Articles |
From the Institut für Prophylaxe der Kreislaufkrankheiten, Ludwig-Maximilians-Universität, München, Germany.
Correspondence to C. Weber, MD, Institut für Prophylaxe der Kreislaufkrankheiten, Pettenkoferstr 9, D-80336 München, Germany.
| Abstract |
|---|
|
|
|---|
(TNF-
)induced surface expression of vascular cell adhesion
molecule1 (VCAM-1). In parallel, DHA inhibited TNF-
stimulated
monocytic U937 cell adhesion to HUVECs but did not affect TNF-
or
interferon gammainduced expression of intercellular adhesion
molecule1 and endothelial leukocyte adhesion molecule1 or VCAM-1
induction by interleukin-1ß. DHA appeared to attenuate VCAM-1
transcription, as it reduced induction of VCAM-1 mRNA by TNF-
.
VCAM-1 induction is regulated by activation of nuclear
factorkB, which can be mediated by a TNF-
responsive
phosphatidylcholine-specific phospholipase C (PC-PLC). Gel-shift
analysis showed inhibition of TNF-
induced nuclear
factorkB mobilization by DHA. While the PC-PLC inhibitor
D609 dose-dependently prevented VCAM-1 induction by TNF-
,
1,2-diacyl-glycerol (DAG) stimulated VCAM-1 expression, suggesting that
VCAM-1 induction by TNF-
may be mediated by activation of PC-PLC.
Treatment with DHA resulted in a fourfold enrichment in PC. In
addition, DHA or D609 but not eicosapentaenoic acid or arachidonic acid
suppressed activation of PC-PLC by TNF-
, estimated as
[14C]DAG synthesis in prelabeled HUVECs. Incorporation of
DHA into phospholipids selectively attenuates VCAM-1 induction by
TNF-
and subsequent monocytic cell adhesion by inhibition of
TNF-
stimulated PC-PLC activation in HUVECs.
Key Words: endothelial cell polyunsaturated fatty acid adhesion molecules monocytic cell adhesion tumor necrosis factor
| Introduction |
|---|
|
|
|---|
Monocyte recruitment into the vascular wall following adhesion to
endothelium in response to various stimuli is an important step in the
pathogenesis of atherosclerosis.10 PUFA incorporation into
cellular phospholipids modulates physicochemical properties and
activities of enzymes, receptors, or ion channels in the plasma
membrane.4 11 To explore potential effects of n-3 PUFAs on
cell adhesion, we investigated whether n-3 PUFAs affect
cytokine-induced expression of endothelial cell adhesion molecules, in
particular vascular cell adhesion molecule1 (VCAM-1), which is
involved in monocyte adhesion to endothelial cells.12 We
show that incorporation of docosahexaenoic acid (DHA) but not
eicosapentaenoic acid (EPA) or arachidonic acid (AA) into human
umbilical vein endothelial cell (HUVEC) phospholipids leads to
selective attenuation of tumor necrosis factor
(TNF-
)induced
VCAM-1 expression and subsequent monocytic cell adhesion. This appears
to be due to reduced activation of phosphatidylcholine-specific
phospholipase C (PC-PLC) by TNF-
.
| Methods |
|---|
|
|
|---|
(8.7x106 U/mL in
phosphate-buffered saline [PBS], kindly provided by BASF),
interleukin 1ß (IL-1ß), interferon gamma (IFN-
; Peprotech), DHA,
EPA, AA, bovine serum albumin (BSA), 1,3- or 1,2-diacylglycerol
(1,2-DAG), or tricyclodecan (D609, kindly provided by Dr S.
Schütze) at indicated concentrations and periods. For flow
cytometry and extractions HUVECs were harvested by careful treatment
with 0.01% trypsin/EDTA antagonized by immediate addition of 10%
fetal calf serum (FCS) and counted in triplicate. Under all conditions
cell viability was >95% as judged by ethidium bromideacridin orange
fluorescence. Elevation of lactate dehydrogenase in supernatants was
excluded. U937 cells were grown in RPMI-1640 medium (2 mmol/L
L-glutamine and 10% FCS) in suspension.11
PUFA Preparation
Free fatty acids (FFAs) were dissolved in ethanol, and NaOH (1N)
was added until the respective sodium salts
precipitated.11 Ethanol was evaporated under nitrogen, and
residual sodium salts were complexed with 2.5 mmol/L BSA to yield
5-mmol/L PUFA solutions. pH was adjusted to 7.4, and aliquots were
stored in liquid nitrogen.
PUFA Analysis
Cells (106) were washed in PBS, and the
pellet was frozen. Cellular lipids were extracted with
CH3Cl/CH3OH (2:1) containing 0.2%
butylhydroxytoluene. Phospholipids were separated by elution of silicic
acid columns (0.5 g; Unisil) with CH3OH and
CH3OH/H2O (99:1) after washing with
CH3Cl to separate triglycerides and FFAs. For analysis
of phospholipid classes, samples were applied to aminopropyl
cartridges.14 Neutral lipids and FFAs were eluted with
CH3Cl/isopropanol (2:1) and diethylether/acetic acid
(98:2). PC was separated with acetonitrile/n-propanol (2:1)
and phosphatidylethanolamine was eluted with CH3OH. Fatty
acid methylesters were prepared by transesterification of
phospholipids with methanolic HCl (90°C, 1 hour) after addition of
internal standards and were quantified by gas chromatography (Hewlett
Packard 5980A) using a 2.5-mmx30-m fused-silica capillary
column.11 Carrier gas was helium at a flow rate of 1
mL/min. Injection port and flame ionization temperatures were 90°C
and 200°C, respectively.
Immunofluorescence
Cells (2x105) were treated for 30 minutes with
saturating amounts of mouse antiVCAM-1 monoclonal antibody (mAb)
1G11, antiendothelial leukocyte adhesion molecule1 (ELAM-1)
mAb, antiintercellular adhesion molecule1 (ICAM-1) mAb 84H10
(Dianova), or IgG1a isotype control (all from Camon) in PBS
containing 0.5% BSA on ice. For staining, cells were reacted with goat
anti-mouse fluorescein isothiocyanateIgG1a (Camon).
Samples were washed twice with FACS buffer (Becton Dickinson), fixed in
2% paraformaldehyde, and analyzed with 10 000 cells/sample by a FACS
(Becton Dickinson15 ). After correction for unspecific
binding (isotype control), specific mean fluorescence intensity was
expressed in channels on a log10 scale.
U937 Cell Adhesion Assay
HUVECs were seeded in 24-well plates, and only confluent
monolayers were used for stimulation with TNF-
(10 U/mL). U937 cells
(6x106/mL) were incubated in RPMI-1640
medium (6 mL) containing 2% FCS and 10 µg/mL of the fluorescence dye
BCECF/AM (Boehringer Mannheim) at 37°C for 30 minutes. Dye loading
was stopped by adding 44 mL RPMI-1640 (2% FCS). Labeled cells were
resuspended (106/mL) in Medium 199 with 10
mmol/L HEPES buffer (M199H; GIBCO-BRL). HUVECs were washed with M199H
before addition of loaded U937 cells and incubated (37°C, 5%
CO2, and 90% humidity). After 30 minutes, the U937
suspension was withdrawn, HUVECs were washed with M199H, and inverted
plates were centrifuged at 50g for 5 minutes. Cells were
lysed with 0.1% Triton X-100 in 0.1 mol/L Tris buffer, pH 8, and
fluorescence was measured by a PTI deltascan spectrofluorometer
(excitation at 485 nm, emission at 535 nm). Adherent cells/well were
calculated by comparing the determined fluorescence to a standard curve
of BCECF activity/cell, expressed as percent adhesion of added U937
cells/well.16
Reverse TranscriptionPolymerase Chain Reaction
Total RNA was isolated from 106 cells by
extraction with phenol/chloroform/isoamylalcohol.16 cDNA
was produced from 1 µg RNA by MULV reverse transcriptase (GIBCO-BRL).
Primers were synthesized from regions with minimal homology to yield
441-bp products for VCAM-1 (sense GGAAGTGGAATTAATTAATTATCCAA, bp 1599
through 1622; antisense CTACACTTTTGATTTCTGTG, bp 2031 through 2040) or
540-bp products (sense GTGGGGCGCCCCAGGCACCA, bp 144 through 163;
antisense CTCCTTAATGTCACGCACGATTTC, bp 660 through 683) for ß-actin.
Aliquots of the same cDNA were amplified by 30 cycles using
Taq polymerase in a thermocycler 480 (Perkin-Elmer Cetus)
set at 95°C (30 seconds), 58°C (60 seconds), and 72°C (60
seconds). A dilution series of standard RNA confirmed that
amplification of the cDNA amount used with both primer pairs was within
the linear range at 32 cycles, using high-performance liquid
chromatography and UV detection at 260 nm for cDNA
quantification.16 A plateau was reached above 32 cycles.
For semiquantitative analyses, polymerase chain reaction (PCR) products
(20 µL) were applied to ethidium bromidestained 1.5% agarose gels,
separated by electrophoresis and of predicted lengths, as determined by
comigration of molecular weight markers. UV-illuminated gels were
photographed by using Polaroid 667 films.
Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared by ultrasound disruption of cell
membranes followed by high-salt extraction with Dignam's buffer C and
diluted with buffer D.17 Nuclear protein (10 µg) was
mixed with a double-stranded oligonucleotide corresponding to a nuclear
factorkB (NF-kB) binding motif located -57
bp from the initiation site in the VCAM-1 promoter.18 It
was synthesized according to the published sequence
(5'TGAAGGGATTTCCC 3') and labeled with [32P]dATP by
using polynucleotide kinase. After binding for 15 minutes, samples were
separated on nondenaturating 4% polyacrylamide gels and exposed to
x-ray films.
Thin-Layer Chromatography
HUVECs (106/mL) were labeled with
L-lyso-PC-1-[14C] palmitoyl (1 µCi/mL;
Amersham) for 2 hours in medium containing 2% BSA and stimulated with
100 U/mL TNF-
for 1 minute in PBS. Stimulation was stopped by
immersion of samples in CH3OH/dry ice followed by
centrifugation at 4°C. Cells were resuspended in hexane/isopropanol
(3:2) and sonicated. Insoluble material was removed by centrifugation
(2500g), supernatants were dried under nitrogen, and
residues were dissolved in CH3Cl/CH3OH (2:1).
Neutral lipids were separated by thin-layer chromatography by using a
toluole/ethylacetate (65:35) solvent system. 1,2- and 1,3-DAG,
1-monoacylglycerol, triglycerides, and cholesterol were applied as
standards and visualized by staining with 10%
molybdatophosphoric acid. Plates were analyzed by gamma scanning
and laser densitometry (Pharmacia). Amounts of cholesterol were used as
an internal control for equal amounts of material loaded.
All other reagents were from Sigma.
Statistics
Data were analyzed by Student's t test using
Bonferroni corrections where appropriate.
| Results |
|---|
|
|
|---|
|
Effect of DHA on TNF-
Induced VCAM-1 Expression
VCAM-1 was not constitutively expressed but markedly
upregulated by TNF-
in HUVECs as assessed by flow cytometry (Fig 1
). Pretreatment of HUVECs with DHA (20 µmol/L) for 24
hours reduced VCAM-1 protein expression stimulated by TNF-
(50 U/mL,
12 hours) from 155±13 to 103±6 channels, reflecting a decrease in
surface density of 40%. The effect of DHA was found to be dose
dependent between 3 and 20 µmol/L, with an IC50 of 9
µmol/L, with concentrations higher than 20 µmol/L being toxic. DHA
caused comparable attenuation of VCAM-1 upregulation induced by 10 U/mL
TNF-
. Incorporation of EPA or the n-6 PUFA AA had no influence
despite inverse effects on AA content (Fig 2
). Hence,
replacement of AA from cellular phospholipids is unlikely to be
responsible for the action of DHA. While pretreatment with DHA (20
µmol/L) for 6 or 48 hours had similar effects, incubation for 3 hours
was less potent, and sequential addition of DHA 6 hours after TNF-
did not reduce VCAM-1 protein (not shown). The plateau reached at 6
hours paralleled DHA incorporation. Thus, DHA may modulate mechanisms
of VCAM-1 induction rather than surface expression. In contrast, DHA
did not affect basal ICAM-1 expression, ELAM-1 and ICAM-1 induction by
TNF-
(50 U/mL) or IFN-
(100 U/mL), or VCAM-1 and ICAM-1
upregulation by IL-1ß (100 U/mL), excluding unspecific alteration of
signal transduction or membrane functions (Table 2
).
None of the PUFAs tested changed molecule expression in unstimulated
HUVECs (not shown). Induction of VCAM-1 but not ICAM-1 by TNF-
is
specifically regulated by mobilization of
NF-kB16 19 in HUVECs. The specificity of DHA
for VCAM-1 induction in response to TNF-
suggests that DHA may
selectively alter pathways leading to NF-kB activation by
TNF-
.
|
|
|
DHA Inhibits VCAM-1Dependent Monocytic Cell Adhesion to
TNF-
Stimulated HUVECs
The functional relevance of modulated VCAM-1 induction by
DHA was evident from the reduced adhesion of human premonocytic U937
cells to TNF-
treated HUVECs. Since U937 cells express the
VCAM-1 ligand VLA-4, U937 adhesion to HUVECs is partly dependent on
VCAM-1, as demonstrated by inhibition studies with blocking
antiVCAM-1 mAb 1G11 (Fig 3
).16
Stimulation of HUVECs with TNF-
(10 U/mL for 24 hours) enhanced U937
cell adhesion from 2.3±0.7% to 15.5±1.8% (n=4). In parallel to its
effect on VCAM-1 surface induction, preincubation of HUVECs with DHA
(20 µmol/L) attenuated TNF-
induced U937 adhesion to 73%
(P<.05), suggesting that inhibition of adhesion by DHA is
due to reduced VCAM-1 induction by TNF-
in HUVECs. In contrast, AA
or EPA had no effect (Fig 3
).
|
Effect of DHA on VCAM-1 mRNA Induction and NF-kB
Mobilization by TNF-
To further explore whether the mechanisms responsible for the
inhibition of VCAM-1 induction by DHA are at the transcriptional level,
we studied VCAM-1 mRNA expression using reverse transcription PCR. In
unstimulated HUVECs VCAM-1 mRNA was hardly detectable, but TNF-
(50
U/mL for 12 hours) induced a marked increase of specific VCAM-1 PCR
products (Fig 4
). In accordance with surface protein
expression, TNF-
induced VCAM-1 transcripts were reduced by
pretreatment with DHA (20 µmol/L) for 24 hours, while DHA alone had
no effect. Neither TNF-
nor DHA altered constitutive ß-actin
transcription.
|
Subsequently, we investigated whether DHA (20 µmol/L) inhibited
VCAM-1 gene transcription by blocking activation of NF-kB.
Gel-shift analyses demonstrated induction of NF-kBlike
DNA binding activity in response to 50 U/mL TNF-
and a reduction of
TNF-
stimulated NF-kB mobilization by pretreatment of
HUVECs with DHA for 24 hours (Fig 5
). DHA alone had no
effect. Competition studies with prototypic NF-kB motifs
and an irrelevant AP-1 motif revealed specific binding (not shown).
These data indicate that DHA attenuates VCAM-1 induction by blocking
NF-kB activation and VCAM-1 transcription.
|
Involvement of PC-PLC in VCAM-1 Induction by TNF-
NF-kB activation can be triggered by a
TNF-
responsive PC-PLC that is coupled to an acidic
sphingomyelinase via 1,2-DAG generation.20 Since VCAM-1
induction by TNF-
requires NF-kB mobilization in
HUVECs,16 19 and DHA appeared to selectively inhibit this
pathway, we used the specific and potent PC-PLC inhibitor
D60920 to study mechanisms of VCAM-1 induction by TNF-
.
Pretreatment of HUVECs with D609 (30 µg/mL) for 24 hours
significantly (P<.01) reduced TNF-
(50 U/mL for 12
hours)stimulated induction of VCAM-1 (33±14 versus 142±16 channels,
n=3; all data as mean±SD) but not ICAM-1 (289±34 versus 296±23).
This reduction of specific mean fluorescence intensity reflected a 70%
decrease in surface density of VCAM-1 protein. Inhibition was dose
dependent, first evident at 3 µg/mL (110±17), more marked at 10
µg/mL (75±12), and maximal at 30 µg/mL of D609, with an
IC50 of approximately 8 µg/mL. Consistently, stimulation
of HUVECs with 1,2-DAG but not 1,3-DAG (100 ng/mL for 12 hours) induced
upregulation of VCAM-1 (39±4 versus 5±7, P<.01) but not
ICAM-1 (56±13 versus 49±10). Taken together, our data suggest that
VCAM-1 induction by TNF-
may be mediated by PC-PLC activation. To
assess DHA incorporation into the relevant phospholipid class, we
determined PUFA composition in PC. Treatment with DHA (20 µmol/L for
24 hours) resulted in a fourfold enrichment in PC, while C18:2 and AA
content were reduced. DHA content in phosphatidylethanolamine reached
higher levels, but increased only twofold (Table 3
). The
marked incorporation into PC suggests that DHA may attenuate
TNF-
induced VCAM-1 expression by modulating activities of
specifically coupled receptors or enzymes catalyzing phospholipid
breakdown in the plasma membrane, such as PC-PLC.
|
Effect of DHA on TNF-
Stimulated Activation of PC-PLC
To further address the question of whether DHA incorporation into
PC may exert a selective effect by inhibiting PC-PLC activation in
HUVECs, we estimated [14C]DAG synthesis. Stimulation with
TNF-
(100 U/mL) for 60 seconds was performed under conditions that
elicit maximal responses in U937 cells.21 The specific
PC-PLC inhibitor D609 (30 µg/mL) completely prevented
TNF-
stimulated [14C]DAG synthesis in HUVECs
prelabeled with L-lyso-PC-1-[14C]palmitoyl (1
µCi/mL for 2 hours), indicating the relevance of PC-PLC activation by
TNF-
. Preincubation with DHA (20 µmol/L for 24 hours) but not AA
or EPA reduced TNF-
induced [14C]DAG synthesis (Table 4
), suggesting that inhibition of PC-PLC activation may
be crucial for selective attenuation of VCAM-1 induction by DHA.
|
| Discussion |
|---|
|
|
|---|
stimulated
VCAM-1 expression, while ELAM-1 or ICAM-1 induction by TNF-
or
IFN-
and upregulation of ICAM-1 and VCAM-1 by IL-1ß remained
unaffected. In parallel, preincubation with DHA reduced
VCAM-1dependent adhesion of monocytic cells to TNF-
stimulated
HUVECs, supporting a functional relevance of the biochemical changes.
Pretreatment more than 3 hours before TNF-
stimulation was necessary
for optimal incorporation and activity of DHA, while addition of DHA 6
hours after TNF-
had no effect. Hence, this effect appeared to be
caused by inhibition of VCAM-1 induction mechanisms, not modulation of
posttranslational modification, protein transport to the membrane, or
persistent surface expression. Consistently, DHA pretreatment inhibited
TNF-
induced mRNA expression in HUVECs, indicating regulation at
the transcriptional level. The specific prevention by
pyrrolidinedithiocarbamate of NF-kBmediated VCAM-1
induction and monocyte adhesion stimulated by TNF-
indicated that
VCAM-1 and in part ELAM-1 but not ICAM-1 induction requires
mobilization of NF-kB in HUVECs.19 Our data
show that DHA is similarly selective for VCAM-1, suggesting that signal
transduction involved in NF-kB activation by TNF-
was
influenced by DHA incorporation. Accordingly, gel-shift analyses
demonstrated that DHA attenuated TNF-
stimulated NF-kB
mobilization. Although NF-kB motifs are present in the
promoter regions of the ELAM-1 and ICAM-1 genes, their induction was
not reduced by DHA. This could be explained by the finding that
NF-kB only partly controls ELAM-1
transcription,19 while other transcription factors, ie,
AP-1 or SP-1, appear more essential for the regulation of ICAM-1
transcription.20
PC-PLC has been implicated in TNF-
receptor coupling to
the acidic sphingomyelinase pathway in U937 cells, resulting in
NF-kB mobilization.21 Since the inhibitory DHA
effect was restricted to NF-kBdependent VCAM-1 induction
by TNF-
but not other cytokines, we explored the role of PC-PLC
activation for VCAM-1 upregulation by TNF-
in endothelial cells.
Indeed, inhibition studies with D609 indicated that TNF-
may mediate
VCAM-1 induction in HUVECs by activating a TNF-
responsive PC-PLC.
Moreover, TNF-
induced a 63% increase in DAG synthesis, which was
highly significant although less pronounced than in U937 cells
(120%).21 This may be due to different basal levels or
detection of DAG in our system. Incubation of HUVECs with DHA increased
its content in PC with a concurrent decrease of the n-6 PUFA AA and
C18:2.
In accordance with VCAM-1 protein expression, DHA but not EPA or AA
reduced TNF-
stimulated PC-PLC activation in HUVECs. Thus, DHA
incorporation into PC may have an effect on enzyme activity, accounting
for attenuation of VCAM-1 induction. Enrichment of DHA but not EPA in
phospholipid subclasses, including alkyl-acyl-glycerophosphocholine,
decreased the enzymatic activity crucial for eosinophilic generation of
platelet-activating factor (PAF).22 The structure of PAF
(1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) is closely
related to PC,23 suggesting similar inhibitory mechanisms.
Accordingly, preincubation with DHA but not AA inhibited PLC activation
in platelets,24 while dietary supplementation with n-3
PUFAs reduced eicosanoid formation and leukotriene
B4induced chemotaxis by attenuating
phosphatidylinositol-specific PLC in polymorphonuclear
cells.25
The induction of the endothelial cell adhesion molecules investigated
and NF-kB mobilization is under predominant control of the
TNF-
receptor R55.26 Our results suggest that DHA
causes selective inhibition of VCAM-1 upregulation by modulating the
specific coupling of receptor subtypes to their effector systems
rather than receptor expression or affinity. In parallel, it has been
reported that DHA or its metabolites but not EPA reduced PAF-stimulated
increases in intracellular Ca2+ without affecting
expression of PAF binding sites.11 We have recently shown
that NF-kB mobilization and VCAM-1 induction follow
activation of radical generation by TNF-
in HUVECs.16
Hence, DHA may alternatively act by suppressing superoxide anion
production, as found after dietary n-3 PUFA supplementation in human
peripheral blood mononuclear cells.27 Taken together, the
effects caused by DHA but not EPA may be due to preferential
incorporation into crucial phospholipid pools or to specific structural
requirements for inhibition of enzymes or receptors.
Monocyte recruitment into the vascular wall initiated by adhesion to
endothelial cells in response to stimuli such as cytokines crucially
contributes to atherogenesis or inflammatory
reactions.10 28 Immunohistochemical staining revealed
VCAM-1 expression in endothelial cells covering or extending beyond
foam cell lesions in hyperlipidemic mice,29 in areas of
neovascularization or inflammatory infiltration in human coronary
atherosclerotic plaques,30 and after aortic balloon injury
in rabbit vascular cells.31 TNF-
secretion by smooth
muscle cells or monocyte-derived macrophages32 may occur
under conditions related to enhanced VCAM-1 expression. In conjunction
with these findings, our data suggest that attenuation of TNF-
responses, such as VCAM-1 upregulation and subsequent monocytic cell
adhesion, by DHA concentrations achievable in vivo2
provides a potential explanation for a preventive role of n-3 PUFAs in
pathophysiological processes such as atherosclerosis and
inflammation.
| Acknowledgments |
|---|
Received November 14, 1994; accepted February 13, 1995.
| References |
|---|
|
|
|---|
2. Von Schacky C, Fischer S, Weber PC. Long-term effects of dietary marine n-3 fatty acids upon plasma and cellular lipids, platelet function, and eicosanoid formation in humans. J Clin Invest. 1985;76:1626-1631.
3.
Hallaq H, Smith TW, Leaf A. Modulation of
dihydropyridine-sensitive calcium channels in heart cells by fish oil
fatty acids. Proc Natl Acad Sci U S A. 1992;89:1760-1764.
4. Lorenz R, Spengler U, Fischer S, Duhm J, Weber PC. Platelet function thromboxane formation and blood pressure control during supplementation of western diet with cod liver oil. Circulation. 1983;67:501-511.
5. Endres S, Ghorbani R, Kelley VE, Georgilis K, Lonnemann G, Van Der Meer JWM, Cannon JG, Rogers TS, Klempner MS, Weber PC, Schaffner EJ, Wolff SM, Dinarello CA. The effect of dietary supplementation with n-3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N Engl J Med. 1989;320:265-271. [Abstract]
6.
Fox PL, Di Corleto PE. Fish oils inhibit
endothelial cell production of platelet-derived growth factor-like
protein. Science. 1988;241:453-456.
7. Weiner BH, Ockene IS, Levine PH, Cuenoud HF, Fisher M, Johnson BF, Daoud AS, Jarmolych J, Hosmer D, Johnson MH, Natale A, Vaudreuil CH, Hoogasian JJ. Inhibition of atherosclerosis by cod liver oil in a hyperlipidemic swine model. N Engl J Med. 1986;315:841-846. [Abstract]
8.
Lehr HA, Hübner C, Finck B, Nolte D, Beisiegel
U, Kohlschutter B, Messmer K. Dietary fish oil reduces
leukocyte/endothelium interaction following systemic administration of
oxidatively modified low-density lipoprotein.
Circulation. 1991;84:1725-1731.
9. Bates EJ, Ferrante A, Harvey DP, Poulos A. Polyunsaturated fatty acids increase neutrophil adherence and integrin receptor expression. J Leukoc Biol. 1993;53:420-426. [Abstract]
10. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801-809. [Medline] [Order article via Infotrieve]
11. Weber C, Aepfelbacher M, Lux I, Zimmer B, Weber PC. Docosahexaenoic acid inhibits PAF and LTB4 stimulated [Ca++]i-increase in differentiated monocytic U937 cells. Biochim Biophys Acta. 1991;1133:38-45. [Medline] [Order article via Infotrieve]
12.
Carlos T, Kovach N, Schwartz B, Rosa M, Newman B,
Wayner E, Benjamin C, Osborn L, Lobb R, Harlan J. Human
monocytes bind to two cytokine-induced adhesive ligands on cultured
human endothelial cells: endothelial-leukocyte adhesion molecule-1 and
vascular cell adhesion molecule-1. Blood. 1991;77:2266-2271.
13. Weber C, Kruse HJ, Sellmayer A, Erl W, Weber PC. Platelet activating factor enhances receptor-operated Ca++-influx and subsequent prostacyclin-synthesis in human endothelial cells. Biochem Biophys Res Commun. 1993;195:874-880. [Medline] [Order article via Infotrieve]
14. Pietsch A, Lorenz R. Rapid separation of the major phospholipid classes on a single aminopropyl cartridge. Lipids. 1993;28:945-947.
15. Weber C, Aepfelbacher M, Haag H, Ziegler-Heitbrock HWL, Weber PC. Tumor necrosis factor induces enhanced responses to platelet activating factor and differentiation in human monocytic Mono Mac 6 cells. Eur J Immunol. 1993;23:852-859. [Medline] [Order article via Infotrieve]
16.
Weber C, Erl W, Pietsch A, Ströbel M,
Ziegler-Heitbrock HWL, Weber PC. Antioxidants inhibit monocyte
adhesion by suppressing nuclear factorkB mobilization and
induction of vascular cell adhesion molecule1 in endothelial cells
stimulated to generate radicals. Arterioscler
Thromb. 1994;14:1665-1673.
17. Ziegler-Heitbrock HWL, Sternsdorf T, Liese J, Belohradsky B, Weber C, Wedel A, Schreck R, Baeuerle PA, Ströbel M. Pyrrolidinedithiocarbamate inhibits NF-kB mobilization and TNF production in human monocytes. J Immunol. 1993;151:6986-6993. [Abstract]
18.
Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins
T. Functional analysis of the human vascular cell adhesion
molecule 1 promoter. J Exp Med. 1992;176:1583-1593.
19. Marui N, Offermann MK, Swerlick R, Kunsch C, Rosen CA, Ahmad M, Alexander RW, Medford RM. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells. J Clin Invest. 1993;92:1866-1874.
20.
Vorarberger G, Schäfer R, Strotowa C.
Cloning of the human gene for intercellular adhesion molecule 1
and analysis of its 5' regulatory region. J
Immunol. 1991;147:2777-2786.
21. Schütze S, Potthoff K, Machleidt T, Berkovic D, Wiegemann K, Krönke M. TNF activates NF-kB by phosphatidyl-choline-specific phospholipase C-induced "acidic" sphingomyelin breakdown. Cell. 1992;71:765-776. [Medline] [Order article via Infotrieve]
22. Shikano M, Masuzawa Y, Yazawa K. Effect of docosahexaenoic acid on the generation of platelet-activating factor by eosinophilic leukemia cells. J Immunol. 1993;150:3525-3533. [Abstract]
23.
Prescott SM, Zimmerman GA, McIntyre TM. Platelet
activating factor. J Biol Chem. 1990;265:17381-17384.
24. Gaudette DC, Holub BJ. Albumin-bound docosahexaenoic acid and collagen-induced human platelet reactivity. Lipids. 1990;25:166-169. [Medline] [Order article via Infotrieve]
25. Sperling RI, Benincasco AJ, Knoell CT, Larkin JK, Austen KF, Robinson DR. Dietary omega-3 polyunsaturated fatty acids inhibit phosphoinositide formation and chemotaxis in neutrophils. J Clin Invest. 1993;92:651-660.
26.
McKay F, Loetscher H, Stueber D, Gehr G, Lesslauer W.
Tumor necrosis factor alpha-induced cell adhesion to human
endothelial cells is under dominant control of one TNF receptor type,
TNF-R55. J Exp Med. 1993;177:1277-1286.
27.
Fisher M, Upchurch KS, Levine PH, Johnson MH, Vandrenie
CH, Hoogasian JJ. Dietary n-3 fish oil supplementation reduces
superoxide anion production and chemoluminescence in a
monocyte-enriched preparation of leukocytes. Am J Clin
Nutr. 1990;51:804-808.
28. Kuijpers TW, Harlan JM. Monocyte-endothelial interactions: insights and questions. J Lab Clin Invest. 1993;122:641-651.
29.
Cybulsky MI, Gimbrone MA. Endothelial expression
of a mononuclear leukocyte adhesion molecule during
atherogenesis. Science. 1991;251:788-791.
30. O'Brien KD, Allen MD, McDonald TO, Chait A, Harlan JM, Fishbein D, McCarty J, Ferguson M, Hudkins K, Benjamin CD, Lobb R, Alpers CE. Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques: implications of the mode of progression of advanced atherosclerosis. J Clin Invest. 1993;92:945-951.
31.
Tanaka H, Sukhova GK, Swanson SJ, Clinton SK, Ganz P,
Cybulsky MI, Libby P. Sustained activation of vascular cells and
leukocytes in the rabbit after balloon injury.
Circulation. 1993;88:1788-1803.
32. Libby P, Hansson G. Involvement of the immune system in human atherogenesis: current knowledge and unanswered questions. Lab Invest. 1991;64:5-15.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
N. M. J. Schwerbrock, E. A. Karlsson, Q. Shi, P. A. Sheridan, and M. A. Beck Fish Oil-Fed Mice Have Impaired Resistance to Influenza Infection J. Nutr., August 1, 2009; 139(8): 1588 - 1594. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mayer, A. Kiessling, J. Ott, M. B. Schaefer, M. Hecker, I. Henneke, R. Schulz, A. Gunther, J. Wang, L. Wu, et al. Acute Lung Injury Is Reduced in fat-1 Mice Endogenously Synthesizing n-3 Fatty Acids Am. J. Respir. Crit. Care Med., March 15, 2009; 179(6): 474 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, R. Gill, T. L. Pedersen, L. J. Higgins, J. W. Newman, and J. C. Rutledge Triglyceride-rich lipoprotein lipolysis releases neutral and oxidized FFAs that induce endothelial cell inflammation J. Lipid Res., February 1, 2009; 50(2): 204 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Surette PhD The science behind dietary omega-3 fatty acids Can. Med. Assoc. J., January 15, 2008; 178(2): 177 - 180. [Full Text] [PDF] |
||||
![]() |
H. E. Theobald, A. H. Goodall, N. Sattar, D. C. S. Talbot, P. J. Chowienczyk, and T. A. B. Sanders Low-Dose Docosahexaenoic Acid Lowers Diastolic Blood Pressure in Middle-Aged Men and Women J. Nutr., April 1, 2007; 137(4): 973 - 978. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ferrante, B. S. Robinson, H. Singh, H. P.A. Jersmann, J. V. Ferrante, Z. H. Huang, N. A. Trout, M. J. Pitt, D. A. Rathjen, C. J. Easton, et al. A Novel {beta}-Oxa Polyunsaturated Fatty Acid Downregulates the Activation of the I{kappa}B Kinase/Nuclear Factor {kappa}B Pathway, Inhibits Expression of Endothelial Cell Adhesion Molecules, and Depresses Inflammation Circ. Res., July 7, 2006; 99(1): 34 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Pfrommer, W. Erl, and P. C. Weber Docosahexaenoic acid induces ciap1 mRNA and protects human endothelial cells from stress-induced apoptosis Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2178 - H2186. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lopez-Garcia, M. B. Schulze, J. E. Manson, J. B. Meigs, C. M. Albert, N. Rifai, W. C. Willett, and F. B. Hu Consumption of (n-3) Fatty Acids Is Related to Plasma Biomarkers of Inflammation and Endothelial Activation in Women J. Nutr., July 1, 2004; 134(7): 1806 - 1811. [Abstract] [Full Text] |
||||
![]() |
K. Mayer, S. Meyer, M. Reinholz-Muhly, U. Maus, M. Merfels, J. Lohmeyer, F. Grimminger, and W. Seeger Short-Time Infusion of Fish Oil-Based Lipid Emulsions, Approved for Parenteral Nutrition, Reduces Monocyte Proinflammatory Cytokine Generation and Adhesive Interaction with Endothelium in Humans J. Immunol., November 1, 2003; 171(9): 4837 - 4843. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nohe, T. Johannes, H.-J. Dieterich, K. Mayer, M. Merfels, F. Grimminger, and W. Seeger Antiinflammatory effects of {omega}-3 fatty acids vary at different stages of inflammation Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2248 - H2250. [Full Text] [PDF] |
||||
![]() |
K. Mayer, M. Merfels, M. Muhly-Reinholz, S. Gokorsch, S. Rosseau, J. Lohmeyer, N. Schwarzer, M. Krull, N. Suttorp, F. Grimminger, et al. omega -3 Fatty acids suppress monocyte adhesion to human endothelial cells: role of endothelial PAF generation Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H811 - H818. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mayer, R. Schmidt, M. Muhly-Reinholz, T. Bogeholz, S. Gokorsch, F. Grimminger, and W. Seeger In vitro mimicry of essential fatty acid deficiency in human endothelial cells by TNF{alpha} impact of {omega}-3 versus {omega}-6 fatty acids J. Lipid Res., June 1, 2002; 43(6): 944 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Field, I. R. Johnson, and P. D. Schley Nutrients and their role in host resistance to infection J. Leukoc. Biol., January 1, 2002; 71(1): 16 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y Abeywardena and R. J Head Longchain n-3 polyunsaturated fatty acids and blood vessel function Cardiovasc Res, December 1, 2001; 52(3): 361 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A Brown and F. B Hu Dietary modulation of endothelial function: implications for cardiovascular disease Am. J. Clinical Nutrition, April 1, 2001; 73(4): 673 - 686. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. De Caterina, J. K Liao, and P. Libby Fatty acid modulation of endothelial activation Am. J. Clinical Nutrition, January 1, 2000; 71(1): 213S - 223S. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Carluccio, M. Massaro, C. Bonfrate, L. Siculella, M. Maffia, G. Nicolardi, A. Distante, C. Storelli, and Raffaele De Caterina Oleic Acid Inhibits Endothelial Activation : A Direct Vascular Antiatherogenic Mechanism of a Nutritional Component in the Mediterranean Diet Arterioscler Thromb Vasc Biol, February 1, 1999; 19(2): 220 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. De Caterina, W. Bernini, M. A. Carluccio, J. K. Liao, and P. Libby Structural requirements for inhibition of cytokine-induced endothelial activation by unsaturated fatty acids J. Lipid Res., May 1, 1998; 39(5): 1062 - 1070. [Abstract] [Full Text] |
||||
![]() |
K. Tschaikowsky, J. Schmidt, and M. Meisner Modulation of Mouse Endotoxin Shock by Inhibition of Phosphatidylcholine-Specific Phospholipase C J. Pharmacol. Exp. Ther., May 1, 1998; 285(2): 800 - 804. [Abstract] [Full Text] |
||||
![]() |
Z. H. Huang, E. J. Bates, J. V. Ferrante, C. S.T. Hii, A. Poulos, B. S. Robinson, and A. Ferrante Inhibition of Stimulus-Induced Endothelial Cell Intercellular Adhesion Molecule-1, E-Selectin, and Vascular Cellular Adhesion Molecule-1 Expression by Arachidonic Acid and Its Hydroxy and Hydroperoxy Derivatives Circ. Res., February 1, 1997; 80(2): 149 - 158. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |