixed aggregates with the frequency of
distribution expected for homophilic aggregation (Fig 7A
; see Reference
3232 ). Finally, to further confirm the adhesive property of VE-cadherin
in a different system, we incubated monolayers of control cells,
VE-transfectants, N-cadherin transfectants, and ECs with radiolabeled
suspensions of control cells, VE-transfectants, or N-cadherin
transfectants. As shown in Fig 8
, VE-transfectants
adhered more efficiently to VE-transfectant and EC monolayers than to
control and N-cadherin cell monolayers. Conversely, control cells
adhered poorly to any cell type tested. N-cadherin transfectants
recognized N-cadherin transfectants more efficiently than heterologous
cell monolayers. These data show that VE-cadherin in cell monolayers is
available for binding to cells in suspension and support the idea that
VE-cadherin retains adhesive properties and promotes homotypic cell
interaction. We suggest that VE-cadherin molecules are also present
at the apical surfaces of both VE-transfectant and EC monolayers to
sustain the adhesive interaction observed. A similar mechanism would
explain the homophilic adhesion of N-cadherin transfectants.
|
|
VE-Cadherin Decreases the Passage of HighMolecular Weight
Molecules Through the Cell Monolayer
To evaluate whether VE-cadherin expression could increase the
cohesion of cell-to-cell contacts, we used an in vitro assay to
quantify the passage of highmolecular weight molecules through the
cell monolayer. VE-transfectants and control cells were cultured on
Transwell filters and the passage of HRP conjugated to HRPIg
through the cell monolayers was quantified. In preliminary experiments
conditions to ensure a comparable number of cells on the filters and a
similar degree of confluency were established. Cells on the filters
essentially appeared in monolayers when fixed and stained with crystal
violet and examined by phase-contrast microscopy.
As shown in Fig 9
, permeation of HRPIg through
VE-transfectant monolayers was significantly reduced in comparison to
control cell monolayers. This difference was lost when 5 mmol/L EGTA
was added to the culture medium to reduce calcium concentration during
the assay. In preliminary experiments this condition did not cause a
significant cell retraction or detachment from the substratum. In Fig 9
are reported the data obtained in a typical experiment; a
consistent and statistically significant decrease in
permeability of 40% to 50% was always observed in six additional
experiments in which four separate VE-cadherin transfectant clones were
used. Comparable results were obtained when a smaller molecule,
unconjugated HRP, was used as a permeation marker (data not shown).
|
VE-Cadherin Transfection Reduces the Migration Rate of the
Cells
As a further indication of the strength of intercellular contacts
in VE-transfectants, we analyzed the capacity of the cells to
migrate into a "wounded" area produced in the cultured monolayer.
Monolayers were scratched to form a uniform cell-free lesion of
determined size. At different times after the lesion, the distance
covered by the migrating front was measured. As shown in Fig 10A
, VE-transfectants had a lower migration rate and
showed a tighter cell front compared with the control cells. Fig 10B
shows the time course of the migration of control and
VE-transfectants. For up to 20 hours, VE-transfectants covered a
distance significantly shorter than controls. The observed changes in
cell migration were not due to differences in the proliferative rates
of the various clones because within the time course of the experiment
(20 hours) the number of VE-transfectants was not significantly
different from control cells (data not shown).
|
| Discussion |
|---|
|
|
|---|
In this study we expressed human VE-cadherin in heterologous cells and directly evaluated its biological properties. For transfection, the full-length cDNA of human VE-cadherin was cloned and sequenced. Sequence analysis revealed few differences with respect to the previously reported sequence of cadherin-5.15 Most importantly, the sequence was completed by addition of a 3' nucleotide tail containing the polyadenylation signal and the poly(A) tail (lacking in the previously described cadherin-5 cDNA), and a novel putative ATG initiation codon was identified.
We found that VE-transfectants acquired homotypic cell-to-cell adhesive properties. In the classical test of single-cell aggregation in the presence of calcium8 the aggregates formed were relatively small (the majority were composed of 5 to 10 cells). A soluble fragment corresponding to the amino terminal domain of the molecule was able to inhibit cell aggregation, demonstrating the specificity of the effect. The three mAbs used in this study (TEA 1.31, BV9, and BV6) did not inhibit aggregation. The easiest explanation for this is that they recognize a molecular domain of VE-cadherin that is not relevant for the adhesive properties of the molecule. Alternatively, VE-cadherin homotypic binding might be due to the multiple interactions of different molecular epitopes. In this case different binding sites need to be blocked at the same time. One mAb or even the cocktail of the three might not be sufficient for this purpose.
The adhesive properties of VE-cadherin could be also demonstrated
when single cell suspensions of VE-transfectants were added to a
monolayer of homotypic VE-transfectants (see Fig 8
). In these
conditions VE-cadherin transfectants adhered more effectively to
homotypic than to N-cadherin or control transfectants. This observation
further supports the idea that VE-cadherin promotes a homotypic type of
recognition. These experiments also suggest that VE-cadherin
localization is not exclusively at junctions but that VE-cadherin could
be found on the apical surface of the transfectants promoting adhesion
of cells in suspension.
VE-cadherin presumably exerts its physiological
role in cells attached to the extracellular matrix. In adherent cells
the complete organization of adhesive molecules, as well as related
cytoplasmic and cytoskeletal proteins at junctions, is required for
sustaining a stable intercellular adhesion.36 37 In
contrast, cell aggregation is a short-term effect that needs to
counteract dynamic disrupting forces and during which a proper
organization of intercellular junctions cannot occur. It was therefore
of importance to investigate, in substrate-adherent cells, whether
VE-cadherin transfection could change the organization and biological
activity of cell junctions. As in ECs, in confluent VE-transfectants
the molecule was localized at the intercellular contacts in a homotypic
way. The cytoplasmic domain of cadherins mediates binding to the
cytoskeleton and is required for normal functioning of these adhesive
molecules.13 In this article we showed by
immunofluorescence microscopy that
-catenin, one of the
specific cytoplasmic proteins connecting cadherins to the
cytoskeleton,13 14 codistributed with VE-cadherin in both
ECs and VE-transfectants. In addition,
-catenin coimmunoprecipitated
with VE-cadherin in both ECs and VE-transfectants, indicating a
physical linkage between the two molecules. These data indirectly
indicate that the ectopically expressed VE-cadherin was regularly
associated with catenins, as happens in ECs, and suggest that the
intercellular junctions of VE-transfectants were properly
organized.
To evaluate whether VE-cadherin expression could increase cohesion of intercellular junctions in adherent cells, we measured the permeation of highmolecular weight proteins through VE-transfectant monolayers. VE-transfectants showed a significant decrease in permeability compared with control cells, and this effect was abolished in conditions of low calcium concentration. These data suggest that VE-cadherin could contribute to the regulation of junctional permeability. This is of particular relevance for the endothelium, which acts as a permselective barrier between plasma and tissues.4 Of course, much caution is necessary for extrapolation from an in vitro assay with an experimental cell line to the in vivo behavior of the physiologically regulated endothelium. We have previously shown that agents able to increase EC permeability in vitro and in vivo induced a disruption of VE-cadherin organization at intercellular junctions.18 This was an indirect proof that this molecule could play a relevant role in the regulation of cell permeability. The data reported here provide a more direct support for this hypothesis.
EC migration is another important process necessary in embryonic development, repair of vascular injury, and angiogenesis.38 The appropriate movements of individual cells are guided by their interaction with the extracellular matrix and with neighboring cells. To build up new vascular structures, ECs need to disrupt intercellular junctions, detach from the cell monolayers, and invade the underlying tissues. We show here that VE-cadherin transfection decreases the rate of cell migration. The mechanism by which VE-cadherin exerts this effect is not known. The easiest explanation is that by enhancing cell-to-cell adhesion it physically tethers adjacent cells together and prevents cell-from-cell separation required for sheet migration. Immunofluorescence microscopy showed that, during EC migration into a wounded area, VE-cadherin becomes disorganized from cell-to-cell borders (M.G.L., unpublished data, 1995). Overall, these data suggest that VE-cadherin redistribution and inactivation favor EC detachment and migration.
Transfection of E-cadherin into mouse L cells inhibits their capacity to migrate.39 In general, the loss of cadherins and, in particular, of E-cadherin increases the invasiveness of tumor cells.17 Similar functional properties of cadherins might have different biological consequences specific for the cell type in which the cadherin is expressed. In ECs, inhibition of cell migration would be related to inhibition of new vessel formation or repair of a vascular injury, whereas in tumor cells it would be related to a less invasive and metastatic phenotype.17
While this article was in preparation Tanihara et al40 reported that cell transfection of VE-cadherin/cadherin-5 did not cause cell aggregation. An easy explanation for the discrepancy between our results and theirs is that VE-cadherin is particularly sensitive to trypsin digestion,18 and because Tanihara et al detached the cells with trypsin and EDTA most of the molecule was lost on the cell surface. ECs express two other cadherins, N- and P-cadherin,23 41 which are not specific for ECs.9 10 In addition, Heimark et al42 described the presence of an endothelial cadherin-like molecule in bovine endothelium. They reported downregulation of the activity and level of this protein in response to the mitogenic effects of acidic and basic fibroblast growth factors.43
Other noncadherin molecules, such as integrins44 and platelet endothelial cell adhesion molecule (PECAM),45 46 have been found to be localized at intercellular junctions in the endothelium. PECAM plays a role in leukocyte extravasation47 and EC wound repair.48 49 The reciprocal role of these molecules in regulating junction organization and biological activity in the endothelium remains to be clarified.
| Acknowledgments |
|---|
Received December 12, 1994; accepted April 12, 1995.
| References |
|---|
|
|
|---|
2.
Rippe B, Haraldsson B. Transport of
macromolecules across microvascular walls: the two-pore theory.
Physiol Rev.. 1994;74:163-219.
3. Franke WW, Cowin P, Grund C, Kuhn C, Kapprell HP. The endothelial junction: the plaque and its components. In: Simionescu N, Simionescu M, eds. Endothelial Cell Biology in Health and Disease. New York, NY: Plenum Publishing Corp; 1988:147-166.
4. Simionescu N, Simionescu M. Endothelial transport macromolecules: transcytosis and endocytosis. Cell Biol Rev.. 1991;25:5-80. [Medline] [Order article via Infotrieve]
5.
Carter WG, Wayner EA, Bouchard TS, Kaur P. The
role of integrins
2ß1 and
3ß1 in cell-cell and cell-substrate
adhesion of human epidermal cells. J Cell
Biol.. 1990;110:1387-1404.
6. Geiger B, Ayalon O. Cadherins. Annu Rev Cell Biol.. 1992;8:307-332.
7. Kemler R. Classical cadherins. Semin Cell Biol.. 1992;3:149-155. [Medline] [Order article via Infotrieve]
8. Nose A, Nagafuchi A, Takeichi M. Expressed recombinant cadherins mediate cell sorting in model system. Cell.. 1988;54:993-1001. [Medline] [Order article via Infotrieve]
9. Takeichi M. Cadherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biochem.. 1990;59:237-252. [Medline] [Order article via Infotrieve]
10. Grunwald GB. The structural and functional analysis of cadherin calcium-dependent cell adhesion molecules. Curr Opin Cell Biol.. 1993;5:797-805. [Medline] [Order article via Infotrieve]
11.
Boller K, Vestweber D, Kemler R. Cell-adhesion
molecule uvomorulin is localized in the intermediate junctions of adult
intestinal epithelial cells. J Cell Biol.. 1985;100:327-332.
12.
Takeichi M. Cadherin cell adhesion receptors as
a morphogenic regulator. Science.. 1991;251:1451-1455.
13. Nagafuchi A, Takeichi M. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO J.. 1988;7:3679-3684. [Medline] [Order article via Infotrieve]
14. Ozawa M, Baribault H, Kemler R. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J.. 1989;8:1711-1717. [Medline] [Order article via Infotrieve]
15. Suzuki S, Sano K, Tanihara H. Diversity of the cadherin family: evidence for eight new cadherins in nervous tissue. Cell Regul.. 1991;2:261-270. [Medline] [Order article via Infotrieve]
16. Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system. EMBO J.. 1993;12:2249-2256. [Medline] [Order article via Infotrieve]
17. Takeichi M. Cadherins in cancer: implications for invasion and metastasis. Curr Opin Cell Biol.. 1993;5:806-811. [Medline] [Order article via Infotrieve]
18.
Lampugnani MG, Resnati M, Raiteri M, Pigott R, Pisacane
A, Houen G, Ruco LP, Dejana E. A novel
endothelial-specific membrane protein as a marker of
cell-cell contacts. J Cell Biol.. 1992;118:1511-1522.
19. Leach L, Clark P, Lampugnani MG, Arroyo AG, Dejana E, Firth JA. Immunoelectron characterization of the inter-endothelial junctions of human term placenta. J Cell Sci.. 1993;104:1073-1081. [Abstract]
20.
Geiger B, Volberg T, Ginsberg D, Bitzur S, Sabanay I,
Hines RO. Broad spectrum pan-cadherin antibodies, reactive with
the C-terminal 24 amino acid residues of N-cadherin.
J Cell Sci.. 1990;97:607-614.
21. Frachet P, Uzan G, Thevenon D, Denarier E, Prandini MH, Marguerie G. GPIIb and GPIIIa amino acid sequences deduced from human megakaryocytes cDNAs. Mol Biol Rep.. 1990;14:27-33. [Medline] [Order article via Infotrieve]
22.
Gulino D, Boudignon C, Zhang L, Concord E, Rabiet MJ,
Marguerie G. Ca2+-binding properties of the
platelet glycoprotein IIb ligand-interacting
domain. J Biol Chem.. 1992;267:1001-1007.
23.
Salomon D, Ayalon O, Patel-King R, Hynes RO, Geiger B.
Extrajunctional distribution of N-cadherin in cultured human
endothelial cells. J Cell
Sci.. 1992;102:7-17.
24.
Balzac F, Belkin AM, Koteliansky VE, Bolanov YV,
Altruda F, Silengo L, Tarone G. Expression and functional
analysis of a cytoplasmic variant of the ß1 integrin
subunit. J Cell Biol.. 1993;121:171-178.
25.
Golay J, Capucci A, Arsura M, Castellano M, Rizzo V,
Introna M. Expression of c-myb and B-myb, but not A-myb,
correlates with proliferation in human hematopoietic cells.
Blood.. 1991;77:149-158.
26.
Tabor S. Richardson CC. DNA sequence
analysis with a modified bacteriophage T7 DNA
polymerase. Proc Natl Acad Sci U S A.. 1987;84:4767-4771.
27.
Breviario F, d'Aniello EM, Golay J, Peri G, Bottazzi
B, Bairoch A, Saccone S, Marzella R, Predazzi V, Rocchi M, Della Valle
G, Dejana E, Mantovani A, Introna M. Interleukin-1-inducible
genes in endothelial cells: cloning of a new gene
related to C-reactive protein and serum amyloid P component.
J Biol Chem.. 1992;267:22190-22197.
28.
Pearson WR, Lipman DJ. Improved tools for
biological sequence comparison. Proc Natl Acad Sci
U S A.. 1988;85:2444-2448.
29. Stoehr PJ, Omond R. In: Collins J, Driesel AJ eds. Genome Analysis: From Sequence to Functions. Heidelberg, Germany: Huetlrig Buch Verlag; 1991;177.
30. Ellis L, Clauser E, Morgan DO, Edery M, Roth RA, Rutter WJ. Replacement of insulin receptor tyrosine residues 1162 and 1163 compromises insulin-stimulated kinase activity and uptake of 2-deoxyglucose. Cell.. 1986;45:721-732. [Medline] [Order article via Infotrieve]
31.
Takeichi M. Functional correlation between
cell adhesive properties and some cell surface proteins.
J Cell Biol.. 1977;75:464-474.
32.
Sieber F, Roseman S. Quantitative
analysis of intercellular adhesive specificity in freshly
explanted and cultured cells. J Cell Biol.. 1981;90:55-62.
33. Lauri D, Martin-Padura I, Biondelli T, Rossi G, Bernasconi S, Giavazzi R, Passerini F, Van Hinsbergh V, Dejana E. Role of ß1 integrins in tumor cell adhesion to cultured human endothelial cells. Lab Invest.. 1991;65:525-531. [Medline] [Order article via Infotrieve]
34.
Kozak M. The scanning model for translation: an
update. J Cell Biol.. 1989;108:229-241.
35. Nagafuchi A, Takeichi M, Tsukita S. The 102 kd cadherin-associated protein: similarity to vinculin and posttranscriptional regulation of expression. Cell.. 1991;65:849-857. [Medline] [Order article via Infotrieve]
36.
McNeill H, Ryan TA, Smith SJ, Nelson WJ.
Spatial and temporal direction of immediate and early events
following cadherin-mediated epithelial cell adhesion.
J Cell Biol.. 1993;120:1217-1226.
37. Tsukita S, Tsukita S, Nagafuchi A, Yonemura S. Molecular linkage between cadherins and actin filaments in cell-cell adherent junctions. Curr Opin Cell Biol.. 1992;4:834-839. [Medline] [Order article via Infotrieve]
38.
Folkman J, Shing Y. Angiogenesis.
J Biol Chem.. 1992;267:10931-10934.
39.
Chen WC, Obrink B. Cell-cell contacts mediated
by E-cadherin (uvomorulin) restrict invasive behavior of
L-cells. J Cell Biol.. 1991;114:319-327.
40. Tanihara H, Kido M, Obata S, Heimark RL, Davidson M, St John T, Suzuki S. Characterization of cadherin-4 and cadherin-5 reveals new aspects of cadherins. J Cell Sci.. 1994;107:1697-1704. [Abstract]
41. Liaw CW, Cannon C, Power MD, Kiboneka PK, Rubin LL. Identification and cloning of two species of cadherins in bovine endothelial cells. EMBO J.. 1990;9:2701-2708. [Medline] [Order article via Infotrieve]
42.
Heimark RL, Degner M, Schwartz SM.
Identification of a Ca2+-dependent cell-cell
adhesion molecule in endothelial cells.
J Cell Biol.. 1990;110:1745-1756.
43. Bavisotto LM, Schwartz SM, Heimark R. Modulation of Ca2+-dependent intercellular adhesion in bovine aortic and human umbilical vein endothelial cells by heparin-binding growth factors. J Cell Physiol.. 1990;143:39-51. [Medline] [Order article via Infotrieve]
44.
Lampugnani MG, Resnati M, Dejana E, Marchisio PC.
The role of integrins in the maintenance of
endothelial monolayer integrity. J
Cell Biol.. 1991;112:479-490.
45.
Muller WA, Ratti CM, McDonnell SL, Cohn ZA.
A human endothelial cell-restricted, externally
disposed plasmalemmal protein enriched in intercellular
junctions. J Exp Med.. 1989;170:399-414.
46.
Albelda SM, Oliver PD, Romer LH, Buck CA.
EndoCAM: a novel endothelial cell-cell adhesion
molecule. J Cell Biol.. 1990;110:1227-1237.
47.
Muller WA, Weigl SA, Deng X, Phillips DM.
PECAM-1 is required for transendothelial
migration of leukocytes. J Exp Med.. 1993;178:449-460.
48. Schimmenti LA, Yan HC, Madri JA, Albelda SM. Platelet endothelial cell adhesion molecule, PECAM-1, modulates cell migration. J Cell Physiol.. 1992;153:417-428. [Medline] [Order article via Infotrieve]
49.
Vaporcyan AA, DeLisser HM, Yan HC, Mendiguren II, Thorm
SR, Jones ML, Ward PA, Albelda SM. Involvement of
platelet-endothelial cell adhesion molecule-1 in
neutrophil recruitment in vivo. Science.. 1993;262:1580-1582.
This article has been cited by other articles:
![]() |
Yang Gu, D. F. Lewis, J. S. Alexander, and Yuping Wang Placenta-derived Chymotrypsin-like Protease (CLP) Disturbs Endothelial Junctional Structure in Preeclampsia Reproductive Sciences, May 1, 2009; 16(5): 479 - 488. [Abstract] [PDF] |
||||
![]() |
N. Bardin, M. Blot-Chabaud, N. Despoix, A. Kebir, K. Harhouri, J.-P. Arsanto, L. Espinosa, P. Perrin, S. Robert, F. Vely, et al. CD146 and its Soluble Form Regulate Monocyte Transendothelial Migration Arterioscler. Thromb. Vasc. Biol., May 1, 2009; 29(5): 746 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Funa, V. Kriz, G. Zang, G. Calounova, B. Akerblom, J. Mares, E. Larsson, Y. Sun, C. Betsholtz, and M. Welsh Dysfunctional Microvasculature as a Consequence of Shb Gene Inactivation Causes Impaired Tumor Growth Cancer Res., March 1, 2009; 69(5): 2141 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Mourad-Zeidan, V. O. Melnikova, H. Wang, A. Raz, and M. Bar-Eli Expression Profiling of Galectin-3-Depleted Melanoma Cells Reveals its Major Role in Melanoma Cell Plasticity and Vasculogenic Mimicry Am. J. Pathol., December 1, 2008; 173(6): 1839 - 1852. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Nottebaum, G. Cagna, M. Winderlich, A. C. Gamp, R. Linnepe, C. Polaschegg, K. Filippova, R. Lyck, B. Engelhardt, O. Kamenyeva, et al. VE-PTP maintains the endothelial barrier via plakoglobin and becomes dissociated from VE-cadherin by leukocytes and by VEGF J. Exp. Med., November 24, 2008; 205(12): 2929 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schulz, J. Pruessmeyer, T. Maretzky, A. Ludwig, C. P. Blobel, P. Saftig, and K. Reiss ADAM10 Regulates Endothelial Permeability and T-Cell Transmigration by Proteolysis of Vascular Endothelial Cadherin Circ. Res., May 23, 2008; 102(10): 1192 - 1201. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Barbieri, L. Ruggiero, E. Tremoli, and B. B. Weksler Suppressing PTEN Activity by Tobacco Smoke Plus Interleukin-1{beta} Modulates Dissociation of VE-Cadherin/{beta}-Catenin Complexes in Endothelium Arterioscler. Thromb. Vasc. Biol., April 1, 2008; 28(4): 732 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Dewi, T. Takasaki, and I. Kurane Peripheral blood mononuclear cells increase the permeability of dengue virus-infected endothelial cells in association with downregulation of vascular endothelial cadherin J. Gen. Virol., March 1, 2008; 89(3): 642 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Labelle, H. J. Schnittler, D. E. Aust, K. Friedrich, G. Baretton, D. Vestweber, and G. Breier Vascular Endothelial Cadherin Promotes Breast Cancer Progression via Transforming Growth Factor {beta} Signaling Cancer Res., March 1, 2008; 68(5): 1388 - 1397. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Najy, K. C. Day, and M. L. Day ADAM15 Supports Prostate Cancer Metastasis by Modulating Tumor Cell-Endothelial Cell Interaction Cancer Res., February 15, 2008; 68(4): 1092 - 1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Vestweber VE-Cadherin: The Major Endothelial Adhesion Molecule Controlling Cellular Junctions and Blood Vessel Formation Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 223 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, M. W. Lensch, J. Wylie-Sears, G. Q. Daley, and J. Bischoff Hemogenic Endothelial Progenitor Cells Isolated from Human Umbilical Cord Blood Stem Cells, November 1, 2007; 25(11): 2770 - 2776. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Carter, G. Niu, M. D. Ward, G. Small, J. E. Hahn, and B. J. Muffly Mechanisms of HER2-Induced Endothelial Cell Retraction Ann. Surg. Oncol., October 1, 2007; 14(10): 2971 - 2978. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Shasby Cell-cell adhesion in lung endothelium Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L593 - L607. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hu, N. Ferrara, and R. B. Jaffe Paracrine VEGF/VE-Cadherin Action on Ovarian Cancer Permeability. Experimental Biology and Medicine, November 1, 2006; 231(10): 1646 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Hall, F. R. Westwood, and P. F. Wadsworth Review of the Effects of Anti-Angiogenic Compounds on the Epiphyseal Growth Plate Toxicol Pathol, February 1, 2006; 34(2): 131 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Xiao, J. Garner, K. M. Buckley, P. A. Vincent, C. M. Chiasson, E. Dejana, V. Faundez, and A. P. Kowalczyk p120-Catenin Regulates Clathrin-dependent Endocytosis of VE-Cadherin Mol. Biol. Cell, November 1, 2005; 16(11): 5141 - 5151. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hudry-Clergeon, D. Stengel, E. Ninio, and I. Vilgrain Platelet-activating factor increases VE-cadherin tyrosine phosphorylation in mouse endothelial cells and its association with the PtdIns3'-kinase FASEB J, April 1, 2005; 19(6): 512 - 520. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lambeng, Y. Wallez, C. Rampon, F. Cand, G. Christe, D. Gulino-Debrac, I. Vilgrain, and P. Huber Vascular Endothelial-Cadherin Tyrosine Phosphorylation in Angiogenic and Quiescent Adult Tissues Circ. Res., February 18, 2005; 96(3): 384 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sengupta, S. Caballero, R. N. Mames, A. M. Timmers, D. Saban, and M. B. Grant Preventing Stem Cell Incorporation into Choroidal Neovascularization by Targeting Homing and Attachment Factors Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 343 - 348. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iyer, D. M. Ferreri, N. C. DeCocco, F. L. Minnear, and P. A. Vincent VE-cadherin-p120 interaction is required for maintenance of endothelial barrier function Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1143 - L1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, D. F. Lewis, Y. Gu, Y. Zhang, J. S. Alexander, and D. N. Granger Placental Trophoblast-Derived Factors Diminish Endothelial Barrier Function J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2421 - 2428. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Vincent, K. Xiao, K. M. Buckley, and A. P. Kowalczyk VE-cadherin: adhesion at arm's length Am J Physiol Cell Physiol, May 1, 2004; 286(5): C987 - C997. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Spagnuolo, M. Corada, F. Orsenigo, L. Zanetta, U. Deuschle, P. Sandy, C. Schneider, C. J. Drake, F. Breviario, and E. Dejana Gas1 is induced by VE-cadherin and vascular endothelial growth factor and inhibits endothelial cell apoptosis Blood, April 15, 2004; 103(8): 3005 - 3012. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Nelson and C. S. Chen VE-cadherin simultaneously stimulates and inhibits cell proliferation by altering cytoskeletal structure and tension J. Cell Sci., September 1, 2003; 116(17): 3571 - 3581. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Xiao, D. F. Allison, M. D. Kottke, S. Summers, G. P. Sorescu, V. Faundez, and A. P. Kowalczyk Mechanisms of VE-cadherin Processing and Degradation in Microvascular Endothelial Cells J. Biol. Chem., May 23, 2003; 278(21): 19199 - 19208. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Calkins, B. L. Hoepner, C. M. Law, M. R. Novak, S. V. Setzer, M. Hatzfeld, and A. P. Kowalczyk The Armadillo Family Protein p0071 Is a VE-cadherin- and Desmoplakin-binding Protein J. Biol. Chem., January 10, 2003; 278(3): 1774 - 1783. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. C. Albuquerque and A. S. Flozak Wound Closure in Sheared Endothelial Cells Is Enhanced by Modulation of Vascular Endothelial-Cadherin Expression and Localization Experimental Biology and Medicine, December 1, 2002; 227(11): 1006 - 1016. [Abstract] [Full Text] |
||||
![]() |
K. Venkiteswaran, K. Xiao, S. Summers, C. C. Calkins, P. A. Vincent, K. Pumiglia, and A. P. Kowalczyk Regulation of endothelial barrier function and growth by VE-cadherin, plakoglobin, and beta -catenin Am J Physiol Cell Physiol, September 1, 2002; 283(3): C811 - C821. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Corada, L. Zanetta, F. Orsenigo, F. Breviario, M. G. Lampugnani, S. Bernasconi, F. Liao, D. J. Hicklin, P. Bohlen, and E. Dejana A monoclonal antibody to vascular endothelial-cadherin inhibits tumor angiogenesis without side effects on endothelial permeability Blood, July 18, 2002; 100(3): 905 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zanetti, M. G. Lampugnani, G. Balconi, F. Breviario, M. Corada, L. Lanfrancone, and E. Dejana Vascular Endothelial Growth Factor Induces Shc Association With Vascular Endothelial Cadherin: A Potential Feedback Mechanism to Control Vascular Endothelial Growth Factor Receptor-2 Signaling Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 617 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Lampugnani, A. Zanetti, F. Breviario, G. Balconi, F. Orsenigo, M. Corada, R. Spagnuolo, M. Betson, V. Braga, and E. Dejana VE-Cadherin Regulates Endothelial Actin Activating Rac and Increasing Membrane Association of Tiam Mol. Biol. Cell, April 1, 2002; 13(4): 1175 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. van Wetering, J. D. van Buul, S. Quik, F. P. J. Mul, E. C. Anthony, J.-P. t. Klooster, J. G. Collard, and P. L. Hordijk Reactive oxygen species mediate Rac-induced loss of cell-cell adhesion in primary human endothelial cells J. Cell Sci., January 5, 2002; 115(9): 1837 - 1846. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bardin, F. Anfosso, J.-M. Masse, E. Cramer, F. Sabatier, A. L. Bivic, J. Sampol, and F. Dignat-George Identification of CD146 as a component of the endothelial junction involved in the control of cell-cell cohesion Blood, December 15, 2001; 98(13): 3677 - 3684. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Shaw, P. S. Bamba, B. N. Perkins, and F. W. Luscinskas Real-Time Imaging of Vascular Endothelial-Cadherin During Leukocyte Transmigration Across Endothelium J. Immunol., August 15, 2001; 167(4): 2323 - 2330. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Corada, F. Liao, M. Lindgren, M. G. Lampugnani, F. Breviario, R. Frank, W. A. Muller, D. J. Hicklin, P. Bohlen, and E. Dejana Monoclonal antibodies directed to different regions of vascular endothelial cadherin extracellular domain affect adhesion and clustering of the protein and modulate endothelial permeability Blood, March 15, 2001; 97(6): 1679 - 1684. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Yanez-Mo, R Tejedor, P Rousselle, and F Sanchez -Madrid Tetraspanins in intercellular adhesion of polarized epithelial cells: spatial and functional relationship to integrins and cadherins J. Cell Sci., January 2, 2001; 114(3): 577 - 587. [Abstract] [PDF] |
||||
![]() |
F. Liao, Y. Li, W. OConnor, L. Zanetta, R. Bassi, A. Santiago, J. Overholser, A. Hooper, P. Mignatti, E. Dejana, et al. Monoclonal Antibody to Vascular Endothelial-cadherin Is a Potent Inhibitor of Angiogenesis, Tumor Growth, and Metastasis Cancer Res., December 1, 2000; 60(24): 6805 - 6810. [Abstract] [Full Text] |
||||
![]() |
X. Gao, P. Kouklis, N. Xu, R. D. Minshall, R. Sandoval, S. M. Vogel, and A. B. Malik Reversibility of increased microvessel permeability in response to VE-cadherin disassembly Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1218 - L1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Allport, W. A. Muller, and F. W. Luscinskas Monocytes Induce Reversible Focal Changes in Vascular Endothelial Cadherin Complex during Transendothelial Migration Under Flow J. Cell Biol., January 10, 2000; 148(1): 203 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Castilla, M. V. A. Arroyo, E. Aceituno, P. Aragoncillo, F. R. Gonzalez-Pacheco, E. Texeiro, R. Bragado, and C. Caramelo Disruption of Cadherin-Related Junctions Triggers Autocrine Expression of Vascular Endothelial Growth Factor in Bovine Aortic Endothelial Cells : Effects on Cell Proliferation and Death Resistance Circ. Res., December 3, 1999; 85(12): 1132 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Noria, D. B. Cowan, A. I. Gotlieb, and B. L. Langille Transient and Steady-State Effects of Shear Stress on Endothelial Cell Adherens Junctions Circ. Res., September 17, 1999; 85(6): 504 - 514. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. V Bobryshev, S. M Cherian, S. J Inder, and R. S.A Lord Neovascular expression of VE-cadherin in human atherosclerotic arteries and its relation to intimal inflammation Cardiovasc Res, September 1, 1999; 43(4): 1003 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Corada, M. Mariotti, G. Thurston, K. Smith, R. Kunkel, M. Brockhaus, M. G. Lampugnani, I. Martin-Padura, A. Stoppacciaro, L. Ruco, et al. Vascular endothelial-cadherin is an important determinant of microvascular integrity in vivo PNAS, August 17, 1999; 96(17): 9815 - 9820. [Abstract] [Full Text] [PDF] |
||||
![]() |
V Noe, J Willems, J Vandekerckhove, F. Roy, E Bruyneel, and M Mareel Inhibition of adhesion and induction of epithelial cell invasion by HAV-containing E-cadherin-specific peptides J. Cell Sci., January 1, 1999; 112(1): 127 - 135. [Abstract] [PDF] |
||||
![]() |
T. L. Bach, C. Barsigian, C. H. Yaen, and J. Martinez Endothelial Cell VE-cadherin Functions as a Receptor for the beta 15-42 Sequence of Fibrin J. Biol. Chem., November 13, 1998; 273(46): 30719 - 30728. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gulino, E. Delachanal, E. Concord, Y. Genoux, B. Morand, M.-O. Valiron, E. Sulpice, R. Scaife, M. Alemany, and T. Vernet Alteration of Endothelial Cell Monolayer Integrity Triggers Resynthesis of Vascular Endothelium Cadherin J. Biol. Chem., November 6, 1998; 273(45): 29786 - 29793. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Martin-Padura, S. Lostaglio, M. Schneemann, L. Williams, M. Romano, P. Fruscella, C. Panzeri, A. Stoppacciaro, L. Ruco, A. Villa, et al. Junctional Adhesion Molecule, a Novel Member of the Immunoglobulin Superfamily That Distributes at Intercellular Junctions and Modulates Monocyte Transmigration J. Cell Biol., July 13, 1998; 142(1): 117 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Telo', F. Breviario, P. Huber, C. Panzeri, and E. Dejana Identification of a Novel Cadherin (Vascular Endothelial Cadherin-2) Located at Intercellular Junctions in Endothelial Cells J. Biol. Chem., July 10, 1998; 273(28): 17565 - 17572. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yanez-Mo, A. Alfranca, C. Cabanas, M. Marazuela, R. Tejedor, M. Angeles Ursa, L. K. Ashman, M. O. de Landazuri, and F. Sanchez-Madrid Regulation of Endothelial Cell Motility by Complexes of Tetraspan Molecules CD81/TAPA-1 and CD151/PETA-3 with alpha 3beta 1 Integrin Localized at Endothelial Lateral Junctions J. Cell Biol., May 4, 1998; 141(3): 791 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Navarro, L. Ruco, and E. Dejana Differential Localization of VE- and N-Cadherins in Human Endothelial Cells: VE-Cadherin Competes with N-Cadherin for Junctional Localization J. Cell Biol., March 23, 1998; 140(6): 1475 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gory, J. Dalmon, M.-H. Prandini, T. Kortulewski, Y. de Launoit, and P. Huber Requirement of a GT Box (Sp1 Site) and Two Ets Binding Sites for Vascular Endothelial Cadherin Gene Transcription J. Biol. Chem., March 20, 1998; 273(12): 6750 - 6755. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kowalczyk, P Navarro, E Dejana, E. Bornslaeger, K. Green, D. Kopp, and J. Borgwardt VE-cadherin and desmoplakin are assembled into dermal microvascular endothelial intercellular junctions: a pivotal role for plakoglobin in the recruitment of desmoplakin to intercellular junctions J. Cell Sci., January 10, 1998; 111(20): 3045 - 3057. [Abstract] [PDF] |
||||
![]() |
S Esser, M. Lampugnani, M Corada, E Dejana, and W Risau Vascular endothelial growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cells J. Cell Sci., January 7, 1998; 111(13): 1853 - 1865. [Abstract] [PDF] |
||||
![]() |
J. R. Allport, H. Ding, T. Collins, M. E. Gerritsen, and F. W. Luscinskas Endothelial-dependent Mechanisms Regulate Leukocyte Transmigration: A Process Involving the Proteasome and Disruption of the Vascular Endothelial-Cadherin Complex at Endothelial Cell-to-Cell Junctions J. Exp. Med., August 18, 1997; 186(4): 517 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. G. Dong, S. Bernasconi, S. Lostaglio, R. Wainstok De Calmanovici, I. Martin-Padura, F. Breviario, C. Garlanda, S. Ramponi, A. Mantovani, and A. Vecchi A General Strategy for Isolation of Endothelial Cells From Murine Tissues : Characterization of Two Endothelial Cell Lines From the Murine Lung and Subcutaneous Sponge Implants Arterioscler. Thromb. Vasc. Biol., August 1, 1997; 17(8): 1599 - 1604. [Abstract] [Full Text] |
||||
![]() |
M. Lampugnani, M Corada, P Andriopoulou, S Esser, W Risau, and E Dejana Cell confluence regulates tyrosine phosphorylation of adherens junction components in endothelial cells J. Cell Sci., January 9, 1997; 110(17): 2065 - 2077. [Abstract] [PDF] |
||||
![]() |
S. Corvera, C. DiBonaventura, and H. S. Shpetner Cell Confluence-dependent Remodeling of Endothelial Membranes Mediated by Cholesterol J. Biol. Chem., September 29, 2000; 275(40): 31414 - 31421. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Legrand, S. Bibert, M. Jaquinod, C. Ebel, E. Hewat, F. Vincent, C. Vanbelle, E. Concord, T. Vernet, and D. Gulino Self-assembly of the Vascular Endothelial Cadherin Ectodomain in a Ca2+-dependent Hexameric Structure J. Biol. Chem., January 26, 2001; 276(5): 3581 - 3588. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bazzoni, O. M. Martinez-Estrada, F. Orsenigo, M. Cordenonsi, S. Citi, and E. Dejana Interaction of Junctional Adhesion Molecule with the Tight Junction Components ZO-1, Cingulin, and Occludin J. Biol. Chem., June 30, 2000; 275(27): 20520 - 20526. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zanetti, M. G. Lampugnani, G. Balconi, F. Breviario, M. Corada, L. Lanfrancone, and E. Dejana Vascular Endothelial Growth Factor Induces Shc Association With Vascular Endothelial Cadherin: A Potential Feedback Mechanism to Control Vascular Endothelial Growth Factor Receptor-2 Signaling Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 617 - 622. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |