This Article Abstract Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Weber, C. Articles by Weber, P. C. Search for Related Content PubMed PubMed Citation Articles by Weber, C. Articles by Weber, P. C.

(Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:622-628.)
© 1995 American Heart Association, Inc.

Articles

Docosahexaenoic Acid Selectively Attenuates Induction of Vascular Cell Adhesion Molecule–1 and Subsequent Monocytic Cell Adhesion to Human Endothelial Cells Stimulated by Tumor Necrosis Factor–

Christian Weber; Wolfgang Erl; Angelika Pietsch; Ulrich Danesch; Peter C. Weber

From the Institut für Prophylaxe der Kreislaufkrankheiten, Ludwig-Maximilians-Universität, München, Germany.

Correspondence to C. Weber, MD, Institut für Prophylaxe der Kreislaufkrankheiten, Pettenkoferstr 9, D-80336 München, Germany.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract Incorporation of the n-3 polyunsaturated fatty acid docosahexaenoic acid (DHA) but not eicosapentaenoic acid or n-6 arachidonic acid into human umbilical vein endothelial cell (HUVEC) phospholipids dose-dependently reduced tumor necrosis factor– (TNF-)–induced surface expression of vascular cell adhesion molecule–1 (VCAM-1). In parallel, DHA inhibited TNF-–stimulated monocytic U937 cell adhesion to HUVECs but did not affect TNF-– or interferon gamma–induced expression of intercellular adhesion molecule–1 and endothelial leukocyte adhesion molecule–1 or VCAM-1 induction by interleukin-1ß. DHA appeared to attenuate VCAM-1 transcription, as it reduced induction of VCAM-1 mRNA by TNF-. VCAM-1 induction is regulated by activation of nuclear factor–_kB, which can be mediated by a TNF-–responsive phosphatidylcholine-specific phospholipase C (PC-PLC). Gel-shift analysis showed inhibition of TNF-–induced nuclear factor–_kB mobilization by DHA. While the PC-PLC inhibitor D609 dose-dependently prevented VCAM-1 induction by TNF-, 1,2-diacyl-glycerol (DAG) stimulated VCAM-1 expression, suggesting that VCAM-1 induction by TNF- may be mediated by activation of PC-PLC. Treatment with DHA resulted in a fourfold enrichment in PC. In addition, DHA or D609 but not eicosapentaenoic acid or arachidonic acid suppressed activation of PC-PLC by TNF-, estimated as [¹⁴C]DAG synthesis in prelabeled HUVECs. Incorporation of DHA into phospholipids selectively attenuates VCAM-1 induction by TNF- and subsequent monocytic cell adhesion by inhibition of TNF-–stimulated PC-PLC activation in HUVECs.

Key Words: endothelial cell • polyunsaturated fatty acid • adhesion molecules • monocytic cell adhesion • tumor necrosis factor–

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The underlying mechanisms for beneficial effects attributed to n-3 polyunsaturated fatty acids (PUFAs)¹ include decreased plasma triglyceride and platelet aggregation and a shift in the eicosanoid balance to a vasodilatory state.² Moreover, n-3 PUFAs reduce excitation of cardiac myocytes³ and blood pressure responses to hormonal stimuli.⁴ Suppression of cytokine synthesis in mononuclear cells and of platelet-derived growth factor production in endothelial cells by n-3 PUFA^{5 6} may account for reduced smooth muscle cell proliferation and prevention of coronary intimal thickening by fish oil in animal models.⁷ In addition, fish oil inhibits stimulated leukocyte-endothelium interaction in vivo.⁸ However, pretreatment of polymorphonuclear cells with n-3 PUFA tends to enhance adhesion,⁹ suggesting an endothelial mechanism of action.

Monocyte recruitment into the vascular wall following adhesion to endothelium in response to various stimuli is an important step in the pathogenesis of atherosclerosis.¹⁰ PUFA incorporation into cellular phospholipids modulates physicochemical properties and activities of enzymes, receptors, or ion channels in the plasma membrane.^{4 11} To explore potential effects of n-3 PUFAs on cell adhesion, we investigated whether n-3 PUFAs affect cytokine-induced expression of endothelial cell adhesion molecules, in particular vascular cell adhesion molecule–1 (VCAM-1), which is involved in monocyte adhesion to endothelial cells.¹² We show that incorporation of docosahexaenoic acid (DHA) but not eicosapentaenoic acid (EPA) or arachidonic acid (AA) into human umbilical vein endothelial cell (HUVEC) phospholipids leads to selective attenuation of tumor necrosis factor– (TNF-)–induced VCAM-1 expression and subsequent monocytic cell adhesion. This appears to be due to reduced activation of phosphatidylcholine-specific phospholipase C (PC-PLC) by TNF-.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cell Culture
HUVECs were obtained from human umbilical cord veins by digestion with chymotrypsin and cultured in low-serum endothelial cell growth medium EGM (PromoCell) by using T-75 flasks precoated with collagen in a 5% CO₂ atmosphere at 37°C.¹³ HUVEC purity was assessed by morphology (cobblestone appearance) and factor VIII staining. Confluent HUVECs, passages 2 or 3, were detached by 0.01% trypsin/EDTA and grown in T-25 flasks for treatment with human recombinant TNF-1 (8.7x10⁶ U/mL in phosphate-buffered saline [PBS], kindly provided by BASF), interleukin 1ß (IL-1ß), interferon gamma (IFN-; Peprotech), DHA, EPA, AA, bovine serum albumin (BSA), 1,3- or 1,2-diacylglycerol (1,2-DAG), or tricyclodecan (D609, kindly provided by Dr S. Schütze) at indicated concentrations and periods. For flow cytometry and extractions HUVECs were harvested by careful treatment with 0.01% trypsin/EDTA antagonized by immediate addition of 10% fetal calf serum (FCS) and counted in triplicate. Under all conditions cell viability was >95% as judged by ethidium bromide–acridin orange fluorescence. Elevation of lactate dehydrogenase in supernatants was excluded. U937 cells were grown in RPMI-1640 medium (2 mmol/L L-glutamine and 10% FCS) in suspension.¹¹

PUFA Preparation
Free fatty acids (FFAs) were dissolved in ethanol, and NaOH (1N) was added until the respective sodium salts precipitated.¹¹ Ethanol was evaporated under nitrogen, and residual sodium salts were complexed with 2.5 mmol/L BSA to yield 5-mmol/L PUFA solutions. pH was adjusted to 7.4, and aliquots were stored in liquid nitrogen.

PUFA Analysis
Cells (10⁶) were washed in PBS, and the pellet was frozen. Cellular lipids were extracted with CH₃Cl/CH₃OH (2:1) containing 0.2% butylhydroxytoluene. Phospholipids were separated by elution of silicic acid columns (0.5 g; Unisil) with CH₃OH and CH₃OH/H₂O (99:1) after washing with CH₃Cl to separate triglycerides and FFAs. For analysis of phospholipid classes, samples were applied to aminopropyl cartridges.¹⁴ Neutral lipids and FFAs were eluted with CH₃Cl/isopropanol (2:1) and diethylether/acetic acid (98:2). PC was separated with acetonitrile/n-propanol (2:1) and phosphatidylethanolamine was eluted with CH₃OH. Fatty acid methylesters were prepared by transesterification of phospholipids with methanolic HCl (90°C, 1 hour) after addition of internal standards and were quantified by gas chromatography (Hewlett Packard 5980A) using a 2.5-mmx30-m fused-silica capillary column.¹¹ Carrier gas was helium at a flow rate of 1 mL/min. Injection port and flame ionization temperatures were 90°C and 200°C, respectively.

Immunofluorescence
Cells (2x10⁵) were treated for 30 minutes with saturating amounts of mouse anti–VCAM-1 monoclonal antibody (mAb) 1G11, anti–endothelial leukocyte adhesion molecule–1 (ELAM-1) mAb, anti–intercellular adhesion molecule–1 (ICAM-1) mAb 84H10 (Dianova), or IgG_1a isotype control (all from Camon) in PBS containing 0.5% BSA on ice. For staining, cells were reacted with goat anti-mouse fluorescein isothiocyanate–IgG_1a (Camon). Samples were washed twice with FACS buffer (Becton Dickinson), fixed in 2% paraformaldehyde, and analyzed with 10 000 cells/sample by a FACS (Becton Dickinson¹⁵ ). After correction for unspecific binding (isotype control), specific mean fluorescence intensity was expressed in channels on a log₁₀ scale.

U937 Cell Adhesion Assay
HUVECs were seeded in 24-well plates, and only confluent monolayers were used for stimulation with TNF- (10 U/mL). U937 cells (6x10⁶/mL) were incubated in RPMI-1640 medium (6 mL) containing 2% FCS and 10 µg/mL of the fluorescence dye BCECF/AM (Boehringer Mannheim) at 37°C for 30 minutes. Dye loading was stopped by adding 44 mL RPMI-1640 (2% FCS). Labeled cells were resuspended (10⁶/mL) in Medium 199 with 10 mmol/L HEPES buffer (M199H; GIBCO-BRL). HUVECs were washed with M199H before addition of loaded U937 cells and incubated (37°C, 5% CO₂, and 90% humidity). After 30 minutes, the U937 suspension was withdrawn, HUVECs were washed with M199H, and inverted plates were centrifuged at 50g for 5 minutes. Cells were lysed with 0.1% Triton X-100 in 0.1 mol/L Tris buffer, pH 8, and fluorescence was measured by a PTI deltascan spectrofluorometer (excitation at 485 nm, emission at 535 nm). Adherent cells/well were calculated by comparing the determined fluorescence to a standard curve of BCECF activity/cell, expressed as percent adhesion of added U937 cells/well.¹⁶

Reverse Transcription–Polymerase Chain Reaction
Total RNA was isolated from 10⁶ cells by extraction with phenol/chloroform/isoamylalcohol.¹⁶ cDNA was produced from 1 µg RNA by MULV reverse transcriptase (GIBCO-BRL). Primers were synthesized from regions with minimal homology to yield 441-bp products for VCAM-1 (sense GGAAGTGGAATTAATTAATTATCCAA, bp 1599 through 1622; antisense CTACACTTTTGATTTCTGTG, bp 2031 through 2040) or 540-bp products (sense GTGGGGCGCCCCAGGCACCA, bp 144 through 163; antisense CTCCTTAATGTCACGCACGATTTC, bp 660 through 683) for ß-actin. Aliquots of the same cDNA were amplified by 30 cycles using Taq polymerase in a thermocycler 480 (Perkin-Elmer Cetus) set at 95°C (30 seconds), 58°C (60 seconds), and 72°C (60 seconds). A dilution series of standard RNA confirmed that amplification of the cDNA amount used with both primer pairs was within the linear range at 32 cycles, using high-performance liquid chromatography and UV detection at 260 nm for cDNA quantification.¹⁶ A plateau was reached above 32 cycles. For semiquantitative analyses, polymerase chain reaction (PCR) products (20 µL) were applied to ethidium bromide–stained 1.5% agarose gels, separated by electrophoresis and of predicted lengths, as determined by comigration of molecular weight markers. UV-illuminated gels were photographed by using Polaroid 667 films.

Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared by ultrasound disruption of cell membranes followed by high-salt extraction with Dignam's buffer C and diluted with buffer D.¹⁷ Nuclear protein (10 µg) was mixed with a double-stranded oligonucleotide corresponding to a nuclear factor–_kB (NF-_kB) binding motif located -57 bp from the initiation site in the VCAM-1 promoter.¹⁸ It was synthesized according to the published sequence (5'TGAAGGGATTTCCC 3') and labeled with [³²P]dATP by using polynucleotide kinase. After binding for 15 minutes, samples were separated on nondenaturating 4% polyacrylamide gels and exposed to x-ray films.

Thin-Layer Chromatography
HUVECs (10⁶/mL) were labeled with L-lyso-PC-1-[¹⁴C] palmitoyl (1 µCi/mL; Amersham) for 2 hours in medium containing 2% BSA and stimulated with 100 U/mL TNF- for 1 minute in PBS. Stimulation was stopped by immersion of samples in CH₃OH/dry ice followed by centrifugation at 4°C. Cells were resuspended in hexane/isopropanol (3:2) and sonicated. Insoluble material was removed by centrifugation (2500g), supernatants were dried under nitrogen, and residues were dissolved in CH₃Cl/CH₃OH (2:1). Neutral lipids were separated by thin-layer chromatography by using a toluole/ethylacetate (65:35) solvent system. 1,2- and 1,3-DAG, 1-monoacylglycerol, triglycerides, and cholesterol were applied as standards and visualized by staining with 10% molybdatophosphoric acid. Plates were analyzed by gamma scanning and laser densitometry (Pharmacia). Amounts of cholesterol were used as an internal control for equal amounts of material loaded.

All other reagents were from Sigma.

Statistics
Data were analyzed by Student's t test using Bonferroni corrections where appropriate.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Incorporation of PUFAs Into Phospholipids
Incubation of HUVECs with PUFAs (20 µmol/L) for 24 hours significantly increased the content of the respective PUFAs in cellular phospholipids (Table 1). Treatment with PUFAs for 48 hours did not further enhance the content. Supplementation for 6 hours also resulted in effective incorporation, but incorporation was not complete after 3 hours (data not shown). DHA or EPA supplementation decreased AA content, while incubation with AA reduced DHA and EPA content in phospholipids, probably due to mutual replacement. Increased EPA content in DHA-treated HUVECs may follow retroconversion. No PUFA affected C18:2 phospholipid content.

View this table: [in this window] [in a new window]   Table 1. Incorporation of PUFAs Into Cellular Phospholipids

Effect of DHA on TNF-–Induced VCAM-1 Expression
VCAM-1 was not constitutively expressed but markedly upregulated by TNF- in HUVECs as assessed by flow cytometry (Fig 1). Pretreatment of HUVECs with DHA (20 µmol/L) for 24 hours reduced VCAM-1 protein expression stimulated by TNF- (50 U/mL, 12 hours) from 155±13 to 103±6 channels, reflecting a decrease in surface density of 40%. The effect of DHA was found to be dose dependent between 3 and 20 µmol/L, with an IC₅₀ of 9 µmol/L, with concentrations higher than 20 µmol/L being toxic. DHA caused comparable attenuation of VCAM-1 upregulation induced by 10 U/mL TNF-. Incorporation of EPA or the n-6 PUFA AA had no influence despite inverse effects on AA content (Fig 2). Hence, replacement of AA from cellular phospholipids is unlikely to be responsible for the action of DHA. While pretreatment with DHA (20 µmol/L) for 6 or 48 hours had similar effects, incubation for 3 hours was less potent, and sequential addition of DHA 6 hours after TNF- did not reduce VCAM-1 protein (not shown). The plateau reached at 6 hours paralleled DHA incorporation. Thus, DHA may modulate mechanisms of VCAM-1 induction rather than surface expression. In contrast, DHA did not affect basal ICAM-1 expression, ELAM-1 and ICAM-1 induction by TNF- (50 U/mL) or IFN- (100 U/mL), or VCAM-1 and ICAM-1 upregulation by IL-1ß (100 U/mL), excluding unspecific alteration of signal transduction or membrane functions (Table 2). None of the PUFAs tested changed molecule expression in unstimulated HUVECs (not shown). Induction of VCAM-1 but not ICAM-1 by TNF- is specifically regulated by mobilization of NF-_kB^{16 19} in HUVECs. The specificity of DHA for VCAM-1 induction in response to TNF- suggests that DHA may selectively alter pathways leading to NF-_kB activation by TNF-.

View larger version (23K): [in this window] [in a new window]   Figure 1. Effect of docosahexaenoic acid (DHA) on vascular cell adhesion molecule–1 (VCAM-1) induction by tumor necrosis factor– (TNF). Human umbilical vein endothelial cells were pretreated with bovine serum albumin (control; ——) or DHA (20 µmol/L; – – –) for 24 hours, stimulated with 50 U/mL TNF- for 12 hours, stained for VCAM-1 or isotype control (IC, reflecting unspecific binding; ...), and analyzed by flow cytometry. Shown are original histograms representing four similar experiments. Relative cell numbers (vertical) and fluorescence intensity (horizontal log10 scale) are indicated.

View larger version (61K): [in this window] [in a new window]   Figure 2. Bar graph showing effect of polyunsaturated fatty acids (PUFAs) on vascular cell adhesion molecule–1 (VCAM-1) induction by tumor necrosis factor– (TNF-). Human umbilical vein endothelial cells were pretreated with bovine serum albumin (control) or the indicated PUFA (20 µmol/L) for 24 hours, stimulated with 50 U/mL TNF- for 12 hours, stained for VCAM-1 or isotype control, and analyzed by flow cytometry. Data are expressed as specific mean fluorescence intensity (sMFI) corrected for unspecific binding in channels and represent mean±SD of four separate experiments performed in duplicate. DHA indicates docosahexaenoic acid; EPA, eicosapentaenoic acid; and AA, arachidonic acid. *P<.05 vs control.

View this table: [in this window] [in a new window]   Table 2. Effect of DHA on Adhesion Molecule Induction in HUVECs

DHA Inhibits VCAM-1–Dependent Monocytic Cell Adhesion to TNF-–Stimulated HUVECs
The functional relevance of modulated VCAM-1 induction by DHA was evident from the reduced adhesion of human premonocytic U937 cells to TNF-–treated HUVECs. Since U937 cells express the VCAM-1 ligand VLA-4, U937 adhesion to HUVECs is partly dependent on VCAM-1, as demonstrated by inhibition studies with blocking anti–VCAM-1 mAb 1G11 (Fig 3).¹⁶ Stimulation of HUVECs with TNF- (10 U/mL for 24 hours) enhanced U937 cell adhesion from 2.3±0.7% to 15.5±1.8% (n=4). In parallel to its effect on VCAM-1 surface induction, preincubation of HUVECs with DHA (20 µmol/L) attenuated TNF-–induced U937 adhesion to 73% (P<.05), suggesting that inhibition of adhesion by DHA is due to reduced VCAM-1 induction by TNF- in HUVECs. In contrast, AA or EPA had no effect (Fig 3).

View larger version (41K): [in this window] [in a new window]   Figure 3. Bar graph showing effect of polyunsaturated fatty acids (PUFAs) on U937 cell adhesion. Human umbilical vein endothelial cells were pretreated with PUFAs (20 µmol/L) or bovine serum albumin (control) for 24 hours and stimulated with 10 U/mL tumor necrosis factor– (TNF) for 12 hours. Adhesion of fluorescence-labeled U937 cells was determined after incubation with or without anti–vascular cell adhesion molecule–1 monoclonal antibody 1G11 (20 µg/mL) for 30 minutes by comparison to a standard curve. Data are expressed as percent adhesion of cells added and represent mean±SD of four separate experiments performed in triplicate. DHA indicates docosahexaenoic acid; EPA, eicosapentaenoic acid; and AA, arachidonic acid. *P<.05 vs control.

Effect of DHA on VCAM-1 mRNA Induction and NF-_kB Mobilization by TNF-
To further explore whether the mechanisms responsible for the inhibition of VCAM-1 induction by DHA are at the transcriptional level, we studied VCAM-1 mRNA expression using reverse transcription PCR. In unstimulated HUVECs VCAM-1 mRNA was hardly detectable, but TNF- (50 U/mL for 12 hours) induced a marked increase of specific VCAM-1 PCR products (Fig 4). In accordance with surface protein expression, TNF-–induced VCAM-1 transcripts were reduced by pretreatment with DHA (20 µmol/L) for 24 hours, while DHA alone had no effect. Neither TNF- nor DHA altered constitutive ß-actin transcription.

View larger version (57K): [in this window] [in a new window]   Figure 4. Human umbilical vein endothelial cells were pretreated with or without docosahexaenoic acid (DHA; 20 µmol/L) for 24 hours and stimulated with tumor necrosis factor– (TNF; 50 U/mL) for 12 hours. mRNA was extracted, reverse transcribed, and amplified by polymerase chain reaction (PCR) using specific primers for ß-actin and vascular cell adhesion molecule–1 (VCAM-1). PCR products (20 µL) or molecular-weight standards (M) were applied to ethidium bromide–stained 1.5% agarose gels and separated by electrophoresis. Shown is a photograph of a UV-illuminated gel representative of three similar experiments.

Subsequently, we investigated whether DHA (20 µmol/L) inhibited VCAM-1 gene transcription by blocking activation of NF-_kB. Gel-shift analyses demonstrated induction of NF-_kB–like DNA binding activity in response to 50 U/mL TNF- and a reduction of TNF-–stimulated NF-_kB mobilization by pretreatment of HUVECs with DHA for 24 hours (Fig 5). DHA alone had no effect. Competition studies with prototypic NF-_kB motifs and an irrelevant AP-1 motif revealed specific binding (not shown). These data indicate that DHA attenuates VCAM-1 induction by blocking NF-_kB activation and VCAM-1 transcription.

View larger version (45K): [in this window] [in a new window]   Figure 5. Electrophoretic mobility shift assay of nuclear proteins binding to the -57-bp nuclear factor (NF)–kB motif of the vascular cell adhesion molecule–1 (VCAM-1) promoter. Nuclear extracts from human umbilical vein endothelial cells pretreated with or without docosahexaenoic acid (DHA; 20 µmol/L) for 24 hours and stimulated with tumor necrosis factor– (TNF; 50 U/mL) for 1 hour were admixed with [32P]oligonucleotide derived from the -57-bp VCAM-1–NF-kB sequence and separated on a 4% nondenaturating polyacrylamide gel. Shown is one representative assay from three separate experiments.

Involvement of PC-PLC in VCAM-1 Induction by TNF-
NF-_kB activation can be triggered by a TNF-–responsive PC-PLC that is coupled to an acidic sphingomyelinase via 1,2-DAG generation.²⁰ Since VCAM-1 induction by TNF- requires NF-_kB mobilization in HUVECs,^{16 19} and DHA appeared to selectively inhibit this pathway, we used the specific and potent PC-PLC inhibitor D609²⁰ to study mechanisms of VCAM-1 induction by TNF-. Pretreatment of HUVECs with D609 (30 µg/mL) for 24 hours significantly (P<.01) reduced TNF- (50 U/mL for 12 hours)–stimulated induction of VCAM-1 (33±14 versus 142±16 channels, n=3; all data as mean±SD) but not ICAM-1 (289±34 versus 296±23). This reduction of specific mean fluorescence intensity reflected a 70% decrease in surface density of VCAM-1 protein. Inhibition was dose dependent, first evident at 3 µg/mL (110±17), more marked at 10 µg/mL (75±12), and maximal at 30 µg/mL of D609, with an IC₅₀ of approximately 8 µg/mL. Consistently, stimulation of HUVECs with 1,2-DAG but not 1,3-DAG (100 ng/mL for 12 hours) induced upregulation of VCAM-1 (39±4 versus 5±7, P<.01) but not ICAM-1 (56±13 versus 49±10). Taken together, our data suggest that VCAM-1 induction by TNF- may be mediated by PC-PLC activation. To assess DHA incorporation into the relevant phospholipid class, we determined PUFA composition in PC. Treatment with DHA (20 µmol/L for 24 hours) resulted in a fourfold enrichment in PC, while C18:2 and AA content were reduced. DHA content in phosphatidylethanolamine reached higher levels, but increased only twofold (Table 3). The marked incorporation into PC suggests that DHA may attenuate TNF-–induced VCAM-1 expression by modulating activities of specifically coupled receptors or enzymes catalyzing phospholipid breakdown in the plasma membrane, such as PC-PLC.

View this table: [in this window] [in a new window]   Table 3. Incorporation of DHA Into HUVEC Phospholipid Subclasses

Effect of DHA on TNF-–Stimulated Activation of PC-PLC
To further address the question of whether DHA incorporation into PC may exert a selective effect by inhibiting PC-PLC activation in HUVECs, we estimated [¹⁴C]DAG synthesis. Stimulation with TNF- (100 U/mL) for 60 seconds was performed under conditions that elicit maximal responses in U937 cells.²¹ The specific PC-PLC inhibitor D609 (30 µg/mL) completely prevented TNF-–stimulated [¹⁴C]DAG synthesis in HUVECs prelabeled with L-lyso-PC-1-[¹⁴C]palmitoyl (1 µCi/mL for 2 hours), indicating the relevance of PC-PLC activation by TNF-. Preincubation with DHA (20 µmol/L for 24 hours) but not AA or EPA reduced TNF-–induced [¹⁴C]DAG synthesis (Table 4), suggesting that inhibition of PC-PLC activation may be crucial for selective attenuation of VCAM-1 induction by DHA.

View this table: [in this window] [in a new window]   Table 4. Effect of PUFAs on PC-PLC Activation by TNF- in HUVECs Measured as [14C]DAG Synthesis

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Incorporation of the n-3 PUFA DHA but not EPA or the n-6 PUFA AA into phospholipids of HUVECs selectively attenuated TNF-–stimulated VCAM-1 expression, while ELAM-1 or ICAM-1 induction by TNF- or IFN- and upregulation of ICAM-1 and VCAM-1 by IL-1ß remained unaffected. In parallel, preincubation with DHA reduced VCAM-1–dependent adhesion of monocytic cells to TNF-–stimulated HUVECs, supporting a functional relevance of the biochemical changes. Pretreatment more than 3 hours before TNF- stimulation was necessary for optimal incorporation and activity of DHA, while addition of DHA 6 hours after TNF- had no effect. Hence, this effect appeared to be caused by inhibition of VCAM-1 induction mechanisms, not modulation of posttranslational modification, protein transport to the membrane, or persistent surface expression. Consistently, DHA pretreatment inhibited TNF-–induced mRNA expression in HUVECs, indicating regulation at the transcriptional level. The specific prevention by pyrrolidinedithiocarbamate of NF-_kB–mediated VCAM-1 induction and monocyte adhesion stimulated by TNF- indicated that VCAM-1 and in part ELAM-1 but not ICAM-1 induction requires mobilization of NF-_kB in HUVECs.¹⁹ Our data show that DHA is similarly selective for VCAM-1, suggesting that signal transduction involved in NF-_kB activation by TNF- was influenced by DHA incorporation. Accordingly, gel-shift analyses demonstrated that DHA attenuated TNF-–stimulated NF-_kB mobilization. Although NF-_kB motifs are present in the promoter regions of the ELAM-1 and ICAM-1 genes, their induction was not reduced by DHA. This could be explained by the finding that NF-_kB only partly controls ELAM-1 transcription,¹⁹ while other transcription factors, ie, AP-1 or SP-1, appear more essential for the regulation of ICAM-1 transcription.²⁰

PC-PLC has been implicated in TNF- receptor coupling to the acidic sphingomyelinase pathway in U937 cells, resulting in NF-_kB mobilization.²¹ Since the inhibitory DHA effect was restricted to NF-_kB–dependent VCAM-1 induction by TNF- but not other cytokines, we explored the role of PC-PLC activation for VCAM-1 upregulation by TNF- in endothelial cells. Indeed, inhibition studies with D609 indicated that TNF- may mediate VCAM-1 induction in HUVECs by activating a TNF-–responsive PC-PLC. Moreover, TNF- induced a 63% increase in DAG synthesis, which was highly significant although less pronounced than in U937 cells (120%).²¹ This may be due to different basal levels or detection of DAG in our system. Incubation of HUVECs with DHA increased its content in PC with a concurrent decrease of the n-6 PUFA AA and C18:2.

In accordance with VCAM-1 protein expression, DHA but not EPA or AA reduced TNF-–stimulated PC-PLC activation in HUVECs. Thus, DHA incorporation into PC may have an effect on enzyme activity, accounting for attenuation of VCAM-1 induction. Enrichment of DHA but not EPA in phospholipid subclasses, including alkyl-acyl-glycerophosphocholine, decreased the enzymatic activity crucial for eosinophilic generation of platelet-activating factor (PAF).²² The structure of PAF (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) is closely related to PC,²³ suggesting similar inhibitory mechanisms. Accordingly, preincubation with DHA but not AA inhibited PLC activation in platelets,²⁴ while dietary supplementation with n-3 PUFAs reduced eicosanoid formation and leukotriene B₄–induced chemotaxis by attenuating phosphatidylinositol-specific PLC in polymorphonuclear cells.²⁵

The induction of the endothelial cell adhesion molecules investigated and NF-_kB mobilization is under predominant control of the TNF- receptor R55.²⁶ Our results suggest that DHA causes selective inhibition of VCAM-1 upregulation by modulating the specific coupling of receptor subtypes to their effector systems rather than receptor expression or affinity. In parallel, it has been reported that DHA or its metabolites but not EPA reduced PAF-stimulated increases in intracellular Ca²⁺ without affecting expression of PAF binding sites.¹¹ We have recently shown that NF-_kB mobilization and VCAM-1 induction follow activation of radical generation by TNF- in HUVECs.¹⁶ Hence, DHA may alternatively act by suppressing superoxide anion production, as found after dietary n-3 PUFA supplementation in human peripheral blood mononuclear cells.²⁷ Taken together, the effects caused by DHA but not EPA may be due to preferential incorporation into crucial phospholipid pools or to specific structural requirements for inhibition of enzymes or receptors.

Monocyte recruitment into the vascular wall initiated by adhesion to endothelial cells in response to stimuli such as cytokines crucially contributes to atherogenesis or inflammatory reactions.^{10 28} Immunohistochemical staining revealed VCAM-1 expression in endothelial cells covering or extending beyond foam cell lesions in hyperlipidemic mice,²⁹ in areas of neovascularization or inflammatory infiltration in human coronary atherosclerotic plaques,³⁰ and after aortic balloon injury in rabbit vascular cells.³¹ TNF- secretion by smooth muscle cells or monocyte-derived macrophages³² may occur under conditions related to enhanced VCAM-1 expression. In conjunction with these findings, our data suggest that attenuation of TNF- responses, such as VCAM-1 upregulation and subsequent monocytic cell adhesion, by DHA concentrations achievable in vivo² provides a potential explanation for a preventive role of n-3 PUFAs in pathophysiological processes such as atherosclerosis and inflammation.

	Acknowledgments

 
This work was supported by grants from Deutsche Forschungsgemeinschaft (We 681), Bundesministerium für Forschung und Technologie (07ERG-03), and August-Lenz Stiftung and fulfills requirements for the doctoral theses of W.E. and A.P.

Received November 14, 1994; accepted February 13, 1995.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Leaf A, Weber PC. Cardiovascular effects of n-3 fatty acids. N Engl J Med. 1988;318:549-557.[Medline] [Order article via Infotrieve]

2. Von Schacky C, Fischer S, Weber PC. Long-term effects of dietary marine n-3 fatty acids upon plasma and cellular lipids, platelet function, and eicosanoid formation in humans. J Clin Invest. 1985;76:1626-1631.

3. Hallaq H, Smith TW, Leaf A. Modulation of dihydropyridine-sensitive calcium channels in heart cells by fish oil fatty acids. Proc Natl Acad Sci U S A. 1992;89:1760-1764. [Abstract/Free Full Text]

4. Lorenz R, Spengler U, Fischer S, Duhm J, Weber PC. Platelet function thromboxane formation and blood pressure control during supplementation of western diet with cod liver oil. Circulation. 1983;67:501-511.

5. Endres S, Ghorbani R, Kelley VE, Georgilis K, Lonnemann G, Van Der Meer JWM, Cannon JG, Rogers TS, Klempner MS, Weber PC, Schaffner EJ, Wolff SM, Dinarello CA. The effect of dietary supplementation with n-3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N Engl J Med. 1989;320:265-271. [Abstract]

6. Fox PL, Di Corleto PE. Fish oils inhibit endothelial cell production of platelet-derived growth factor-like protein. Science. 1988;241:453-456. [Abstract/Free Full Text]

7. Weiner BH, Ockene IS, Levine PH, Cuenoud HF, Fisher M, Johnson BF, Daoud AS, Jarmolych J, Hosmer D, Johnson MH, Natale A, Vaudreuil CH, Hoogasian JJ. Inhibition of atherosclerosis by cod liver oil in a hyperlipidemic swine model. N Engl J Med. 1986;315:841-846. [Abstract]

8. Lehr HA, Hübner C, Finck B, Nolte D, Beisiegel U, Kohlschutter B, Messmer K. Dietary fish oil reduces leukocyte/endothelium interaction following systemic administration of oxidatively modified low-density lipoprotein. Circulation. 1991;84:1725-1731. [Abstract/Free Full Text]

9. Bates EJ, Ferrante A, Harvey DP, Poulos A. Polyunsaturated fatty acids increase neutrophil adherence and integrin receptor expression. J Leukoc Biol. 1993;53:420-426. [Abstract]

10. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801-809. [Medline] [Order article via Infotrieve]

11. Weber C, Aepfelbacher M, Lux I, Zimmer B, Weber PC. Docosahexaenoic acid inhibits PAF and LTB₄ stimulated [Ca⁺⁺]_i-increase in differentiated monocytic U937 cells. Biochim Biophys Acta. 1991;1133:38-45. [Medline] [Order article via Infotrieve]

12. Carlos T, Kovach N, Schwartz B, Rosa M, Newman B, Wayner E, Benjamin C, Osborn L, Lobb R, Harlan J. Human monocytes bind to two cytokine-induced adhesive ligands on cultured human endothelial cells: endothelial-leukocyte adhesion molecule-1 and vascular cell adhesion molecule-1. Blood. 1991;77:2266-2271. [Abstract/Free Full Text]

13. Weber C, Kruse HJ, Sellmayer A, Erl W, Weber PC. Platelet activating factor enhances receptor-operated Ca⁺⁺-influx and subsequent prostacyclin-synthesis in human endothelial cells. Biochem Biophys Res Commun. 1993;195:874-880. [Medline] [Order article via Infotrieve]

14. Pietsch A, Lorenz R. Rapid separation of the major phospholipid classes on a single aminopropyl cartridge. Lipids. 1993;28:945-947.

15. Weber C, Aepfelbacher M, Haag H, Ziegler-Heitbrock HWL, Weber PC. Tumor necrosis factor induces enhanced responses to platelet activating factor and differentiation in human monocytic Mono Mac 6 cells. Eur J Immunol. 1993;23:852-859. [Medline] [Order article via Infotrieve]

16. Weber C, Erl W, Pietsch A, Ströbel M, Ziegler-Heitbrock HWL, Weber PC. Antioxidants inhibit monocyte adhesion by suppressing nuclear factor–_kB mobilization and induction of vascular cell adhesion molecule–1 in endothelial cells stimulated to generate radicals. Arterioscler Thromb. 1994;14:1665-1673. [Abstract/Free Full Text]

17. Ziegler-Heitbrock HWL, Sternsdorf T, Liese J, Belohradsky B, Weber C, Wedel A, Schreck R, Baeuerle PA, Ströbel M. Pyrrolidinedithiocarbamate inhibits NF-_kB mobilization and TNF production in human monocytes. J Immunol. 1993;151:6986-6993. [Abstract]

18. Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins T. Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med. 1992;176:1583-1593. [Abstract/Free Full Text]

19. Marui N, Offermann MK, Swerlick R, Kunsch C, Rosen CA, Ahmad M, Alexander RW, Medford RM. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J Clin Invest. 1993;92:1866-1874.

20. Vorarberger G, Schäfer R, Strotowa C. Cloning of the human gene for intercellular adhesion molecule 1 and analysis of its 5' regulatory region. J Immunol. 1991;147:2777-2786. [Abstract/Free Full Text]

21. Schütze S, Potthoff K, Machleidt T, Berkovic D, Wiegemann K, Krönke M. TNF activates NF-_kB by phosphatidyl-choline-specific phospholipase C-induced "acidic" sphingomyelin breakdown. Cell. 1992;71:765-776. [Medline] [Order article via Infotrieve]

22. Shikano M, Masuzawa Y, Yazawa K. Effect of docosahexaenoic acid on the generation of platelet-activating factor by eosinophilic leukemia cells. J Immunol. 1993;150:3525-3533. [Abstract]

23. Prescott SM, Zimmerman GA, McIntyre TM. Platelet activating factor. J Biol Chem. 1990;265:17381-17384. [Free Full Text]

24. Gaudette DC, Holub BJ. Albumin-bound docosahexaenoic acid and collagen-induced human platelet reactivity. Lipids. 1990;25:166-169. [Medline] [Order article via Infotrieve]

25. Sperling RI, Benincasco AJ, Knoell CT, Larkin JK, Austen KF, Robinson DR. Dietary omega-3 polyunsaturated fatty acids inhibit phosphoinositide formation and chemotaxis in neutrophils. J Clin Invest. 1993;92:651-660.

26. McKay F, Loetscher H, Stueber D, Gehr G, Lesslauer W. Tumor necrosis factor alpha-induced cell adhesion to human endothelial cells is under dominant control of one TNF receptor type, TNF-R55. J Exp Med. 1993;177:1277-1286. [Abstract/Free Full Text]

27. Fisher M, Upchurch KS, Levine PH, Johnson MH, Vandrenie CH, Hoogasian JJ. Dietary n-3 fish oil supplementation reduces superoxide anion production and chemoluminescence in a monocyte-enriched preparation of leukocytes. Am J Clin Nutr. 1990;51:804-808. [Abstract/Free Full Text]

28. Kuijpers TW, Harlan JM. Monocyte-endothelial interactions: insights and questions. J Lab Clin Invest. 1993;122:641-651.

29. Cybulsky MI, Gimbrone MA. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science. 1991;251:788-791. [Abstract/Free Full Text]

30. O'Brien KD, Allen MD, McDonald TO, Chait A, Harlan JM, Fishbein D, McCarty J, Ferguson M, Hudkins K, Benjamin CD, Lobb R, Alpers CE. Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques: implications of the mode of progression of advanced atherosclerosis. J Clin Invest. 1993;92:945-951.

31. Tanaka H, Sukhova GK, Swanson SJ, Clinton SK, Ganz P, Cybulsky MI, Libby P. Sustained activation of vascular cells and leukocytes in the rabbit after balloon injury. Circulation. 1993;88:1788-1803. [Abstract/Free Full Text]

32. Libby P, Hansson G. Involvement of the immune system in human atherogenesis: current knowledge and unanswered questions. Lab Invest. 1991;64:5-15.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				N. M. J. Schwerbrock, E. A. Karlsson, Q. Shi, P. A. Sheridan, and M. A. Beck Fish Oil-Fed Mice Have Impaired Resistance to Influenza Infection J. Nutr., August 1, 2009; 139(8): 1588 - 1594. [Abstract] [Full Text] [PDF]

				K. Mayer, A. Kiessling, J. Ott, M. B. Schaefer, M. Hecker, I. Henneke, R. Schulz, A. Gunther, J. Wang, L. Wu, et al. Acute Lung Injury Is Reduced in fat-1 Mice Endogenously Synthesizing n-3 Fatty Acids Am. J. Respir. Crit. Care Med., March 15, 2009; 179(6): 474 - 483. [Abstract] [Full Text] [PDF]

				L. Wang, R. Gill, T. L. Pedersen, L. J. Higgins, J. W. Newman, and J. C. Rutledge Triglyceride-rich lipoprotein lipolysis releases neutral and oxidized FFAs that induce endothelial cell inflammation J. Lipid Res., February 1, 2009; 50(2): 204 - 213. [Abstract] [Full Text] [PDF]

				M. E. Surette PhD The science behind dietary omega-3 fatty acids Can. Med. Assoc. J., January 15, 2008; 178(2): 177 - 180. [Full Text] [PDF]

				H. E. Theobald, A. H. Goodall, N. Sattar, D. C. S. Talbot, P. J. Chowienczyk, and T. A. B. Sanders Low-Dose Docosahexaenoic Acid Lowers Diastolic Blood Pressure in Middle-Aged Men and Women J. Nutr., April 1, 2007; 137(4): 973 - 978. [Abstract] [Full Text] [PDF]

				A. Ferrante, B. S. Robinson, H. Singh, H. P.A. Jersmann, J. V. Ferrante, Z. H. Huang, N. A. Trout, M. J. Pitt, D. A. Rathjen, C. J. Easton, et al. A Novel {beta}-Oxa Polyunsaturated Fatty Acid Downregulates the Activation of the I{kappa}B Kinase/Nuclear Factor {kappa}B Pathway, Inhibits Expression of Endothelial Cell Adhesion Molecules, and Depresses Inflammation Circ. Res., July 7, 2006; 99(1): 34 - 41. [Abstract] [Full Text] [PDF]

				C. A. Pfrommer, W. Erl, and P. C. Weber Docosahexaenoic acid induces ciap1 mRNA and protects human endothelial cells from stress-induced apoptosis Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2178 - H2186. [Abstract] [Full Text] [PDF]

				E. Lopez-Garcia, M. B. Schulze, J. E. Manson, J. B. Meigs, C. M. Albert, N. Rifai, W. C. Willett, and F. B. Hu Consumption of (n-3) Fatty Acids Is Related to Plasma Biomarkers of Inflammation and Endothelial Activation in Women J. Nutr., July 1, 2004; 134(7): 1806 - 1811. [Abstract] [Full Text]

				K. Mayer, S. Meyer, M. Reinholz-Muhly, U. Maus, M. Merfels, J. Lohmeyer, F. Grimminger, and W. Seeger Short-Time Infusion of Fish Oil-Based Lipid Emulsions, Approved for Parenteral Nutrition, Reduces Monocyte Proinflammatory Cytokine Generation and Adhesive Interaction with Endothelium in Humans J. Immunol., November 1, 2003; 171(9): 4837 - 4843. [Abstract] [Full Text] [PDF]

				B. Nohe, T. Johannes, H.-J. Dieterich, K. Mayer, M. Merfels, F. Grimminger, and W. Seeger Antiinflammatory effects of {omega}-3 fatty acids vary at different stages of inflammation Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2248 - H2250. [Full Text] [PDF]

				K. Mayer, M. Merfels, M. Muhly-Reinholz, S. Gokorsch, S. Rosseau, J. Lohmeyer, N. Schwarzer, M. Krull, N. Suttorp, F. Grimminger, et al. omega -3 Fatty acids suppress monocyte adhesion to human endothelial cells: role of endothelial PAF generation Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H811 - H818. [Abstract] [Full Text] [PDF]

				K. Mayer, R. Schmidt, M. Muhly-Reinholz, T. Bogeholz, S. Gokorsch, F. Grimminger, and W. Seeger In vitro mimicry of essential fatty acid deficiency in human endothelial cells by TNF{alpha} impact of {omega}-3 versus {omega}-6 fatty acids J. Lipid Res., June 1, 2002; 43(6): 944 - 951. [Abstract] [Full Text] [PDF]

				C. J. Field, I. R. Johnson, and P. D. Schley Nutrients and their role in host resistance to infection J. Leukoc. Biol., January 1, 2002; 71(1): 16 - 32. [Abstract] [Full Text] [PDF]

				M. Y Abeywardena and R. J Head Longchain n-3 polyunsaturated fatty acids and blood vessel function Cardiovasc Res, December 1, 2001; 52(3): 361 - 371. [Abstract] [Full Text] [PDF]

				A. A Brown and F. B Hu Dietary modulation of endothelial function: implications for cardiovascular disease Am. J. Clinical Nutrition, April 1, 2001; 73(4): 673 - 686. [Abstract] [Full Text] [PDF]

				R. De Caterina, J. K Liao, and P. Libby Fatty acid modulation of endothelial activation Am. J. Clinical Nutrition, January 1, 2000; 71(1): 213S - 223S. [Abstract] [Full Text] [PDF]

				M. A. Carluccio, M. Massaro, C. Bonfrate, L. Siculella, M. Maffia, G. Nicolardi, A. Distante, C. Storelli, and Raffaele De Caterina Oleic Acid Inhibits Endothelial Activation : A Direct Vascular Antiatherogenic Mechanism of a Nutritional Component in the Mediterranean Diet Arterioscler Thromb Vasc Biol, February 1, 1999; 19(2): 220 - 228. [Abstract] [Full Text] [PDF]

				R. De Caterina, W. Bernini, M. A. Carluccio, J. K. Liao, and P. Libby Structural requirements for inhibition of cytokine-induced endothelial activation by unsaturated fatty acids J. Lipid Res., May 1, 1998; 39(5): 1062 - 1070. [Abstract] [Full Text]

				K. Tschaikowsky, J. Schmidt, and M. Meisner Modulation of Mouse Endotoxin Shock by Inhibition of Phosphatidylcholine-Specific Phospholipase C J. Pharmacol. Exp. Ther., May 1, 1998; 285(2): 800 - 804. [Abstract] [Full Text]

				Z. H. Huang, E. J. Bates, J. V. Ferrante, C. S.T. Hii, A. Poulos, B. S. Robinson, and A. Ferrante Inhibition of Stimulus-Induced Endothelial Cell Intercellular Adhesion Molecule-1, E-Selectin, and Vascular Cellular Adhesion Molecule-1 Expression by Arachidonic Acid and Its Hydroxy and Hydroperoxy Derivatives Circ. Res., February 1, 1997; 80(2): 149 - 158. [Abstract] [Full Text]

This Article Abstract Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Weber, C. Articles by Weber, P. C. Search for Related Content PubMed PubMed Citation Articles by Weber, C. Articles by Weber, P. C.