This Article Abstract Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Marcil, M. Articles by Genest, J. Search for Related Content PubMed PubMed Citation Articles by Marcil, M. Articles by Genest, J., Jr

(Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:1015-1024.)
© 1995 American Heart Association, Inc.

Articles

Severe Familial HDL Deficiency in French-Canadian Kindreds

Clinical, Biochemical, and Molecular Characterization

Michel Marcil; Betsie Boucher; Larbi Krimbou; B. Charles Solymoss; Jean Davignon; Jiri Frohlich; Jacques Genest, Jr

From the Cardiovascular Genetics Laboratory (M.M., B.B., L.K., J.G. Jr) and the Hyperlipidemia and Atherosclerosis Research Group (J.D.), Clinical Research Institute of Montréal; the Montréal Heart Institute (M.M., B.C.S., J.G. Jr); the Cardiology Services, Hôpital Hôtel-Dieu de Montréal (J.G. Jr); and the Department of Pathology and Laboratory Medicine (J.F.), University of British Columbia, Vancouver, Canada.

Correspondence to Jacques Genest, Jr, MD, Cardiovascular Genetics Laboratory, Clinical Research Institute of Montréal, 110 Pine Ave West, Montréal, Québec, Canada H2W 1R7.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract A decreased level of HDL cholesterol (HDL-C) is the most common lipoprotein abnormality seen in people with premature coronary artery disease (CAD). In many cases, HDL-C reduction in patients with CAD may be the result of increased apo B–containing lipoprotein production by the liver with secondary hypoalphalipoproteinemia. Primary hypoalphalipoproteinemia is seen in approximately 4% of people with CAD. We report findings in four subjects with severe familial HDL deficiency (HDL-C<<5th percentile for age and sex; 0.08 to 0.38 mmol/L) in three French-Canadian kindreds with autosomal codominant inheritance. By inclusion criteria, all four subjects had normal fasting triglycerides and none were diabetic. HDL particle size by gradient gel electrophoresis revealed small HDL particles (estimated Stokes' diameter, 8.14 to 8.30 nm). Apo AI analysis by polyacrylamide gel electrophoresis and use of isoelectrofocusing gels in affected subjects revealed normal molecular weight (28.3 kD) and normal isoelectrofocusing point but a relative increase in proapolipoprotein AI, with near-normal levels of proapolipoprotein AI in plasma, suggesting normal secretion of apo AI. Quantitative Southern blot analysis of the apo AI-CIII-AIV gene cluster reveals no gene rearrangements or allele deletion. Haplotypes of the apo AI gene, determined by use of the restriction enzymes Pst I, Xmn I, and Sst I and of the apo AII gene by use of the enzyme Msp I, did not reveal segregation of the low HDL-C trait with either the apo AI or the AII gene. Sequence analysis of the promoter region of the apo AI gene reveals heterozygosity for guanine-to-adenine substitution at position 76 in two kindreds with no evidence of segregation with the low HDL trait. None of the patients had mutations of the lipoprotein lipase gene common in subjects of French-Canadian descent. Haplotype analysis of the lipoprotein lipase gene did not show segregation with the low HDL trait. Plasma lecithin:cholesterol acyltransferase (LCAT) activity was found to be within normal levels in affected subjects and in nonaffected first-degree relatives. None of the affected subjects had clinical manifestations of Tangier disease. Two of the four cases examined, both men, had severe CAD and had undergone revascularization procedures. The third is a younger brother of one of these probands and the fourth is a 30-year-old woman, and both were free of clinical CAD. However, in none of the families did the low HDL trait unequivocally cosegregate with CAD. The data reveal that the molecular defect in our patients with severe hypoalphalipoproteinemia is not linked to the apo AI-CIII-AIV gene cluster, LCAT activity, elevated triglycerides, or lipoprotein lipase gene defects. CAD was identified in two probands, but both had several risk factors for CAD. Although hypercatabolism of HDL particles and apo AI has been shown to occur in patients with hypoalphalipoproteinemia, the exact metabolic and molecular defect(s) remain unknown. We hypothesize that an alteration in HDL-mediated cholesterol efflux or in intracellular cholesterol transport to the cell surface may explain the metabolic abnormalities observed.

Key Words: HDL • reverse cholesterol transport • apolipoprotein AI

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Increased plasma lipids and VLDL, IDL, and LDL cholesterol levels are associated with the development of coronary artery disease (CAD) in retrospective case-control studies and in prospective, longitudinal studies (for review, see Reference 1¹ ). Many studies have shown that a decreased level of HDL cholesterol (HDL-C) is the best marker for CAD. Although there is some controversy about which HDL subfraction provides optimal protection, a decrease in the number of HDL particles remains the strongest predictor of risk, according to many studies.² The measurement of HDL-associated apolipoproteins, especially apo AI and apo AII, has little additional predictive value over the measurement of HDL-C.³ The measurement of HDL-C level is important in the determination of cardiovascular risk,⁴ and it appears to be predictive of future coronary events.⁵

In this context, syndromes of HDL deficiency have attracted a great deal of interest during the past 10 years mostly because they increase our understanding of the role of HDL in atherogenesis. With the cloning and sequencing of all known apolipoproteins, lipoprotein-processing enzymes, and lipoprotein receptors, many (usually rare) defects of HDL metabolism have been identified. Several mutations of the apo AI gene have been characterized in which apo AI is not produced^{6 7 8 9 10 11 12 13 14 15 16} ; other point mutations alter the protein sequence and are, in general, of little clinical consequence.^{17 18 19 20} Mutations within the genes coding for lipoprotein lipase (LPL) or its activator apo CII are associated with severe hypertriglyceridemia and markedly reduced HDL-C levels (for review, see Reference 21²¹ ). Mutations in the gene coding for the enzyme lecithin:cholesterol acyltransferase (LCAT) are associated with corneal opacities, anemia, renal failure, and severe HDL deficiency.^{22 23 24 25 26 27} Tangier disease is characterized by extreme HDL deficiency and increased catabolism of HDL and apo AI; in addition, infiltration of reticuloendothelial tissue and Schwann cells with neutral lipids is found.^{28 29 30} The genetic or metabolic defects in Tangier disease are still unknown. In contrast to the rarity of defects of HDL metabolism, moderate reductions of HDL-C levels are commonly encountered in patients with premature CAD.^{31 32}

In the present study, we present four subjects from three kindreds with severe HDL deficiency. Our purpose was to examine the known causes of HDL deficiency in each proband, including common causes of low HDL-C, mutations at the apo AI-CIII-AIV and LPL gene loci, LCAT deficiency, and clinical manifestations of Tangier disease. We also examined the association between the low HDL trait and the presence of premature CAD. We suggest that this syndrome be called "severe familial HDL deficiency." Several groups have reported patients, such as ours, with very low HDL-C levels, and kinetic studies have shown increased catabolism of HDL particles or apo AI.^{19 20 29 33 34 35 36} Despite such characterization of lipoprotein kinetics during the past decade or so, the metabolic or genetic abnormalities in such patients have not been identified.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Subject Selection
Patients were selected from the Lipid Clinics of the Montréal Heart Institute and the Clinical Research Institute of Montréal. The basis of selection was an HDL-C level below the 5th percentile for age- and sex-matched norms³⁷ with normal fasting triglycerides (<95th percentile). The patients, all adults, were referred to the Clinical Research Institute of Montréal or the Montréal Heart Institute for a workup of lipoprotein disorders. A search of computer databases for actively followed patients was performed with the criteria of low HDL-C and triglycerides less than the 95th percentile for age and sex according to the the Lipid Research Clinics database.³⁷

Lipids and Lipoprotein Cholesterol
Blood was drawn by venipuncture in an antecubital vein in tubes containing EDTA as an anticoagulant (final concentration, 1.2 mg/mL) for the determination of biochemical variables. Plasma was separated by centrifugation (20 minutes at 4°C, 3000 rpm), and five 1-mL aliquots were stored at -80°C for future studies. Total cholesterol, triglyceride, and HDL-C levels were measured as previously described^{38 39 40} with the Cobas Mira-S analyzer (Hoffman Roche Diagnostics). Lipoprotein cholesterol was determined after ultracentrifugation of plasma as described.⁴¹ HDL-C was measured after precipitation of apo B–containing lipoproteins⁴⁰ ; LDL-C was determined as infranate cholesterol minus HDL-C. The laboratory participates in and meets the requirements of the Centers for Disease Control and Prevention cholesterol standardization program.

HDL Particle Isolation
HDL particles were separated by sequential ultracentrifugation at densities of 1.063 to 1.210 g/mL, adjusted with solid KBr for 22 hours at 50 000 rpm in a Ti 50.3 rotor (Beckman Instruments), and a third centrifugation at d=1.210 g/mL was used to wash and concentrate the lipoproteins.⁴¹ HDL particles were also separated by single-step density gradient ultracentrifugation in an SW40 rotor for 24 hours at 38 000 rpm (Beckman Instruments).⁴² For the latter step, we overlaid 2 mL plasma with solutions of decreasing densities (1.210 g/mL, 2 mL; 1.063 g/mL, 3.8 mL; 1.019 g/mL, 3.3 mL; and 1.006 g/mL, 1.2 mL) with solid NaBr. The tubes were then punctured through the bottom and the contents were gently forced through the top of the tube by injection of an NaBr solution (1.400 g/mL) through the bottom of the tube. Optical density at 280 nm was monitored on-line and fractions were separated on an LKB fraction collector (Pharmacia Biotech Inc). Each HDL fraction was extensively dialyzed in 0.9% NaCl overnight at 4°C.⁴² HDL particle size was performed on nondenaturing 4% to 30% preformed polyacrylamide gradient gels as described.⁴³ The Stokes' diameter of HDL particles was estimated with the use of the following standards: thyroglobulin (17.0 nm), ferritin (12.2 nm), lactate dehydrogenase (8.1 nm), and albumin (7.1 nm). A large HDL particle has a score of 1 (HDL-1), corresponding to a Stokes' diameter of 12.46 nm, and the smallest HDL particle found with this system was HDL-14 (Stokes' diameter <7.86 nm).⁴³

Apo AI, Apo B, and Lp AI
Apo AI was determined by nephelometry (BN-100 nephelometer, Berhing) with polyclonal antisera directed against apo AI.⁴⁴ A similar technique was used for apo B,⁴⁵ with polyclonal antiserum directed against apo B. Lp AI was measured by electroimmunodiffusion (rocket immunoelectrophoresis), with preformed agarose gels with excess anti-apo AII polyclonal antibodies (Sebia Hydragel) as previously described.^{46 47}

Polyacrylamide Gel Electrophoresis
HDL protein was quantified by the Lowry method, and approximately 50 to 100 µg of HDL protein was applied to the gels. We used a 4% to 16% polyacrylamide gel in addition to straight 6% or 8% gels for the identification of apolipoproteins.⁴⁸ On each run, lipoprotein fractions from a normolipidemic control subject, isolated at the same time and under the same conditions as those from the patients, were run in parallel.

Isoelectrofocusing Gels for Apo AI
Isoelectrofocusing gels were run on delipidated HDL proteins isolated by ultracentrifugation from the control subject and the patients with severe hypoalphalipoproteinemia. We used an isoelectrofocusing gel as previously described⁴⁹ and loaded approximately 50 to 100 µg HDL protein in each tube. The gels consisted of 7.5% acrylamide in 8 mol/L urea with ampholines, pH 4/6 (Bio-Rad Laboratories). HDL particles were delipidated in acetone:ethanol (1:1) and diethyl ether at -20°C. The loading buffer consisted of 8 mol/L urea and 10 mmol/L dithiothreitol, pH 8.6. The gels were run overnight at 4°C at 250 V (approximately 2.2 mA/tube) and stained with Coomassie brilliant blue (0.04%) in perchloric acid (3.5%) and destained in 5% acetic acid. We then photographed them and read them by densitometry to estimate the relative concentration of proapolipoprotein AI and mature apo AI. To do so, we scanned apo AI bands, and the proapolipoprotein AI band was expressed as a percent of total apo AI. The concentration of proapolipoprotein AI was then estimated as the percent of total apo AI protein multiplied by total plasma apo AI.

Southern Blots and Apo AI Gene Xmn I, Sst I, Pst I Restriction Fragment–Length Polymorphisms
Southern blots were performed on human genomic DNA isolated from peripheral leukocytes as previously described.⁵⁰ Restriction fragment–length polymorphisms (RFLPs) were determined for the apo AI gene with the restriction enzymes Xmn I (New England Biolabs), Sst I, and Pst I (GIBCO Bethesda Research Laboratories). DNA was cut according to the recommendations of the manufacturer, separated on 1.0% agarose gels, and transferred onto nylon filters (Hybond N, Amersham). The nylon filters were hybridized with a full length ³²P-labeled cDNA probe of the apo AI gene at 65°C as described.⁵⁰ Labeling of the cDNA probe was performed with the random primer method by use of the Klenow polymerase (Pharmacia Biotech Inc). Molecular weight standards were applied on each gel to determine the size of the hybridized fragments. The gels were exposed on Kodak XAR-5 film (Kodak Scientific) and developed after 24 to 72 hours at -80°C.

Polymerase Chain Reaction
The apo AI Xmn I, Sst I, and Pst I⁵¹ and apo AII Msp I RFLPs⁵² were determined by polymerase chain reaction and digestion of the amplified products with the appropriate enzymes with subsequent separation of the fragments by agarose gel electrophoresis. For determination of haplotypes of the apo AI and apo AII genes, DNA was isolated from probands and all family members who were available for DNA analysis. The apo AI Xmn I, Sst I, and Pst I as well as the apo AII Msp I RFLPs were determined as described.^{51 52} The presence of a cutting site in one allele was noted as 1 and in both alleles as 2, and its absence was noted as 0.

The diagnoses of mutations LPL188, LPL207, and LPL250 were performed as described.²¹ Haplotypes of the LPL gene were determined by analysis of the LPL5GT site, as described.⁵³ The LPL5GT site is a polymorphic microsatellite containing a guanine (G)-thymine (T) repeat flanking the 5' side of the LPL gene. Reactions were run on a 6% polyacrylamide gel and the fragments were detected by autoradiography.

DNA Sequencing
We performed sequence analysis on the apo AI promoter region, exon 1, and part of intron 1 (-99 to +375) by first amplifying a 475-bp region of the apo AI gene (-99 to +375) and subcloning the fragment obtained by polymerase chain reaction into the pGEM-t vector (Promega) by use of T4 DNA ligase (Promega) under the conditions suggested by the manufacturer. The sequence of the oligonucleotides used was (5'-3') AGGACCAGTGAGCAGCAACA for the forward primer and AGTGAGAAACCTGCTGCCTCT for the reverse primer. The ligated plasmids were then used to transform the DH5 strain of E coli (GIBCO BRL Life Technologies), which lacks the ampicillin resistance gene. The transformed bacteria were grown on LB agar containing ampicillin and IPTG. Colonies that failed to turn blue in the presence of X-Gal were cultured individually and the plasmid DNA was isolated on Quiagen-100 columns (Quiagen Inc). The purified plasmid clones were then sequenced with the dideoxynucleotide chain termination method by use of a T7- or Sp6-dependent DNA polymerase sequencing kit (Pharmacia Biotech Inc).

LCAT Activity
LCAT activity was determined in plasma as previously described²⁵ by use of an exogenous substrate composed of egg yolk lecithin, unesterified cholesterol, and apo AI.²⁴ With this assay, LCAT activity of 20 nmoL of free cholesterol esterified/mL · h^-1 is >2 SD below the mean of normal and is used for the phenotypic assessment of heterozygous LCAT deficiency.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Case 1: Proband 24430-301
The proband is a 48-year-old man, father of one daughter. His past medical history is insignificant except for cholestatic jaundice secondary to antibiotic therapy 10 years before this evaluation. Liver function tests and bilirubin levels have been consistently within normal limits since this episode. CAD was diagnosed at age 42 and the patient underwent percutaneous transluminal coronary angioplasty of the left anterior descending coronary artery at age 47 for symptoms refractory to medical therapy. One year later, he underwent right femoral angioplasty for stenosis of the common femoral artery. Since then, symptoms of CAD have progressed, with worsening exertional angina. Repeat coronary angiography revealed a 50% left main coronary artery stenosis and the patient underwent coronary bypass surgery. He was known to have a very low HDL-C for at least 8 years, as was found during routine physical examinations. He was not on medications known to alter plasma lipids, including the drug probucol, at any time. He is a smoker (one pack per day) and has a history of high blood pressure; his smoking habits have not changed despite medical advice and worsening cardiac symptoms. His medications include aspirin 325 mg every second day and 90 mg diltiazem SR twice per day. On physical examination, the weight was determined to be 78.5 kg, the height 172 cm, and the body mass index (BMI [weight (kg)/height (m²)]) 26.5. Blood pressure was 150/90 mm Hg and the heart rate 70 beats per minute. There were no corneal lipid deposits and no xanthomas (tendinous or plantar), the tonsils were normal in size and color, there was no enlargement of lymphoid tissue, and there was no hepatic or splenic enlargement. There were vascular bruits over the femoral arteries. The rest of the examination was within normal limits. A summary of clinical and demographic features is shown in Table 1; the pedigree is shown in Fig 1, top.

View this table: [in this window] [in a new window]   Table 1. Subject Demographics

View larger version (32K): [in this window] [in a new window]   Figure 1. Pedigrees for kindreds 24430 (top), 24842 (middle), and 24723 (bottom) show HDL cholesterol levels (in mmol/L) below or above the symbols representing family members. Numbers within the symbols ( for men; for women) relate to their family number; the proband, indicated by a thick arrow, has the suffix 301. Crossed symbols identify a deceased relative, and an asterisk indicates documented premature coronary artery disease. Haplotypes for the apo AI-CIII-AIV gene cluster were determined with the restriction fragment–length polymorphisms identified by use of the enzymes Xmn I and Sst I (see Table 4).

Case 2: Proband 24430-313
This subject is the 39-year-old brother of the patient described above. He has no significant past medical history and is not known to have cardiovascular disease. Findings on physical examination were within normal limits; there was no clinical evidence of lymphoid tissue infiltration, the tonsils were normal in size and color, and there was no corneal arcus. His BMI was 27. He was not taking any medication (Table 1, Fig 1, top). Within this kindred, no other subject was found on clinical grounds to have CAD. All subjects in the kindred were questioned and examined by a cardiologist (J.G. Jr). Subject 24430-315 does have significant CAD but is not a blood relative of probands 24430-301 and 24430-313 (Fig 1, top).

Case 3: Proband 24842-301
The proband is a 53-year-old man, slightly overweight, who underwent coronary bypass surgery at age 41; he has a known history of high blood pressure, cigarette smoking, and slightly elevated fasting blood glucose (7.0 mmol/L), although a diagnosis of diabetes was never made. On physical examination, the patient had bilateral corneal arcus but there were no xanthomas or xanthelasmas. The tonsils were normal in size and color, and there was no hepatosplenomegaly. The patient has an older brother with established CAD (Table 1, Fig 1, middle). Within this kindred, several members were diagnosed as having CAD. In the subjects examined, no clear association was identified between the presence of CAD and a low HDL-C. Of interest, the patient has elevated apo B levels (175 mg/dL), triglyceride levels ranging from 1.8 to 4.48 mmol/L, hypertension, and abnormal fasting glucose levels. Therefore, this subject has a clustering of cardiovascular risk factors that are often associated with a low HDL-C.

Case 4: Proband 24723-301
The proband is a 30-year-old woman, married and the mother of two children. During a routine physical examination, she was found to have a very low HDL-C and was referred to our clinic. There was no significant medical history other than childbearing. The patient is a nonsmoker, does not drink alcohol other than on rare occasions, and does not take any medications (including hormones). Findings on physical examination were within normal limits. The tonsils were slightly enlarged but of normal color, and an ear, nose, and throat consultant thought that the tonsils were at the upper limit of normal in terms of size. Within this kindred, no other member was diagnosed with CAD; however, the proband's siblings are relatively young and three of four are women (Table 1, Fig 1, bottom).

The demographic features of the probands and their family members are shown in Table 1. By convention, all probands are identified by the suffix 301, their spouses by 302, siblings by 303 and up, parents by 200 and up, and children by 400 and up. Probands 24430-301 and 24842-301 had CAD but also had several risk factors for CAD,⁴ including smoking, hypertension, and being of the male sex. None of the probands were diabetics, but the brother of case 3, indicated as 24842-308, had non–insulin-dependent diabetes mellitus. Case 2, who had an HDL-C of 0.13 mmol/L (Table 2), was clinically free of cardiovascular disease. He was 39 years old, a nonsmoker, and not diabetic or hypertensive. Case 4 was a 30-year-old mother of two with no evidence of CAD.

View this table: [in this window] [in a new window]   Table 2. Plasma Lipids and Lecithin:Cholesterol Acyltransferase

Lipids and Lipoproteins
The 5th percentiles of HDL-C for age and sex were determined according to the Lipid Research Clinics database.³⁷ All probands had an HDL-C<<5th percentile for their age and sex. As can be seen (Table 2), cases 1, 2, and 3, all men, had HDL-C levels of 0.18, 0.13, and 0.38 mmol/L, respectively, and case 4, a woman, had an HDL-C level of 0.27 mmol/L. Fasting triglyceride levels were less than the 95th percentile in all these subjects. Plasma levels of apo B were within normal limits or only slightly elevated. Apo AI levels were reduced to approximately 20% to 50% of normal, as were Lp AI levels (Table 2). A gradient density profile of plasma on probands was performed as described in "Methods." As shown in Fig 2, the absorbance at 280 nm reveals that there was a marked reduction in HDL particles in the study patients compared with a normal control subject. Furthermore, the patients also had a reduction of particles in the LDL density range and an accumulation of particles in the IDL density range. Of note, the apo E phenotype for the subject whose gradient density profile is shown in Fig 2 is apo E3/3, and the patient has no clinical or biochemical evidence of type III dyslipoproteinemia.

View larger version (18K): [in this window] [in a new window]   Figure 2. Graph shows gradient density profiles of plasma from proband 24430-313 with familial hypoalphalipoproteinemia (FHA; solid line) and a normolipidemic control subject (dashed line). Fraction 1 represents large, buoyant lipoproteins and fractions of more than 28 represent plasma proteins. A marked decrease in HDL particles is noted in the proband compared with the control subject.

HDL particle size was assessed by polyacrylamide gradient gel electrophoresis (PAGGE) as previously described.⁴³ The densitometric analysis of the HDL PAGGE reveals that the majority of HDL particles are small (in the range of HDL-12 to HDL-14⁴³ ). On the basis of the PAGGE analysis, the mean weighted HDL particle size was 8.30 nm for subject 24430-301 (case 1), 8.15 nm for subject 24430-313 (case 2), 8.14 nm for subject 24842-301 (case 3), and 8.16 nm for subject 24723-301 (case 4). The majority of HDL particles were therefore of small size corresponding to a weighted Stokes' diameter between 8.14 and 8.30 nm (Table 3).

View this table: [in this window] [in a new window]   Table 3. Densitometric Analysis of the HDL-Sizing Polyacrylamide Gel Electrophoresis

LCAT Activity
LCAT activity determined in the probands and their family members was normal, ie, >20 nmoL of free cholesterol esterified/mL · h^-1, except in two probands: 24430-301, who had an HDL-C of 0.18 mmol/L (range, 0.08 to 0.25 mmol/L), and 24430-313, who had an HDL-C of 0.13 mmol/L. These probands had LCAT activities of 19.9 and 19.2 nmoL/mL · h^-1, respectively, and their two brothers—24430-306, who had an HDL-C of 0.74 mmol/L, and 24430-309, who had an HDL-C of 0.40 mmol/L—had LCAT activities of 19.5 and 18.2 nmoL/mL · h^-1, respectively (Table 2).

Apo AI
The molecular weight of apo AI was determined on nondenaturing PAGGE. A sample from a normal control subject was always run in parallel with each patient's samples, and standard molecular weight markers (low–molecular weight standards, Bio-Rad) were loaded in a separate well. Each proband's apo AI moved the same distance as the control and the estimated molecular weight was 28.3 kD.

Isoelectrofocusing of the HDL proteins was performed as described in "Methods." A relative increase in proapolipoprotein AI was found in all cases. The percent concentration of proapolipoprotein AI was 40% for proband 24430-301, 20% for case 24430-313, and 26% for proband 24723-301. Based on the total apo AI concentration, the estimated concentration of proapolipoprotein AI in plasma was approximately 14.9 mg/dL, 6.4 mg/dL, and 18.5 mg/dL, respectively. These results indicate that the proapolipoprotein AI levels were approximately within the normal range. The mature form of the protein migrated at the same position as that of a control subject (Fig 3). The data show that the molecular weight of apo AI in probands was normal and the charge of the mature protein was also normal. The relative increase in proapolipoprotein AI was similar to that observed in patients with increased catabolism of HDL particles, as in patients with Tangier disease or other subjects with severe hypoalphalipoproteinemia of unknown causes.

View larger version (48K): [in this window] [in a new window]   Figure 3. Photograph shows isoelectrofocusing gel of HDL proteins. HDL fraction was obtained after sequential ultracentrifugation of plasma at densities 1.063 and 1.210 g/mL. Approximately 90 µg of HDL protein was loaded onto the polyacrylamide gel in the presence of ampholines (pH 4/6); electrophoresis was carried out as described in "Methods." Note that the proapolipoprotein AI band in proband 24430-301 represents approximately 40% of the total apo AI mass.

Molecular Genetics
Southern blot analysis of genomic DNA obtained from peripheral leukocytes was cleaved with the restriction enzymes Xmn I, Sst I, and Pst I. These restriction enzymes were chosen to identify possible gene rearrangements of the apo AI-CIII-AIV gene cluster on chromosome 11q23. In all cases, the RFLPs obtained revealed expected fragments. Cases 1 and 3 were heterozygous for the Xmn I RFLP (data not shown); cases 2 and 4 were homozygous for the frequent allele. No major gene rearrangement was found with the use of the RFLPs mentioned above.

Using Southern blot analysis, as well as RFLP data obtained from polymerase chain reaction for the enzymes Pst I, Sst I, and Xmn I, we carried out segregation analysis. Results for all kindreds are shown in Table 4. It is of interest that the affected brothers in kindred 24430 (301, 313) share at most one allele and are heterozygous for the Xmn I or Sst I RFLP. In addition, none of the haplotypes segregates with the low HDL trait in any of the three families. A similar analysis was performed with the apo AII Msp I RFLP. Again, no segregation was shown between the apo AII RFLP and the presence of a low HDL-C.

View this table: [in this window] [in a new window]   Table 4. Segregation Analysis and Genotyping

Analysis of the allelic variation at the LPL5GT locus⁵³ revealed three alleles varying from 112 to 120 bp in the three families. The genotypes of all family members are presented in Table 4. Four haplotypes were found in kindred 24430, only one in kindred 24842, and two in kindred 24723. No allelic association with low HDL-C appears in the three families.

We considered that a mutation within the promoter region of the apo AI gene could cause a decrease in transcriptional activation of the apo AI gene. We sequenced the immediate promoter of the apo AI gene in both alleles in the four probands as described in "Methods" (sequence data not shown). The sequence obtained in our patients was compared to previously published sequences for the apo AI gene.^{54 55} We identified a relatively common RFLP of the promoter region with a guanine-to-adenine substitution at position -76 from the transcriptional start site. This substitution has been previously reported and has been associated with hyperalphalipoproteinemia in a group of Italian women.⁵⁶ No association with a low HDL-C was identified in our study families.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
HDL Deficiency and CAD
Many studies have shown that HDL-C is the most frequent lipoprotein abnormality in subjects with premature CAD and that HDL-C may be the best discriminator between patients with CAD and control subjects in selected populations.^{2 3} During the past decade, considerable progress has been made in understanding HDL metabolism (as reviewed by Eisenberg⁵⁷ and Karathanasis⁵⁸ ). There are still unresolved issues concerning the relationship between isolated HDL deficiency and increased risk of CAD. In the three families we studied, a low HDL-C did not segregate with CAD, although it should be noted that kindred 24723 consisted mostly of relatively young adults. The proband and the siblings in kindred 24842 had CAD, but with no clear association with a low HDL-C; indeed, one sister with CAD had an HDL-C of 1.26 mmol/L. It is noteworthy that proband 24842-301 may have hyperapolipoproteinemia B, with multiple metabolic abnormalities, including elevated triglyceride levels (on several occasions), mildly elevated LDL-C levels, borderline diabetes (elevated fasting glucose level), and high blood pressure; in addition, he is also a cigarette smoker. This patient has multiple risk factors for CAD, and the severe hypoalphalipoproteinemia may be, at least in part, secondary to increased hepatic secretion of apo B and triglycerides. This patient therefore cannot be considered as having an isolated HDL deficiency.

Rare mutations of the apo AI gene that lead to the absence of apo AI have been described.^{9 10 12 13 16 59} Patients with mutations leading to a complete lack of apo AI have often been identified because of the presence of premature CAD. A recently described mutation, apo AIQ32X, has recently been characterized in an Italian kindred.⁵⁹ This mutation, AIGln32Stop, is caused by a single nucleotide substitution in exon 3 of the apo AI gene leading to a stop codon. It does not appear to be associated with CAD in the homozygous proband or in the heterozygous first-degree relatives.⁵⁹

Relatively uncommon mutations of apo AI were detected in a large screening program in which at least 17 mutations were uncovered.¹⁷ Most were not associated with altered HDL-C levels, but the apo AI_Milano and apo AI_Iowa mutations result in decreased HDL-C levels because of increased apo AI turnover rates.^{18 19 20}

Mutations affecting the lipoprotein processing enzyme LPL or its activator apo CII can cause severe hypertriglyceridemia and marked reductions in HDL-C levels²¹ but are usually not associated with CAD. LPL deficiency in the province of Québec, Canada, is relatively frequent, and three mutations, LPL188 (Gly to Glu), LPL207 (Pro to Leu), and LPL250 (Asp to Asn) account for 97% of cases of LPL deficiency in subjects of French-Canadian origin.²¹ None of our probands had these LPL mutations. In addition, a highly informative polymorphic GT dinucleotide repeat flanking the LPL gene⁵³ did not reveal segregation with low HDL-C levels. As discussed previously, mutations affecting the LCAT gene are also associated with severe HDL deficiency; the relationship with CAD is uncertain.

Tangier disease is a very rare disorder of severe hypoalphalipoproteinemia, characterized by markedly reduced HDL-C and apo AI levels, reticuloendothelial tissue infiltration by neutral lipids, neurological manifestations secondary to demyelination, and, in approximately half of affected subjects, premature CAD.²⁹

Initial reports suggested that common genetic polymorphisms of the apo AI gene are associated with alterations in HDL-C levels, but these associations were either population specific or failed to be confirmed in a large sample. In addition, RFLPs at the apo AI-CIII-AIV gene locus have been found in some studies, but not in others, to be associated with altered lipoprotein cholesterol levels. The strength of this association varies between studies but, so far, has been of little clinical significance in predicting lipoprotein cholesterol levels. Similarly, the association between RFLPs at the apo AI-CIII-AIV locus and the presence of CAD has not been substantiated (for review, see Reference 60⁶⁰ ).

Secondary causes of low HDL-C are thought to be the most common causes of hypoalphalipoproteinemia. The male sex, abdominal obesity, diabetes mellitus, cigarette smoking, and, especially, mild to moderate hypertriglyceridemia or an increase in apo B–containing lipoprotein particles⁴ are associated with decreased HDL-C levels. An inverse relationship between triglyceride levels and HDL-C has long been known.³ Although incompletely elucidated, the mechanism by which elevated triglyceride levels are associated with low HDL-C levels involves decreased phospholipid and neutral fat transfer onto nascent HDL particles from triglyceride-rich lipoproteins and subsequent enhanced catabolism of HDL particles. Some drugs decrease HDL-C levels; these include thiazide diuretics, ß-adrenergic blockers, and probucol, which is associated with marked reductions in HDL-C levels. Hospitalization may also be associated with mild, but significant, reductions in HDL-C levels.⁶¹

We have recently shown that most familial forms of hypoalphalipoproteinemia in subjects with CAD are associated with complex lipoprotein disorders, including familial combined hyperlipidemia, which is familial hypertriglyceridemia with reduced HDL-C; pure hypoalphalipoproteinemia is relatively uncommon.⁶² In all these familial syndromes, we have noted an increase in apo B levels, suggesting that the primary metabolic lipoprotein abnormality is hepatic oversecretion of apo B–containing particles.⁶³

Hypoalphalipoproteinemia and HDL Catabolism
Metabolic studies carried out in subjects with marked reductions in HDL-C levels have revealed that the catabolism of HDL particles and apo AI is markedly enhanced^{33 34 35 36 64} (for review, see Reference 65⁶⁵ ). In one proband, described by Emmerich et al,³⁴ the fractional catabolic rate of apo AI endogenously labeled with deuterated leucine was increased 10-fold over that in control subjects. Interestingly, the production rate was also decreased approximately threefold. Evidence from studies with radiolabeled HDL or apo AI and those with in vivo labeling by stable isotopes shows that many cases of severe hypoalphalipoproteinemia are associated with increased fractional catabolic rate of apo AI rather than decreased synthetic rate. The clinical characteristics of the patients reported in the aforementioned studies closely resemble those of the patients in the present study. No defects of the apo AI gene were found in these cases of familial hypoalphalipoproteinemia.⁶⁶ In conditions of HDL deficiency, as seen clinically, the catabolism of HDL particles is enhanced. According to kinetic data generated by Schaefer and Ordovas,⁶⁵ normal plasma HDL and apo AI residency times in normal individuals are approximately 4.1 to 6.6 days and 3.0 to 4.5 days, respectively. In contrast, HDL particles from patients with Tangier disease have an HDL protein residence time of 0.53 day and an apo AI residence time of 0.22 day. By use of the same techniques, residence time for apo AI is determined to be 2.9 days in type IV hyperlipidemia, 2.45 days in type I hyperlipidemia, and 2.51 days in type V hyperlipidemia. Several other groups have previously shown increased catabolism of HDL in subjects with hypoalphalipoproteinemia and in patients with apo AI mutations.^{33 34 35 36 64 67}

We hypothesize that the metabolic basis of these disorders may reside in abnormal intracellular cholesterol transfer onto HDL particles at the cell surface. Any defect involving intracellular cholesterol processing (for review, see Reference 68⁶⁸ ) could decrease the amount of cholesterol available for desorption at the cell surface. The mechanisms by which HDL particles take up cholesterol from the cell are not fully understood. One postulated mechanism involves the binding of HDL particles to a specific receptor, which would then promote the transfer of cholesterol from intracellular stores to the cell surface.^{58 69} Cholesterol accumulation would be prevented by decreased intracellular synthesis through the 3-hydroxy-3-methylglutaryl–coenzyme A reductase or the endocytosis of lipoprotein-derived cholesterol by means of the classical LDL receptor pathway.⁷⁰ The resultant HDL particle would be lipid depleted and presumably catabolized at a faster rate than larger, cholesterol-rich HDL particles. Our four probands had small HDL particles (Table 2). Li et al⁴³ have determined that the main determinant of HDL particle size is HDL-free cholesterol. This is an important observation; if free cholesterol (and not esterified cholesterol or triglycerides) is the main determinant of HDL particle size, it is possible that decreased cellular cholesterol efflux onto nascent HDL particles leads to the formation of small particles, as seen in our patients.

The recently characterized particle –lipoprotein E may offer insight into alternative mechanisms of cellular cholesterol efflux.⁷¹ If an alternative cholesterol efflux system exists independent of apo AI, it may offer some insight as to why a low HDL-C, even at extreme levels, is not associated with widespread arteriosclerosis. These cholesterol efflux mechanisms are still being characterized; their metabolic, cellular, and molecular characterization will yield considerable knowledge about the mechanisms of cholesterol efflux and of the cardioprotective effects of HDL particles.

Arteriosclerosis is a complex phenomenon; one must bear in mind that several other mechanisms, including the hemostatic system, endothelial cell function, cellular signaling, and immunological mechanisms, are involved.⁷¹ Although a low HDL-C has been associated with the development of arteriosclerosis, especially CAD, it is often in the context of multiple cardiovascular risk factors. It remains to be verified whether individuals who have a low HDL-C but who are nevertheless able to promote cholesterol efflux by means of an HDL- (or an apo AI-) independent pathway are at lower risk for CAD.

	Acknowledgments

 
This research was supported by a Medical Research Council of Canada scholarship to J. Genest Jr, MD; by an operating grant from the Medical Research Council of Canada; and by the Fonds de Recherche de l'Institut de Cardiologie de Montréal. The authors wish to express their gratitude to the nursing staff of the Lipid Clinics of the Montréal Heart Institute and Clinical Research Institute of Montréal, especially Francine Lemieux, RN, and Colette Rondeau, RN. The technical expertise of Michel Tremblay for the isoelectrofocusing gels, Judith McNamara and Zhengling Li, Boston, for the HDL sizing, and Paule Marchand for editorial assistance is gratefully acknowledged.

Received September 19, 1994; accepted May 8, 1995.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Miller NE. Associations of high density lipoprotein subclasses and apolipoproteins with ischemic heart disease and coronary atherosclerosis. Am Heart J. 1987;113:589-597. [Medline] [Order article via Infotrieve]

2. Stampfer MJ, Sacks FM, Salvini S, Willett WC, Hennekens CH. A prospective study of cholesterol, apolipoproteins, and the risk of myocardial infarction. N Engl J Med. 1991;325:373-381. [Abstract]

3. Genest J Jr, McNamara JR, Salem DN, Ordovas JM, Jenner JL, Millar JS, Silberman SR, Wilson PWF, Schaefer EJ. Lipoprotein cholesterol, apolipoproteins A-I and B, and lipoprotein(a) in men with premature coronary artery disease. J Am Coll Cardiol. 1992;19:782-802.

4. The Expert Panel. Summary of the second report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel II). JAMA. 1993;269:3015-3023. [Abstract/Free Full Text]

5. Miller M, Seidler A, Kwiterovich PO, Pearson TA. Long-term predictors of subsequent cardiovascular events with coronary artery disease and "desirable" levels of plasma total cholesterol. Circulation. 1992;86:1165-1170. [Abstract/Free Full Text]

6. Norum RA, Forte TM, Alaupovic P, Ginsberg HN. Clinical syndrome and lipid metabolism in hereditary deficiency of apolipoproteins A-I and C-III, variant I. Adv Exp Med Biol. 1986;201:137-149. [Medline] [Order article via Infotrieve]

7. Norum RA, Lakier JB, Goldstein S, Angel A, Goldberg RB, Block WD, Noffze DK, Dolphin PJ, Edelglass J, Borograd DD, Alaupovic P. Familial deficiency of apolipoproteins A-I and C-III and precocious coronary artery disease. N Engl J Med. 1982;306:1513-1519. [Abstract]

8. Schmitz G, Lackner K. High density lipoprotein deficiency with xanthomas: a defect in apo AI synthesis. In: Crepaldi et al, eds. Atherosclerosis VIII. Amsterdam, the Netherlands: Exerpta Medica, Elsevier Science Publishers; 1989:399-403.

9. Karathanasis SK, Ferris E, Haddad IA. DNA inversion within the apolipoproteins AI/CIII/AIV–encoding gene cluster of certain patients with premature atherosclerosis. Proc Natl Acad Sci U S A. 1987;84:7198-7202. [Abstract/Free Full Text]

10. Deeb SS, Cheung MC, Peng R, Wolf AC, Stern R, Albers JJ, Knopp RH. A mutation in the human apolipoprotein A-I gene: dominant effect on the level and characteristics of plasma high density lipoproteins. J Biol Chem. 1991;266:13654-13660. [Abstract/Free Full Text]

11. Lackner KJ, Dieplinger H, Nowicka G, Schmitz G. High density lipoprotein deficiency with xanthomas: a defect in reverse cholesterol transport caused by a point mutation in the apolipoprotein A-I gene. J Clin Invest. 1993;92:2262-2273.

12. Matsunaga T, Hiasa Y, Yanagi H, Maeda T, Hattori N, Yamakawa K, Yamanouchi Y, Tanaka I, Obara T, Hamaguchi H. Apolipoprotein A-I deficiency due to a codon 84 nonsense mutation of the apolipoprotein A-I gene. Proc Natl Acad Sci U S A. 1991;88:2793-2797. [Abstract/Free Full Text]

13. Ng DS, Leiter LA, Vezina C, Connelly PW, Hegele RA. Apolipoprotein A-I Q[-2]X causing isolated apolipoprotein AI deficiency in a family with analphalipoproteinemia. J Clin Invest. 1994;93:223-229.

14. Schaefer EJ, Heaton WH, Wetzel MG, Brewer HB Jr. Plasma apolipoprotein A-I absence associated with a marked reduction of high density lipoproteins and premature coronary artery disease. Arteriosclerosis. 1982;2:16-26. [Abstract/Free Full Text]

15. Schaefer EJ, Ordovas JM, Law SW, Ghiselli G, Kashyap ML, Srivastava LS, Heaton WH, Albers JJ, Connor WE, Lindgren FT, Lemeshev Y, Segrest JP, Brewer HB Jr. Familial apolipoprotein A-I and C-III deficiency, variant II. J Lipid Res. 1985;26:1089-1101. [Abstract]

16. Ordovas JM, Cassidy DK, Civeira F, Bisgaier CL, Schaefer EJ. Familial apolipoprotein A-I, C-III and A-IV deficiency and premature atherosclerosis due to deletion of a gene complex on chromosome 11. J Biol Chem. 1989;264:16339-16342. [Abstract/Free Full Text]

17. von Eckardstein A, Funke H, Walter M, Altland K, Benninghoven A, Assmann G. Structural analysis of human apolipoprotein A-I variants: amino acids substitutions are nonrandomly distributed throughout the apolipoprotein A-I primary structure. J Biol Chem. 1990;265:8610-8617. [Abstract/Free Full Text]

18. Weisgraber KH, Bersot TP, Mahley RW, Franceschini G, Sirtori CR. A-I_Milano apoprotein: isolation and characterization of a cysteine-containing variant of the A-I apoprotein from human high density lipoproteins. J Clin Invest. 1980;66:901-907.

19. Roma P, Gregg RE, Meng MS, Ronan R, Zech LA, Franceschini G, Sirtori CR, Brewer HB Jr. In vivo metabolism of a mutant form of apolipoprotein A-I, apo A-I_Milano, associated with hypoalphalipoproteinemia. J Clin Invest. 1993;91:1445-1452.

20. Rader DJ, Gregg RE, Meng MS, Schaefer JR, Zech LA, Benson MD, Brewer HB Jr. In vivo metabolism of a mutant apolipoprotein, apo AI_Iowa, associated with hypoalphalipoproteinemia and hereditary systemic amyloidosis. J Lipid Res. 1992;33:755-763. [Abstract]

21. Julien P, Gagne C, Ven Murthy MR, Cantin B, Cadelis F, Moorjani S, Lupien P-J. Mutations of the lipoprotein lipase gene as a cause of dyslipidemias in the Quebec population. Can J Cardiol. 1994;10:54b-60b.

22. Carlson LA. Fish-eye disease: a new familial condition with massive corneal opacities and dyslipoproteinemia. Eur J Clin Invest. 1982;12:41-53. [Medline] [Order article via Infotrieve]

23. Carlson LA, Holmquist L. Evidence for deficiency of high density lipoprotein lecithin:cholesterol acyltransferase activity (alpha-LCAT) in fish-eye disease. Acta Med Scand. 1985;218:189-196. [Medline] [Order article via Infotrieve]

24. Frohlich J, McLeod R, Pritchard PH, Fesmire J, McConathy W. Plasma lipoprotein abnormalities in heterozygotes for familial lecithin:cholesterol-acyltransferase deficiency. Metab Clin Exp. 1988;37:3-8.

25. Funke H, Von Eckardstein A, Pritchard PH, Karas M, Albers JJ, Assmann G. A frameshift mutation in the human apolipoprotein A-I gene causes high density lipoprotein deficiency, partial lecithin:cholesterol-acyltransferase deficiency, and corneal opacities. J Clin Invest. 1991;87:371-376.

26. Funke H, von Eckardstein A, Pritchard PH, Hornby AE, Wiebusch H, Motti C, Hayden MR, Dachet C, Jacotot B, Gerdes U, Faegeman O, Albers JJ, Colleoni N, Catapano A, Frohlich J, Assmann G. Genetic and phenotypic heterogeneity in familial lecithin:cholesterol acyltransferase (LCAT) deficiency: six newly identified defective alleles further contribute to the structural heterogeneity in this disease. J Clin Invest. 1993;91:677-683.

27. Glomset JA, Norum KR, Gjone E. Familial lecithin:cholesterol acyltransferase deficiency. In: Stanbury JB, Wyngaarden JB, Fredrickson DS, Goldstein JL, Brown MS, eds. The Metabolic Basis of Inherited Disease. New York, NY: McGraw-Hill Publishing Co; 1983:643-654.

28. Fredrickson DS, Altrocchi PH, Avioli LC. Tangier disease: combined clinical staff conference at the National Institutes of Health. Ann Intern Med. 1961;55:1016-1031. [Abstract/Free Full Text]

29. Serfaty-Lacrosniere C, Civiera F, Lanzberg A, Isaia P, Berg J, Janus ED, Smith MP, Pritchard PH, Frohlich J, Lees RS, Barnard GF, Ordovas JM, Schaefer EJ. Homozygous Tangier disease and cardiovascular disease. Atherosclerosis. 1994;107:85-98. [Medline] [Order article via Infotrieve]

30. Schaefer EJ, McNamara JR, Genest J, Ordovas JM. Genetic high density lipoprotein deficiency. In: Miller NE, ed. High Density Lipoproteins, Reverse Cholesterol Transport, and Coronary Heart Disease. Amsterdam, the Netherlands: Exerpta Medica, Elsevier Science Publishers; 1989.

31. Genest J Jr, McNamara JR, Salem DN, Cohn SD, Millar JS, Wilson PWF, Schaefer EJ. Prevalence of risk factors in men with premature coronary artery disease. Am J Cardiol. 1991;67:1185-1189. [Medline] [Order article via Infotrieve]

32. Gordon DJ, Knoke J, Probstfield JL, Superko R, Tyroler HA. High-density lipoprotein cholesterol and coronary heart disease in hypercholesterolemic men: the Lipid Research Clinics Coronary Primary Prevention Trial. Circulation. 1986;74:1217-1225. [Abstract/Free Full Text]

33. Brinton EA, Eisenberg S, Breslow JL. Increased apoA-I and apoA-II fractional catabolic rate in patients with low high density lipoprotein cholesterol levels with or without hypertriglyceridemia. J Clin Invest. 1991;87:536-544.

34. Emmerich J, Verges B, Tauveron I, Rader D, Sammarina-Fojo S, Schaefer J, Ayrault-Jarrier M, Thieblot P, Brewer HB Jr. Familial HDL deficiency due to marked hypercatabolism of normal apo AI. Arterioscler Thromb. 1993;13:1299-1306. [Abstract/Free Full Text]

35. Horowitz BS, Goldberg IJ, Merab J, Vanni TM, Ramakrishnan R, Ginsberg HN. Increased plasma and renal clearance of an exchangeable pool of apolipoproteins A-I in subjects with low levels of high density lipoprotein cholesterol. J Clin Invest. 1993;91:1743-1752.

36. Rader DJ, Ikewaki K, Duverger N, Feuerstein I, Zech L, Connor W, Brewer HB Jr. Very low high-density lipoproteins without coronary atherosclerosis. Lancet. 1993;342:1455-1458. [Medline] [Order article via Infotrieve]

37. Lipid Research Clinics Program. Manual of Laboratory Operations, Vol 1: Lipid and Lipoprotein Analysis. Washington, DC: US Dept of Health, Education, and Welfare; 1974:1-81; publication NIH 75-628.

38. Allain CE, Poon LS, Chan FCS, Richmond W, Fu PC. Enzymatic determination of total serum cholesterol. Clin Chem. 1974;20:470-475. [Abstract]

39. Sampson EH, Demers LM, Krieg AF. Faster enzymatic procedure for serum triglycerides. Clin Chem. 1975;21:1983-1985. [Abstract]

40. Gidez CI, Miller GJ, Burstein M, Slagle S, Eder HA. Separation and quantitation of subclasses of human plasma high density lipoproteins by a simple precipitation procedure. J Lipid Res. 1982;23:1206-1223. [Abstract]

41. Shumaker VN, Puppione DL. Sequential flotation ultracentrifugation. Methods Enzymol. 1986;128:155-170. [Medline] [Order article via Infotrieve]

42. Kelley JL, Kruski AW. Density gradient ultracentrifugation of serum lipoproteins in a swinging bucket rotor. Methods Enzymol. 1986;128:170-181. [Medline] [Order article via Infotrieve]

43. Li Z, McNamara JR, Ordovas JM, Schaefer EJ. Analysis of high density lipoproteins by a modified gradient gel electrophoresis method. J Lipid Res. 1994;35:1698-1711. [Abstract]

44. Fievet-Desreumaux GJ, Dedonder-Decoopman E, Dewailly P, Sezille G, Jaillard J. Immunochemical determination of human apolipoprotein AI by laser nephelometry. Clin Chim Acta. 1980;107:145-148. [Medline] [Order article via Infotrieve]

45. Fievet-Desreumaux GJ, Dedender-Decoopman E, Fruchart JC, Dewailly P, Sezille G. Immunochemical determination of human apolipoprotein B by laser nephelometry. Clin Chim Acta. 1979;95:405-408. [Medline] [Order article via Infotrieve]

46. Puchois P, Kandoussi A, Fievet P, Fourrier JL, Bertrand M, Koren E, Fruchart JC. Apolipoprotein A-I–containing lipoproteins in coronary artery disease. Atherosclerosis. 1992;68:35-40.

47. Genest J Jr, Bard J-M, Fruchart J-C, Ordovas JM, Wilson PWF, Schaefer EJ. Plasma apolipoprotein A-I, A-II, B, E, CIII containing particles in men with premature coronary artery disease. Atherosclerosis. 1991;90:149-157. [Medline] [Order article via Infotrieve]

48. Nichols AV, Krauss RM, Musliner TA. Nondenaturing polyacrylamide gradient gel electrophoresis. Methods Enzymol. 1986;128:417-431. [Medline] [Order article via Infotrieve]

49. Warnick GR, Mayfield C, Albers JJ, Hazzard WR. Gel isoelectric focusing method for specific diagnosis of familial hyperlipoproteinemia type III. Clin Chem. 1979;25:279-284. [Abstract/Free Full Text]

50. Kessling A, Ouellette S, Bouffard O, Chamberland A, Betard C, Selinger E, Xhignesse M, Lussier-Cacan S, Davignon J. Patterns of association between genetic variability in apolipoprotein (apo) B, apo AI-CIII-AIV, and cholesterol ester transfer protein gene regions and quantitative variation in lipid and lipoprotein traits: influence of gender and exogenous hormones. Am J Hum Genet. 1992;50:92-106. [Medline] [Order article via Infotrieve]

51. Shoulders CC, Narcisi TME, Jarmuz A, Brett DJ, Bayliss JD, Scott J. Characterization of genetic markers in the 5' flanking region of the apo AI gene. Hum Genet. 1993;91:197-198. [Medline] [Order article via Infotrieve]

52. Civeira F, Genest J Jr, Pocovi M, Salem DN, Herbert PN, Wilson PWF, Schaefer EJ, Ordovas JM. The MspI restriction fragment-length polymorphism 3' to the apolipoprotein A-II gene: relationships with lipids, apolipoproteins, and premature coronary artery disease. Atherosclerosis. 1992;92:165-176. [Medline] [Order article via Infotrieve]

53. Wood S, Schertzer M, Hayden M, Ma Y. Support for founder effect for two lipoprotein lipase (LPL) gene mutations in French Canadians by analysis of GT microsatellites flanking the LPL gene. Hum Genet. 1993;91:312-316. [Medline] [Order article via Infotrieve]

54. Karathanasis SK, Zannis VI, Breslow JL. Isolation and characterization of the human apolipoprotein A-I gene. Proc Natl Acad Sci U S A. 1983;80:6147-6151. [Abstract/Free Full Text]

55. Makrides SC, Ruiz-Opazo N, Hayden M, Nussbaum AL, Breslow JL, Zannis VI. Sequence and expression of Tangier A-I gene. Eur J Biochem. 1988;173:465-471. [Medline] [Order article via Infotrieve]

56. Pagani F, Sidoli A, Giudici GA, Barenghi L, Vergani C, Baralle FE. Human apolipoprotein A-I gene promoter polymorphism: association with hyperalphalipoproteinemia. J Lipid Res. 1990;31:1371-1377. [Abstract]

57. Eisenberg S. High density lipoprotein metabolism. J Lipid Res. 1984;25:1017-1058. [Medline] [Order article via Infotrieve]

58. Karathanasis SK. Lipoprotein metabolism: high density lipoproteins. In: Lusis AJ, Rotter RS, Sparkes RS, eds. Molecular Genetics of Coronary Artery Disease: Candidate Genes and Processes in Atherosclerosis. Monogr Hum Genet. Basel, Switzerland: Kruger; 1992;14:140-171.

59. Romling R, von Eckardstein A, Funke H, Motti C, Fragiacomo GC, Noseda G, Assmann G. A nonsense mutation in the apolipoprotein A-I gene is associated with high-density lipoprotein deficiency and periorbital xanthelasmas. Arterioscler Thromb. 1994;14:1915-1922. [Abstract/Free Full Text]

60. Marshall HW, Morrison LC, Wu LL, Anderson JL, Corneli PS, Stauffer DM, Allen A, Karagounis LA, Ward RH. Apolipoprotein polymorphisms fail to define risk of coronary artery disease: results of a prospective, angiographically controlled study. Circulation. 1994;89:567-577. [Abstract/Free Full Text]

61. Genest J Jr, McNamara JR, Ordovas JM, Martin-Munley S, Jenner JL, Millar J, Salem DN, Schaefer EJ. Effect of elective hospitalization on plasma lipoprotein cholesterol and apolipoproteins A-I, B and Lp(a). Am J Cardiol. 1990;65:677-679. [Medline] [Order article via Infotrieve]

62. Genest J Jr, Martin-Munley SS, McNamara JR, Ordovas JM, Jenner JL, Myers RH, Silberman SR, Wilson PWF, Salem DN, Schaefer EJ. Familial lipoprotein disorders in patients with premature coronary artery disease. Circulation. 1992;85:2025-2033. [Abstract/Free Full Text]

63. Genest J Jr, Bard J-M, Fruchart J-C, Ordovas JM, Schaefer EJ. Familial hypoalphalipoproteinemia in premature coronary artery disease. Arterioscler Thromb. 1993;13:1728-1737. [Abstract/Free Full Text]

64. Le NA, Ginsberg HN. Heterogeneity of apolipoprotein A-I turnover in subjects with reduced concentrations of plasma high density lipoprotein cholesterol. Metabolism. 1988;37:614-617. [Medline] [Order article via Infotrieve]

65. Schaefer EJ, Ordovas JM. Metabolism of apolipoproteins A-I, A-II and A-IV. Methods Enzymol. 1986;129:420-443. [Medline] [Order article via Infotrieve]

66. Kastelein JJP, Haines JL, Hayden MR. The gene causing familial hypoalphalipoproteinemia is not caused by a defect in the apo AI-CIII-AIV gene cluster in a Spanish family. Hum Genet. 1990;84:396-400. [Medline] [Order article via Infotrieve]

67. Cheung MC, Mendez AJ, Wolf AC, Knopp RH. Characterization of apolipoprotein A-I and A-II-containing lipoproteins in a new case of high density lipoprotein deficiency resembling Tangier disease and their effects on intracellular cholesterol efflux. J Clin Invest. 1993;91:522-529.

68. Liscum L, Dahl NK. Intracellular cholesterol transport. J Lipid Res. 1992;33:1239-1254. [Abstract]

69. Hokland B, Mendez AJ, Oram JF. Cellular localization and characterization of proteins that bind high density lipoprotein. J Lipid Res. 1992;33:1335-1342. [Abstract]

70. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature. 1990;343:425-430. [Medline] [Order article via Infotrieve]

71. Huang Y, von Eckardstein A, Wu S, Maeda N, Assman G. A plasma lipoprotein containing only apolipoprotein E and with mobility on electrophoresis releases cholesterol from cells. Proc Natl Acad Sci U S A. 1994;91:1834-1838.[Abstract/Free Full Text]

This article has been cited by other articles:

				S. Soderlund, A. Soro-Paavonen, C. Ehnholm, M. Jauhiainen, and M.-R. Taskinen Hypertriglyceridemia is associated with pre{beta}-HDL concentrations in subjects with familial low HDL J. Lipid Res., August 1, 2005; 46(8): 1643 - 1651. [Abstract] [Full Text] [PDF]

				C. Y. Lee, A. Lesimple, A. Larsen, O. Mamer, and J. Genest ESI-MS quantitation of increased sphingomyelin in Niemann-Pick disease type B HDL J. Lipid Res., June 1, 2005; 46(6): 1213 - 1228. [Abstract] [Full Text] [PDF]

				L. Krimbou, M. Marcil, H. Chiba, and J. Genest Jr. Structural and functional properties of human plasma high density-sized lipoprotein containing only apoE particles J. Lipid Res., May 1, 2003; 44(5): 884 - 892. [Abstract] [Full Text] [PDF]

				M. Marcil, R. Bissonnette, J. Vincent, L. Krimbou, and J. Genest Cellular Phospholipid and Cholesterol Efflux in High-Density Lipoprotein Deficiency Circulation, March 18, 2003; 107(10): 1366 - 1371. [Abstract] [Full Text] [PDF]

				B. Haidar, M. Denis, L. Krimbou, M. Marcil, and J. Genest Jr. cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts J. Lipid Res., December 1, 2002; 43(12): 2087 - 2094. [Abstract] [Full Text] [PDF]

				T. Oka, S. Yamashita, T. Kujiraoka, M. Ito, M. Nagano, Y. Sagehashi, T. Egashira, M. N. Nanjee, K.-i. Hirano, N. E. Miller, et al. Distribution of human plasma PLTP mass and activity in hypo- and hyperalphalipoproteinemia J. Lipid Res., August 1, 2002; 43(8): 1236 - 1243. [Abstract] [Full Text] [PDF]

				B. Haidar, S. Mott, B. Boucher, C. Y. Lee, M. Marcil, and J. Genest , Jr. Cellular cholesterol efflux is modulated by phospholipid-derived signaling molecules in familial HDL deficiency/Tangier disease fibroblasts J. Lipid Res., February 1, 2001; 42(2): 249 - 257. [Abstract] [Full Text]

				D. Sviridov, L. E. Pyle, M. Jauhiainen, C. Ehnholm, and N. H. Fidge Deletion of the propeptide of apolipoprotein A-I reduces protein expression but stimulates effective conversion of pre{beta}-high density lipoprotein to {alpha}-high density lipoprotein J. Lipid Res., November 1, 2000; 41(11): 1872 - 1882. [Abstract] [Full Text]

				M. Marcil, L. Yu, L. Krimbou, B. Boucher, J. F. Oram, J. S. Cohn, and J. Genest Jr Cellular Cholesterol Transport and Efflux in Fibroblasts Are Abnormal in Subjects With Familial HDL Deficiency Arterioscler. Thromb. Vasc. Biol., January 1, 1999; 19(1): 159 - 169. [Abstract] [Full Text] [PDF]

				M. Miller, D. Aiello, H. Pritchard, G. Friel, and K. Zeller Apolipoprotein A-IZavalla (Leu159->Pro) : HDL Cholesterol Deficiency in a Kindred Associated With Premature Coronary Artery Disease Arterioscler. Thromb. Vasc. Biol., August 1, 1998; 18(8): 1242 - 1247. [Abstract] [Full Text] [PDF]

				R. Batal, M. Tremblay, L. Krimbou, O. Mamer, J. Davignon, J. Genest Jr, and J. S. Cohn Familial HDL Deficiency Characterized by Hypercatabolism of Mature ApoA-I but Not ProApoA-I Arterioscler. Thromb. Vasc. Biol., April 1, 1998; 18(4): 655 - 664. [Abstract] [Full Text] [PDF]

				G. P. Eberhart, A. J. Mendez, and M. W. Freeman Decreased Cholesterol Efflux from Fibroblasts of a Patient without Tangier Disease, but with Markedly Reduced High Density Lipoprotein Cholesterol Levels J. Clin. Endocrinol. Metab., March 1, 1998; 83(3): 836 - 846. [Abstract] [Full Text]

				L. Krimbou, M. Marcil, J. Davignon, and J. Genest Jr. Interaction of Lecithin:Cholesterol Acyltransferase (LCAT){middle dot}alpha 2-Macroglobulin Complex with Low Density Lipoprotein Receptor-related Protein (LRP). EVIDENCE FOR AN alpha 2-MACROGLOBULIN/LRP RECEPTOR-MEDIATED SYSTEM PARTICIPATING IN LCAT CLEARANCE J. Biol. Chem., August 24, 2001; 276(35): 33241 - 33248. [Abstract] [Full Text] [PDF]

This Article Abstract Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Marcil, M. Articles by Genest, J. Search for Related Content PubMed PubMed Citation Articles by Marcil, M. Articles by Genest, J., Jr