© 1995 American Heart Association, Inc.
Articles |
A Common Variant in the Gene for Lipoprotein Lipase (Asp9
Asn)
Functional Implications and Prevalence in Normal and Hyperlipidemic Subjects
From the Division of Cardiovascular Genetics, Department of Medicine, UCL Medical School, Rayne Institute, London, UK (F.M., S.E.H., P.J.T.); the Department of Medical Biochemistry and Biophysics, University of Umea, Umea, Sweden (Y.T., G.O.); the Lipid Research Group, Department of Vascular Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands (P.W.A.R., T.B., B.F.G., J.J.P.K.); the Department of Medicine, Charing Cross Hospital, London, UK (M.S.); the Atherosclerosis Research Unit, King Gustaf V Research Institute, Stockholm, Sweden (A.A.-C., A.H.); the Department of Chemical Pathology and Human Metabolism, Royal Free Hospital School of Medicine, London, UK (D.V., A.F.W.); and the MRC Epidemiology and Medical Care Unit, Wolfson Institute of Preventive Medicine, The Medical College of St Bart's Hospital, London, UK (G.J.M.).
Correspondence to Dr Philippa Talmud, Department of Medicine, Division of Cardiovascular Genetics, University College London Medical School, The Rayne Institute, University St, London, WC1E 6JJ England.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionAppendix 1References |
|---|
Abstract Subjects with combined hyperlipidemia (CHL) were screened for mutations in the lipoprotein lipase (LPL) gene by single-strand conformational polymorphism, and a previously reported G
A DNA sequence change in exon 2, causing substitution of Asp by Asn
at position 9, was identified in 2 individuals. Because this
substitution destroys a recognition site for Taq I, pooling
of DNA samples, amplification, and digest with Taq I allowed
the rapid screening of 1563 healthy individuals and patients of Dutch,
Swedish, English, and Scottish origin. In the general populations of
all four countries, healthy carriers of the mutation were detected at a
frequency of 1.6% to 4.4% (mean, 3.0%; 95% confidence interval,
2.0% to 4.0%). The frequency of carriers was roughly twice as high
(range, 4.0% to 9.8%) in selected patients with CHL or type IV
hyperlipoproteinemia or in subjects with angiographically assessed
atherosclerosis; the frequency was consistently higher in each patient
group compared with its matched control group. In 773 healthy men from
two general practices in the United Kingdom, 25 carriers and 2
homozygotes for the mutation were identified. In these 27, plasma
triglyceride but not plasma cholesterol levels were significantly
higher than in noncarriers (2.25 versus 1.82 mmol/L,
P<.02), and this difference was maintained in three
subsequent annual measurements. Postheparin LPL activity data were
available for some carriers and for 7 of 9 individuals from the
patient groups, and 6 of 6 individuals from the control groups had LPL
activity that was lower than the respective group mean. In vitro
mutagenesis and transient expression in COS cells showed that compared
with the LPL-Asp9 construct, LPL-Asn9 activity and mass were reduced by
20% to 30% in the culture media. Overall however, LPL-Asn9 had only
slightly reduced specific activity (by 18%). Thus, although the
precise mechanism of the effect is unclear, the data strongly suggest
that the LPL-Asn9 variant is associated with and may play a direct role
in predisposing carriers to develop hypertriglyceridemia.
Key Words: familial combined hyperlipidemia • genetic predisposition • lipoprotein lipase
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionAppendix 1References |
|---|
A growing body of evidence supports the hypothesis that elevated levels of plasma triglycerides may increase the risk of coronary artery disease (CAD).1 2 A common disorder that is associated with elevated triglyceride levels and increased risk of CAD is familial combined hyperlipidemia (FCHL). This disorder is defined by elevated plasma levels of cholesterol, triglycerides, or both in the proband and in at least one relative,3 4 5 6 but often at a relatively late age of onset (third to fourth decade of life).
The common metabolic defect in FCHL appears to be overproduction of triglyceride-rich, apoB-containing particles from the liver6 7 8 ; this may be accompanied by an increased number of small, dense LDL particles in the blood,9 10 which are believed to be more atherogenic11 than larger, buoyant LDL and may be more susceptible to oxidative damage.12 However, a number of environmental and genetic factors are also thought to contribute to the development of FCHL, which is now widely believed to be a genetically heterogeneous condition (reviewed in Reference 1313 ). DNA polymorphism studies have shown associations between variation in the apoAI-CIII-AIV gene cluster and FCHL,14 15 and in a proportion of FCHL families, cosegregation with this gene cluster and hyperlipidemia has been reported,14 although this finding has not been reproduced by other workers.16 17 Of the three genes in the cluster, overproduction of apoCIII appears to be the most likely cause of hypertriglyceridemia, as apoCIII is known to inhibit lipoprotein lipase (LPL) and hepatic lipase and to interfere with clearance of remnant lipoproteins.13
One key factor that determines the metabolism of triglyceride-rich lipoproteins is the activity of LPL.18 Patients who are homozygous for a mutation in the LPL gene that causes LPL deficiency occur at a frequency of roughly 1 per million and have type I hyperlipoproteinemia with fasting chylomicronemia18 ; thus, carriers for such mutations may be as frequent as 1 in 500. Study of a large kindred with type I hyperlipoproteinemia has shown that some (but not all) relatives who are heterozygous for LPL deficiency have high plasma cholesterol and/or triglyceride concentrations and that this sign is most evident in individuals over 40 years.19 Other reports have noted the presence of hyperlipidemia in obligate heterozygotes for mutations in the LPL gene, with multiple lipoprotein phenotypes reminiscent of FCHL. Recently, studies from the United States have demonstrated that a proportion (one fifth to one third) of FCHL patients have levels of postheparin LPL activity and mass below the 10th percentile for the general population.20 21 In confirmation of these results, a study of UK patients with combined hyperlipidemia (CHL) and a family history of hyperlipidemia or CAD has recently reported that 37% have LPL levels below the 10th percentile of control values.22 These data suggest that partial LPL deficiency, either genetic or acquired, may underlie the phenotype of FCHL in some patients.
We investigated the role of LPL mutations in the development of CHL and identified a common variant in the LPL gene that is associated with low LPL activity and hypertriglyceridemia. We now report on the frequency of this mutation, its effect on LPL activity in patients and healthy carriers, and on the findings of in vitro expression studies.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionAppendix 1References |
|---|
Study Subjects
Most groups of individuals examined in this study have been described in detail elsewhere. The initial search for mutations by single-strand conformational polymorphism (SSCP) screening was performed for 15 individuals with CHL who had been recruited at Charing Cross Hospital, London, as part of a larger study,22 and 10 Swedish individuals who were participating in a case-control study of myocardial infarction (MI) at a young age.23 LPL activity in the lower third of the each sample distribution was used as the selection criterion for this screening.
Specific screening for the Asp9Asn substitution was undertaken in
DNA samples obtained through five separate studies: (1) 93 control
subjects and 100 patients who were taking part in a Swedish study of MI
before age 4523 ; (2) 61 normotriglyceridemic
individuals from Sweden who were matched for age with 65
hypertriglyceridemic individuals from a community-based survey in
Stockholm county24 ; (3) 240 Dutch subjects with CHL who
were followed up at the Lipid Research Clinic of the University of
Amsterdam and 190 normolipidemic healthy control subjects of Dutch
origin who were recruited from a risk factor study and matched with the
CHL group for age and sex (individuals with plasma lipid levels above
the 95th percentile for age and sex were excluded); (4) 360 male
subjects aged 40 to 64 from a general practice in southern
England and 413 male subjects from a general practice in Scotland, all
of whom had been recruited as part of the Northwick Park Heart Study II
project25 and were free of CAD at the time of entry into
the study, as assessed by questionnaire and electrocardiography; and
(5) 41 consecutive patients with CHL from the Lipid Clinic of Charing
Cross Hospital, 93% of whom had a family history of
hyperlipidemia.22
Biochemical Analysis
Cholesterol and triglycerides determined by standard
colorimetric methods22 and biometric data previously
obtained for each study were used for comparison of carriers with
noncarriers. Approval was obtained from the appropriate institutional
ethics review boards for measurement of LPL activity. Blood samples
were collected in the fasting state 15 minutes after an intravenous
heparin injection (50 or 100 U/kg body weight) was given, and separated
plasma was snap-frozen in a dry ice/ethanol bath and kept at -70°C
until analysis. Postheparin LPL activity in plasma was determined
by one of two methods, using a stabilized, tritiated triolein emulsion
as the substrate. For samples from the Charing Cross
study22 and the Swedish young MI study control
group,23 LPL activity was measured as described by
Nilsson-Ehle and Ekman,26 whereas the method of Karpe et
al27 was used for all other samples. Six subjects were
recalled for reanalysis of plasma LPL by chromatography on
heparin-Sepharose columns as described.28 Briefly, a blood
sample was obtained before and after injection of heparin, 10 mL plasma
was injected in the column, and 1-mL fractions were eluted with
increasing salt concentration. Total lipase activity was measured in
individual fractions, as previously described,27 whereas
LPL mass was determined by an enzyme-linked immunosorbent assay with a
chicken polyclonal antibody as the capture antibody and monoclonal
antibody 5D2 as the detection antibody.29 The stability
(resistance to denaturation) of LPL in carriers and noncarriers of FCHL
was studied by preincubating samples of enzyme fractions from
heparin-Sepharose columns at 37°C before performing the activity
assay.
DNA Analysis
Blood was collected in 10-mL Na-EDTA tubes and kept frozen at
-20°C. DNA was extracted by the salting-out method30 or
as previously described.31 Polymerase chain reaction (PCR)
amplification of LPL exon 2, yielding a 237-bp product, was achieved on
a Cambio machine with a "touchdown" program in the plate mode,
using primers on either side of exon 2 (sequence from Oka et
al32 ). The sequence of these oligonucleotides (ABC
Biotechnology) is as follows: left hand, 5' CTC CAG TTA ACC TCA TAT CC
3'; right hand, 5' CAC CAC CCC AAT CCA CTC 3'.
Following denaturation at 98°C (1 minute, except for 5 minutes at
97°C during the first cycle), the annealing temperature was decreased
from 70°C to 55°C in five steps (70°C, 65°C, 60°C, 58°C,
and 55°C) over six cycles while the extension conditions were kept
constant at 72°C for 1.5 minutes. The reactions were carried out in
standard buffer supplied by GIBCO-BRL (10x buffer is 500 mmol/L KCl;
100 mmol/L Tris-HCl, pH 8.3; 2 mmol/L each dNTP; and 0.01% gelatin)
with 100 ng of each primer, 5% W-1 detergent, and 0.5 U Taq
polymerase (GIBCO-BRL) per reaction at a final MgCl2
concentration of 1.7 mmol/L. For SSCP analysis, amplification was
performed as described above, except that 0.2 µL
[
-32P]dCTP at 10 µCi/µL (3000 mCi/mmol, Amersham)
was added to each sample. An aliquot of the PCR product was then
diluted fivefold in 0.1% SDS–10 mmol/L Na-EDTA and kept frozen until
needed. DNA was separated into single strands by the method of Orita et
al,33 with minor modifications. Samples were denatured by
boiling and were separated by gel electrophoresis for 18 hours on a
10% glycerol/7.5% polyacrylamide gel (40 cm, 0.4 mm thick, with a
50:1 ratio of acrylamide/bisacrylamide) at a constant 15-mA current.
Direct sequencing of variants detected by SSCP was carried out by using
the same primers as in the amplification reaction. The PCR product was
purified using the Geneclean II kit (Bio101) and then sequenced by the
dideoxy method of Green et al,34 using modified T7
polymerase (Sequenase, US Biochemical Corp).
The GA substitution destroys a site for Taq I, and for
rapid screening of this substitution, DNA samples were pooled in groups
of five and amplified as described above. Pooled samples were then
digested with Taq I according to the manufacturer's
instructions and analyzed on 10% acrylamide gels (80x70x1 mm) using
a Hoefer "Mighty Small" vertical electrophoresis apparatus.
Samples were run for 1 hour at 30 mA. Detection of fragments was
achieved by silver staining according to the method of Merrill et
al,35 but with a shorter (1 minute) nitric acid immersion
time and brief (2x <20 seconds) distilled water rinses to compensate
for the thinness of the gels. The bands were seen at 179 and 52 bp
(G–Taq I cutting–Asp9) or 179 and 58 bp (A–Taq
I not cutting–Asn9). Samples from pooled DNA showing the 58-bp band
were individually reamplified and processed as described above for
final identification of Asn9 carriers. Genotypes for Pvu II
and HindIII were determined by PCR using the same primers
and amplification conditions as described
previously.36
Site-Directed Mutagenesis and Transient Expression Studies
In vitro site-directed mutagenesis was used to synthesize the
Asn9 mutant allele (Altered Sites mutagenesis system, Promega). A
2.4-kb fragment of the LPL cDNA containing the entire coding sequence
was inserted in the antisense orientation in the pSelect phagemid
vector with a defective ampicillin resistance gene. Single-stranded
vector containing the full-length LPL-Asp9 cDNA was produced by
coinfection of JM109 bacteria with phage R408 and isolated by
precipitation with 0.25 vol 20% polyethylene glycol–3.75 mol/L
ammonium acetate. The purified material was then annealed to the
mutagenic oligonucleotide (5'–ACTTTCGATGTTGATAAAATCT–3')
and to the ampicillin repair primer, and second-strand synthesis was
performed according to the manufacturer's recommendations. Following
two rounds of transformation with ampicillin selection, phagemid DNA
from resistant colonies was isolated by standard methods and checked
for the presence of the mutation by direct sequencing. After
reamplification, a positive LPL insert was excised from pAlter by
digest with Xba I/Pst I, purified by
electrophoresis and elution on a Spin-Bind column (Biozym), and ligated
into the linearized pcDNAI expression vector (Invitrogen Corp) in the
sense orientation. The resulting pcDNAI–LPL-Asn9 construct had the LPL
cDNA under control of the cytomegalovirus promoter and expressed the
Tyr tRNA suppresser gene (synthetic SupF gene). When used to
transform mc1061 bacteria harboring the mutant p3 plasmid (Invitrogen
Corp), this construct conferred ampicillin and tetracycline resistance
to mc1061/p3 cells. Large-scale purification of pcDNAI–LPL-Asn9 and
pcDNAI-LPL plasmids for transfection was achieved with the Circle Prep
kit (Bio101). The purity of plasmid DNA preparations was confirmed
spectroscopically and electrophoretically to confirm the absence of
contaminating bacterial DNA and by sequencing of the plasmid to confirm
its identity and ensure that no other sequence changes had been
introduced during manipulation.
The DEAE-dextran method37 was used for transfection of COS B cells. Briefly, the DNA to be transfected was diluted in 2.5 mL Dulbecco's modified Eagle's medium with 51.6 µg/mL chloroquine and then mixed 1:1 (vol/vol) with a 0.6-mg DEAE-dextran solution. Plasmid DNA (5 µg) was used for each 60-mm dish (50% to 80% confluent). The cells were washed once with medium, and the transfection mixture was added for 3.5 hours. The cells were shocked briefly (1 minute) with DMSO, washed once with PBS, and then allowed to recover with medium containing 10% fetal calf serum. Samples of medium were collected and cells harvested 3 days after transfection, with heparin (20 U/mL medium) being added to half of the dishes 2 hours prior to collection. All material was snap-frozen and kept at -70°C until assayed as described previously.26 27
Statistical Analysis
The gene-counting method with a 
2 test and
Yates' correction was used to compare the frequencies of the Asn9
variant allele between the different groups. The estimate of relative
risk (RR) of being a carrier was calculated by standard techniques. To
compare RRs between samples, the estimates of logeRR were
weighted by the reciprocal of the sampling variance. The estimates are
combined by calculating a weighted mean and are tested for
heterogeneity by a 2 index (Woolf's
method).38 All other tests and transformations were
performed with the SPSS statistical package. The
Mann-Whitney nonparametric test and t test were used to
compare levels of lipid traits, LPL activity, and LPL mass between
carriers and noncarriers of the Asn9 variant in healthy men from the
two UK studies. To test differences in triglyceride levels, values were
logarithmically transformed prior to statistical analysis.
Statistical significance was considered at P<.05.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionAppendix 1References |
|---|
Screening of LPL exons 2 through 6, 8, and 9 for mutations was undertaken using SSCP in a group of 25 hyperlipidemic subjects who were selected on the basis of low LPL activity. A number of SSCPs were detected, but data for only one of these SSCPs will be presented here. This variant pattern in exon 2 (Fig 1a
) was
detected in 3 individuals, 2 from the CHL, low-LPL group from Charing
Cross Hospital and 1 from the low-LPL patient group from the Swedish
young MI study. No pattern differences in any other exons were detected
for these 3 individuals. Direct sequencing of exon 2 revealed a GA
transition at position 280 (sequence numbering according to Wion et
al39 ) (Fig 1b), resulting in the substitution of Asn for
Asp at amino acid residue 9. This mutation was previously
reported in a patient with type I hyperlipoproteinemia, who, in
addition to being homozygous for the Asn9 variant, was homozygous for
the Tyr262His substitution.40 This second base change
was not present in the carrier subjects studied here.
|
This GA transition was predicted to abolish a Taq I
restriction site, resulting in the production of a 58-bp variant
fragment, larger than the wild-type 52-bp fragment, upon digest of the
exon 2 PCR product with this enzyme (Fig 1c
). To estimate the frequency
of this base change in hyperlipidemic individuals and to determine
whether it was present in apparently healthy individuals, a rapid
screening strategy was developed on the basis of pooling the DNA
samples prior to PCR amplification. Four to six DNA samples were
pooled, amplified, and digested with Taq I. Individual
samples from pools found to be positive were then reamplified and
redigested for final identification of carriers. Mixing experiments
(not shown) demonstrated that this method had the sensitivity to
identify a carrier from a pool of as many as 10 samples (1 mutant
allele from a total of 20), but given the frequency of this variant,
pools of four to six individual samples were optimal.
Patients from England, two groups from Sweden, and one group from the
Netherlands who had been selected on the basis of either being
hyperlipidemic or having suffered an MI before the age of 45 were
screened. Each patient group had a comparison group of control subjects
from each general population; the general characteristics, lipid
levels, and LPL activities (where available) of these groups are
summarized in Table 1. A total of 37 Asn9 carriers were
identified. As shown in Table 2, in the four control
groups the frequency of carriers was between 1.6% and 2.5% (mean,
2.2%; 95% confidence interval, 1.1% to 3.2%) with no significant
evidence for heterogeneity in frequency between groups
(2=0.34, P=.89). One individual in the
general practice control group from England was homozygous for the Asn9
mutation. In each group of patients the frequency of carriers was
roughly twice as high as in the matched control group. The frequency
was fourfold higher (9.8% versus 2.5%) when the CHL sample from
Charing Cross Hospital was compared with control subjects in the
English general population. The two study groups from Sweden had
similar frequency differences, with a prevalence almost twofold higher
in young MI patients compared with their healthy counterparts (4.0%
versus 2.2%) and more than threefold higher in hypertriglyceridemic
compared with normotriglyceridemic individuals (5.0% versus
1.6%). In the Dutch CHL group the frequency was threefold higher
compared with Dutch control subjects (4.9% versus 1.6%). There was no
significant difference (P=.91) between studies in the RR of
being a carrier in patients compared with control subjects.
|
|
To examine the effect of the mutation on plasma lipid levels, an
additional 413 healthy men from a general practice in Scotland were
screened. Their characteristics were similar to the English control
group (Table 1), and 18 carriers (including one homozygote) were
identified. The frequency of carriers in this group was 4.4%, which is
higher (but not significantly, 2=1.74 by gene
counting, P>.2) than the frequency in the English group. As
shown in Table 3, after data from the two groups of
healthy men from England and Scotland were combined, those with at
least one allele for LPL-Asn9 had significantly higher (24%) plasma
triglyceride levels than did noncarriers, with no other significant
differences in measured traits between groups. The individual data for
triglycerides and cholesterol are shown in Fig 2a, which
reveals considerable scatter in triglyceride levels, with one
homozygote having a relatively low and the other a relatively high
level. The individual triglyceride and cholesterol levels for the Dutch
and Swedish control groups are also shown in Fig 2a, and 5 of 6
individuals have triglyceride values above their respective sample
mean.
|
|
|
In 22 male Asn9 carriers from the United Kingdom, complete lipid data
were available for baseline and three subsequent annual measurements,
and these are shown in Fig 2b. In the group of noncarriers (n=631)
there was a small (but significant, P=.001) decrease in
plasma triglyceride level over the 3 years, but the significantly
higher plasma triglyceride level in LPL-Asn9 carriers was maintained
(P=.01 overall). The slightly lower cholesterol levels in
carriers at baseline were also maintained over time, but overall, this
difference was still not significant (5.35±0.18 mmol versus
5.66±0.04, P=.1). To investigate the potential role of
obesity in the development of elevated plasma triglyceride levels in
carriers, lipid levels were determined in those men with a body mass
index (BMI) in the lowest tertile (<25.0 kg/m2) and in the
upper two tertiles combined. In noncarriers from the two UK general
practice samples, plasma triglyceride values were, as expected, higher
in those with a BMI in the upper tertiles (1.54 versus 1.94 mmol/L,
26% higher), but in carriers the effect associated with BMI was larger
(1.35 versus 2.93 mmol/L, 117% higher), although this difference did
not reach conventional levels of significance (BMIxgenotype
interaction, P=.07).
Where available, LPL activity data were examined for the Asn9 carriers.
Fig 3 shows individual LPL activity values from the
various studies plotted against each group's own mean. From the
patient groups, 7 of 9 carriers and from the control groups 3 of 3
carriers had activity measurements below their group mean, and this
represented a 15% to 40% decrease in LPL activity
relative to their respective sample means (data not shown). Without LPL
mass data, it was impossible to distinguish whether this difference
between carriers and noncarriers was due to lower specific activity of
the mutant enzyme or overall decreased release or secretion of LPL from
the cells. To examine this question, experiments were carried out to
characterize biochemically the Asn9 variant by analyzing postheparin
LPL activity and mass in normolipidemic carriers. Three Asn9 carriers
from the English general practice sample were recalled, and samples
from three noncarrier normal laboratory control subjects were taken for
comparison. In the carriers, mean total LPL activity was 30% lower
(177 versus 251 mU/mL) and mass 30% lower (985 versus 1538), although
these differences did not reach significance (t test,
P=.12 for mass and P=.16 for activity).
Separation of plasma by heparin-Sepharose did not reveal any striking
differences in LPL activity or mass elution profiles between carriers
and noncarriers. In particular, there was no clear variation in the
ratio of the two mass peaks or the two areas under the curve,
representing inactive monomeric LPL and active dimeric LPL,
respectively; both forms eluted in the expected fractions (not shown).
The semipurified LPL from both Asn9 carriers and noncarriers had a
similar stability incubation at 37°C (not shown). Activity was then
measured for 22 hours. No striking difference in substrate affinity was
observed between lipase preparations from carriers and noncarriers (not
shown).
|
To determine whether the mutation causing the Asn9 substitution may have occurred on more than one occasion, genotypes for the Pvu II (intron 6) and HindIII (intron 8) polymorphic sites were determined for all identified Asn9 carriers except those in the Scottish sample. In 28 individuals for whom unambiguous haplotypes could be determined, two distinct Asn9 haplotypes that differed at the Pvu II site were identified. Seven individuals were P-P-/H+H+ homozygotes (ie, noncutting for Pvu II but cutting for HindIII) and thus carried the Asn9 variant on a P-H+ haplotype; 4 individuals were homozygous for the P+H+ haplotype; and in 12 individuals who were heterozygous for the Pvu II restriction site, either haplotype could carry the Asn9 variant. Of the remaining 5 subjects for whom data on both polymorphisms were available, 1 was homozygous and 4 were heterozygous for a third, rarer carrier haplotype, P-H-. Among the healthy men from the United Kingdom, those with different Pvu II/HindIII genotypes had similar levels of plasma triglycerides (not shown), and of those with low LPL activity, 2 had the commonest P-H+ carrier haplotype and 1 had the P+H+ haplotype, but the haplotype could not be determined unambiguously in the remaining 6 individuals (P+P-/H+H-).
To confirm that these effects on LPL activity and plasma triglycerides
were due to a direct effect of the Asp9Asn substitution, the Asn9
variant was constructed by site-directed mutagenesis and expressed in
vitro. Following transfection of Asn9 and Asp9 constructs in COS cells,
cells and media were collected and tested for LPL activity and mass,
and data from three separate experiments are summarized in Table 4. In all experiments, LPL activity and mass were
measured in the medium in separate plates, both before and after
addition of heparin to release LPL from the cell surface. In cells
transfected with the Asn9 construct, both activity and mass in the
medium were lower than for the Asp9 construct, and this was seen in all
experiments and in all nine replicates from three experiments. There
was an overall reduction of approximately 20% to 30% (range, 18% to
40% for activity and 6% to 32% for mass), with similar results for
mass and activity measurement in the medium before and after addition
of heparin. However, because both activity and mass were decreased, the
reduction in LPL specific activity was smaller and not statistically
significant (range, 12% to 22%). Levels of activity and mass within
cells were measured in all plates, and these values showed a large
scatter, with mass measurements being threefold to fourfold higher than
in the medium. Overall, there was no clear evidence of intracellular
accumulation of LPL-Asn9 (data not shown). Preheparin media from
several plates were pooled in the fourth transfection experiment and
passed through a heparin-Sepharose affinity column to separate the
excess monomer LPL protein associated with these in vitro assays. The
resulting profile still showed decreased dimer mass and activity for
the Asn9 construct, with no apparent elution shift of the dimer peak
for the mutant, suggesting that the affinity for heparin was not
altered (Fig 4). There were no significant differences
in the monomer to dimer mass ratio, as assessed by the areas under the
curve or by peak fractions. The stabilities of LPL-Asp and LPL-Asn were
compared by measuring activity in the medium from cells incubated at
37°C for 2 hours. LPL activity declined slowly over this time at a
similar rate for both constructs (not shown).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionAppendix 1References |
|---|
Many individuals who develop hyperlipidemia report a family history of hyperlipidemia and/or CAD,3 4 although the observed disease pattern may be incompatible with the inheritance of a single major gene. In most families, several different genes are likely to contribute, with their effects being modified by environmental factors, so that each family has a different constellation of causative genetic and environmental factors. In this model, a mutation that alters the function of a given gene would confer susceptibility but have insufficient impact on its own to cause disease. Such a mutation would therefore be present in healthy individuals in the general population but would be found more frequently in patients with hyperlipidemia, and the data we report here suggest that the common Asp9
Asn variant in the LPL gene is such a mutation. The frequency of
carriers of the mutation in the healthy populations of southern
England, the Netherlands, and Sweden ranged between 1.6% and 2.5%,
with a slightly higher frequency observed in healthy men from Scotland.
The presence of the mutation in individuals from four different
European countries suggests that it may be present in other
Caucasian groups, but further studies are needed for a more accurate
estimate of gene frequency. The frequency of carriers of the mutation
was consistently higher in Swedish MI patients and Swedish, English,
and Dutch hyperlipidemic cases than in their corresponding general
population control groups. Although combining data from the different
patient groups is invalid because the selection criteria are different,
the consistently higher frequency in the patient groups strongly
suggests that the LPL-Asn9 variant is associated with and contributes
to the development of hyperlipidemia.
The hypothesis that the Asn9 substitution has a direct effect on LPL
function is supported by data from in vivo studies. In 34 of the
carriers, three distinct two–restriction fragment length polymorphism
Asn9 haplotypes were identified, suggesting that the mutation has
occurred more than once, a likely possibility, considering that a
mutable CpG dinucleotide is involved. All three haplotypes were
associated with diminished LPL activity and increased triglyceride
levels, thus making it less likely that the Asn9 variant is in linkage
disequilibrium with an unidentified functional mutation elsewhere in
the coding region or in the upstream promoter region of the LPL gene.
In addition, as shown in Fig 5, the Asp9 residue for LPL
is completely conserved across species from guinea pig to human and is
proximal to a ß-strand motif, a highly conserved element among
lipases,41 42 suggesting its importance in the maintenance
of enzyme structure.
In most carriers of the LPL-Asn9 variant, LPL activity is below the
mean for noncarriers, although this effect is more consistent in the
healthy group (3 of 3) than in the patients (7 of 9). This is not
surprising, because although a positive correlation between plasma
triglyceride levels and LPL activity has been reported in
normolipidemic individuals, such a correlation has not been observed in
hypertriglyceridemic (HTG) patients, suggesting that in HTG other
factors modify this relationship.43 44 45 In the healthy men
from the United Kingdom, mean triglyceride levels of those carrying the
Asn9 variant are elevated 24% above noncarriers, but Fig 3 shows that
only 23 of 33 Asn9 carriers have triglyceride values above the group
mean. Thus, 10 carriers, including 1 homozygote, have plasma
triglyceride levels that are not elevated, and this suggests that in
some carriers, another factor, either genetic or environmental, must be
interacting to cause the HTG. Factors that cause increased production
of triglyceride-rich lipoproteins from the liver, such as diet or
obesity, are obvious possibilities, and in the healthy carriers, an
increased BMI (>25.0 kg/m2) was associated with a greater
elevation of plasma triglycerides than in noncarriers. Of the 2
Asn9-variant homozygotes, only 1 was HTG. The second had a BMI that was
18% lower than the sample mean (21.9 versus 26.6 kg/m2),
and this low BMI may have masked the effect of homozygosity for the LPL
mutation.
In the carriers identified in the patient groups, low LPL activity was observed in 7 of 9 patients (the exceptions being 1 from the Charing Cross CHL group and 1 from the Swedish HTG group). Several explanations could account for this observation. LPL is synthesized in both skeletal muscle and adipose tissue, and LPL expression is controlled in a complex tissue-specific manner by factors such as insulin levels, obesity, diet, and alcohol intake.43 44 45 In humans, hyperinsulinemia (together with obesity) has been shown to increase adipose tissue LPL activity.45 Although insulin levels were not measured in these 2 carriers, each was markedly above ideal body weight; in fact, 1 had been on a diet at the time of sampling; and weight loss also is often associated with a long-term increase in adipose tissue LPL activity.46 Recent studies have shown that heterozygotes for the LPL-Thr183 mutation, which completely abolishes LPL activity in vitro, have LPL activity values within the normal range,47 and this raises the possibility that in some circumstances there may be a compensatory upregulation of the functional allele.
In the in vitro experiments, although there was some variation in results, lower activity and mass were consistently observed in the medium from transfected COS cells. The observed variability is not surprising, because the transient expression systems (for several reasons) are not ideal for testing relatively small differences. Although the number of cells per plate was kept constant within each experiment, there was no control for transfection efficiency. However, this issue was at least partially addressed by using multiple dishes, randomized to the two constructs; by combining data from several plates; and by the consistency of results in repeated experiments. The data for nine replicates of three experiments show that cells transfected with the LPL-Asn9 construct consistently had lower levels of LPL activity (by 18% to 40%) and mass (by 6% to 32%) than did plates of cells with the wild-type construct. This small effect on activity and mass is consistent with the in vivo data: in the three normolipidemic carriers who were recalled, mean LPL activity and mass were reduced by 25% to 30%. However, both in vivo and in vitro, specific activity was within the range for the wild-type LPL-Asp9 construct.
Our in vitro experiments suggest that LPL-Asn9 has a specific activity within the normal range, as originally reported.40 The stability of the LPL-Asn9 secreted by COS cells did not differ from that of LPL-Asp9, and binding affinity and the ability to bind heparin appear unchanged, suggesting that the lower mass and activity in the medium were not caused by impaired LPL release from the cell surface. This is not surprising, since the main heparin-binding domain has been proposed to lie between amino acids 270 and 305,48 49 which are predicted to be distant from the N-terminal sequence in the tertiary structure of LPL. The data from these two sets of experiments raise the possibility that the Asn9 substitution may impair secretion, which might lead to intracellular accumulation of LPL. This could not be accurately determined in these experiments due to the difficulty in measuring low levels of active LPL enzyme and in distinguishing inactive monomer from active dimer forms in the cell lysates. These issues could be resolved by cell fractionation and metabolic labeling experiments in permanently transfected cell lines.
One question still to be addressed is the relative proportion of LPL present as the Asn9 variant protein in the plasma of carriers and the ability of the Asn9 monomer to associate intracellularly with the Asp9 monomer. Theoretically, roughly half of plasma LPL activity should be due to Asp9-Asn9 heterodimers, with the other half divided equally between the two homodimers, although this cannot be readily assessed with current techniques. Evidence from the in vitro studies suggests that Asn9 homodimers are not produced as efficiently as their Asp9 counterparts, and it is possible that heterodimer production may be even less efficient. If this is the case, then tissue culture models would underestimate the impact of the Asn9 variant and could explain the similar decrease in mass and activity observed in both homozygous (in vitro) and heterozygous (carrier individuals) settings.
After completion of the work reported here, two small studies reported identification of the LPL-Asn9 variant in 20 patients from the United States and 31 patients from Canada with FCHL.50 51 A carrier frequency of 2% to 5% was observed in FCHL patients, but a similar frequency was also reported in 49 healthy individuals. However, neither study was large enough to have the power to detect small differences in carrier frequency, and in addition, case-control frequency comparisons are easily confounded by ethnic heterogeneity, such as is found in the United States. Further larger studies are required to more precisely estimate the frequency of the LPL-Asn9 variant in groups of patients with different hyperlipidemic phenotypes. However, neither previous study would have had the sensitivity to detect the 20% to 30% lower activity and mass that we consistently observed in the more extensive transfection experiments reported here.
The 24% higher plasma triglyceride levels observed in normal LPL-Asn9 carriers support the contention that the moderate decrease in LPL activity associated with the Asn9 substitution can directly affect lipid metabolism and that this factor, when compounded by other factors, may lead to full hyperlipidemia. These data suggest that a search for other common variants in the LPL gene that affect enzyme function or expression will be fruitful.
|
|
Acknowledgments |
|---|
This work was supported by the British Heart Foundation (RG16) (Drs Humphries and Talmud), the Swedish Medical Research Council, and the Bank of Sweden Tercentenary Foundation (Dr Olivecrona). The excellent technical assistance of Ann-Sofie Jakobsson and Karla Peters is gratefully acknowledged, and we thank Jackie Cooper for assistance with the statistical analysis.
|
Appendix 1 |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionAppendix 1References |
|---|
Received July 11, 1994; accepted January 20, 1995.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionAppendix 1References |
|---|
1. Castelli WP. Epidemiology of triglycerides: a view from Framingham. Am J Cardiol. 1992;70:3H-9H. [Medline] [Order article via Infotrieve]
2. Bengtsson C, Björkelund C, Lapidus L, Lissner L. Associations of serum lipoproteins and obesity with mortality in women: 20 year follow-up of participants in prospective population study in Gothenburg, Sweden. BMJ. 1993;307:1385-1388.
3. Goldstein JL, Hazzard WR, Schrott HG, Bierman EL, Motulsky AG. Hyperlipidemia in coronary heart disease, II: genetic analysis of lipid levels in 176 families and delineation of a new inherited disorder, combined hyperlipidemia. J Clin Invest. 1973;52:1544-1568.
4. Nikkilä EA, Aro A. Family study of lipids and lipoproteins in coronary heart-disease. Lancet. 1973;1:954-958. [Medline] [Order article via Infotrieve]
5. Brunzell JD, Schrott HG, Motulsky AG, Bierman EL. Myocardial infarction in the familial forms of hypertriglyceridemia. Metabolism. 1976;25:313-320. [Medline] [Order article via Infotrieve]
6. Grundy SM, Chait A, Brunzell JD. Familial combined hyperlipidemia workshop. Arteriosclerosis. 1987;7:203-207.
7. Sniderman A, Shapiro S, Marpole D, Malcolm I, Skinner B, Kwiterovich PO Jr. The association of coronary atherosclerosis and hyperapolipoproteinemia (increased protein but normal cholesterol content in human plasma low density lipoprotein). Proc Natl Acad Sci U S A. 1980;97:604-608.
8. Kwiterovich PO Jr, Coresh J, Bachorik PS. Prevalence of hyperapobetalipoproteinemia and other lipoprotein phenotypes in men (<50 years) and women (<60 years) with coronary artery disease. Am J Cardiol. 1993;71:631-639. [Medline] [Order article via Infotrieve]
9.
Austin MA, Brunzell JD, Fitch WK, Krauss RM. Inheritance of
low density lipoprotein subclass patterns in familial combined
hyperlipidemia. Arteriosclerosis. 1990;10:520-530.
10.
Hokanson JE, Austin MA, Zambon MA, Brunzell JD. Plasma
triglyceride and LDL heterogeneity in familial combined hyperlipidemia.
Arterioscler Thromb. 1993;13:427-434.
11.
Austin MA, King M-C. Vranizan KM, Krauss RM. Atherogenic
lipoprotein phenotype: a proposed genetic marker for coronary heart
disease. Circulation. 1990;82:495-506.
12.
De Graaf J, Hak-Lemmers HLM, Hectors MPC, DeMacker PNM,
Hendricks JCM, Stalenhoef AFH. Enhanced susceptibility to in vitro
oxidation of the dense low density lipoprotein subfraction in healthy
subjects. Arterioscler Thromb. 1991;11:298-306.
13. Kwiterovich PO Jr. Genetics and molecular biology of familial combined hyperlipidemia. Curr Opin Lipidol. 1993;4:133-143.
14. Wojciechowski AP, Farrall M, Cullen P, Wilsort ME, Bayliss JD, Farren B, Griffin BA, Caslake MJ, Packard CJ, Shepherd J, Thakker R, Scott J. Familial combined hyperlipidemia linked to the apolipoprotein A-I/C-III/A-IV gene cluster on chromosome 11q23-q24. Nature. 1991;349:161-164. [Medline] [Order article via Infotrieve]
15. Hayden MR, Kirk H, Clark C, Frohlich J, Rabkin S, McLeod R, Hewitt J. DNA polymorphisms in and around the apo AI-CIII gene and genetic hyperlipidemias. Am J Hum Genet. 1987;40:421-430. [Medline] [Order article via Infotrieve]
16. Wijsman EM, Motulsky AG, Guo S-W, Yang M, Austin MA, Brunzell JD, Deeb S. Evidence against linkage of familial combined hyperlipidemia to the AI/CIII/AIV gene complex. Circulation. 1992;86(suppl I):I-410. Abstract.
17. Xu C-F, Talmud P, Schuster H, Houlston R, Miller G, Humphries SE. The association between genetic variation at the apo AI-CIII-AIV gene cluster and familial combined hyperlipidemia. Clin Genet. 1994;46:385-397. [Medline] [Order article via Infotrieve]
18. Brunzell JD. Familial lipoprotein lipase deficiency and other causes of the chylomicronemia syndrome. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The Metabolic Basis of Inherited Disease. New York, NY: McGraw-Hill Book Co Inc; 1989:1165-1180.
19. Wilson DE, Emi M, Iverius P-H, Hata A, Wu LL, Hillas E, Williams RR, Lalouel JM. Phenotypic expression of heterozygous lipoprotein lipase deficiency in the extended pedigree of a proband homozygous for a missense mutation. J Clin Invest. 1990;86:735-750.
20.
Babirak SP, Iverius P-H, Fujimoto WY, Brunzell JD. Detection
and characterization of the heterozygote state for LPL deficiency.
Arteriosclerosis. 1989;9:326-334.
21. Babirak SP, Brown BG, Brunzell JD. Familial combined hyperlipidemia and abnormal lipoprotein lipase. Arterioscler Thromb. 1992;12:1176-1183. [Abstract]
22. Seed M, Mailly F, Vallance D, Doherty E, Winder A, Talmud P, Humphries SE. Lipoprotein lipase activity in patients with combined hyperlipidemia. Clin Invest. 1994;72:100-106. [Medline] [Order article via Infotrieve]
23. Hamsten AG, Walldius G, Dahlen B, Johansson D, de Faire U. Serum lipoproteins and apolipoproteins in young male survivors of myocardial infarction. Atherosclerosis. 1986;59:223-231.[Medline] [Order article via Infotrieve]
24. Asplund-Carlson A. Studies in hypertriglyceridaemia, II: clinical characteristics linked with the hypertriglyceridaemic state in randomly selected Swedish men. Nutr Metab Cardiovasc Dis. 1994;4:88-95.
25.
Humphries SE, Lane A, Green FR, Cooper J, Miller GJ. Factor
VII coagulant activity and antigen levels in healthy men are determined
by interaction between factor VII genotype and plasma triglyceride
concentration. Arterioscler Thromb. 1994;14:193-198.
26. Nilsson-Ehle P, Ekman R. Rapid, simple and specific assays for lipoprotein lipase and hepatic lipase. Artery. 1977;3:194-209.
27. Karpe F, Olivecrona T, Walldius G, Hamsten A. Lipoprotein lipase in plasma after an oral fat load: relation to free fatty acids. J Lipid Res. 1992;33:975-984. [Abstract]
28. Vilella EJ, Joven M, Fernández S, Vilaró S, Brunzell JD, Olivecrona T, Bengtsson-Olivecrona G. Lipoprotein lipase in human plasma is mainly inactive and associated with cholesterol-rich lipoproteins. J Lipid Res. 1993;34:1555-1564. [Abstract]
29. Peterson J, Fujimoto WY, Brunzell JD. Human lipoprotein lipase: relationship of activity, heparin affinity, and conformation as studied with monoclonal antibodies. J Lipid Res. 1992;33:1165-1170. [Abstract]
30.
Miller SA, Dykes DD, Polesky HF. A simple salting out
procedure for extracting DNA from human nucleated cells. Nucleic
Acids Res. 1989;16:1215.
31.
Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel SS,
Miller OJ, Breg WR, Jones HW Jr, Rary JM. Analysis of human
Y-chromosome-specific reiterated DNA in chromosome variants. Proc
Natl Acad Sci U S A. 1977;74:1245-1249.
32. Oka K, Tkalcevic GT, Nakano T, Tucker H, Ishimura-Oka K, Brown VW. Structure and polymorphic map of human lipoprotein lipase gene. Biochim Biophys Acta. 1990;1049:21-26. [Medline] [Order article via Infotrieve]
33. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics. 1989;5:874-879. [Medline] [Order article via Infotrieve]
34. Green P, Bentley D, Mibashan R, Nilsson I, Giannelli F. The molecular pathology of haemophilia B. EMBO J. 1989;8:1067-1072. [Medline] [Order article via Infotrieve]
35.
Merrill CR, Goldman D, Sedman SA, Ebert MH. Ultrasensitive
stain for protein in polyacrylamide gels shows regional variation in
cerebrospinal fluid proteins. Science. 1981;211:1437-1438.
36. Peacock RE, Hamsten A, Nilsson-Ehle P, Humphries SE. Associations between lipoprotein lipase gene polymorphisms and plasma correlations of lipids, lipoproteins and lipase activities in young myocardial infarction survivors and age-matched healthy individuals from Sweden. Atherosclerosis. 1992;97:171-185. [Medline] [Order article via Infotrieve]
37.
Selden RF, Burke-Howie K, Rowe MD, Goodman HM, Moore DD.
Human growth hormone as a reporter gene in regulation studies
employing transient gene expression. Mol Cell Biol. 1986;6:3173-3179.
38. Armitage P, Berry G. Statistical Methods in Medical Research. London, England: Blackwell Scientific Publications; 1987:459-464.
39. Wion KL, Kirchgessner TG, Lusis AJ, Schotz MC, Lawn RM. Human lipoprotein lipase complementary DNA sequence. Science. 1987;236:1638-1641.
40. Lohse P, Beg O, Brunzell JD, Santamarina-Fojo S, Brewer HB Jr. Familial chylomicronemia: identification of a unique patient homozygous for two separate mutations in the LPL gene. Arterioscler Thromb. 1991;11:1415a. Abstract.
41. Bensadoun A. Lipoprotein lipase. Annu Rev Nutr. 1991;11:217-237. [Medline] [Order article via Infotrieve]
42.
Derewenda ZS, Cambillau C. Effects of gene mutations in
lipoprotein and hepatic lipase as interpreted by a molecular model of
the pancreatic triglyceride lipase. J Biol Chem. 1991;266:23112-23119.
43.
Semenkovich CF, Wims M, Noe L, Etienne J, Chan L. Insulin
regulation of lipoprotein lipase activity in 3T3-L1 adipocytes is
mediated at posttranscriptional and posttranslational levels. J
Biol Chem. 1989;264:9030-9038.
44. Taskinen M-R. Lipoprotein lipase in hypertriglyceridemias. In: Borensztajn J, ed. Lipoprotein Lipase. Chicago, Ill: Evener Publishers Inc; 1987:201-225.
45. Eckel RH. Adipose tissue lipoprotein lipase. In: Borensztajn J, ed. Lipoprotein Lipase. Chicago, Ill: Evener Publishers Inc; 1987:79-132.
46. Schwartz RS, Brunzell JD. Increase of adipose tissue lipoprotein lipase activity and weight loss. Metabolism. 1981;67:1425-1430.
47. Tenkanen H, Taskinen M-R, Antikainen M, Ulmanen I, Kontula K, Enholm C. A novel amino acid substitution (His183 Gln) in exon 5 of the lipoprotein lipase gene results in loss of catalytic activity: phenotypic expression of the mutant gene in a heterogenous state. J Lipid Res. 1994;35:220-228. [Abstract]
48.
Cardin AD, Weintraub HJR. Molecular modeling of
protein-glycosaminoglycan interactions. Arteriosclerosis. 1989;9:21-32.
49.
Hata A, Ridinger DN, Sutherland S, Emi M, Shuhua Z, Myers RL,
Ren K, Cheng T, Inoue I, Wilson DE, Iverius P-H, Lalouel J-M. Binding
of lipoprotein lipase to heparin: identification of five critical
residues in two distinct segments of the amino terminal domain. J
Biol Chem. 1993;268:8447-8457.
50.
Nevin DN, Brunzell JD, Deeb SS. The LPL gene in individuals
with familial combined hyperlipidemia and decreased LPL activity.
Arterioscler Thromb. 1994;14:869-873.
51.
Gagne E, Genest J Jr, Zhang H, Clarke LA, Hayden MR. Analysis
of DNA changes in the LPL gene in patients with familial combined
hyperlipidemia. Arterioscler Thromb. 1994;14:1250-1257.
This article has been cited by other articles:
 |
|
 |
|
  J. Rip, M. C. Nierman, C. J. Ross, J. W. Jukema, M. R. Hayden, J. J.P. Kastelein, E. S.G. Stroes, and J. A. Kuivenhoven Lipoprotein Lipase S447X: A Naturally Occurring Gain-of-Function Mutation Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1236 - 1245. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yang, E. Ruiz-Narvaez, T. Niu, X. Xu, and H. Campos Genetic variants of the lipoprotein lipase gene and myocardial infarction in the Central Valley of Costa Rica J. Lipid Res., November 1, 2004; 45(11): 2106 - 2109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Brousseau, A. L. Goldkamp, D. Collins, S. Demissie, A. C. Connolly, L. A. Cupples, J. M. Ordovas, H. E. Bloomfield, S. J. Robins, and E. J. Schaefer Polymorphisms in the gene encoding lipoprotein lipase in men with low HDL-C and coronary heart disease: The Veterans Affairs HDL Intervention Trial J. Lipid Res., October 1, 2004; 45(10): 1885 - 1891. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Lopez-Miranda, G. Cruz, P. Gomez, C. MarIn, E. Paz, P. Perez-MartInez, F. J. Fuentes, J. M. Ordovas, and F. Perez-Jimenez The Influence of Lipoprotein Lipase Gene Variation on Postprandial Lipoprotein Metabolism J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4721 - 4728. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Merkel, R. H. Eckel, and I. J. Goldberg Lipoprotein lipase: genetics, lipid uptake, and regulation J. Lipid Res., December 1, 2002; 43(12): 1997 - 2006. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. L. Ruel, D. Gaudet, P. Perron, J. Bergeron, P. Julien, and B. Lamarche Characterization of LDL Particle Size Among Carriers of a Defective or a Null Mutation in the Lipoprotein Lipase Gene: The Quebec LIPD Study Arterioscler Thromb Vasc Biol, July 1, 2002; 22(7): 1181 - 1186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. H. McGladdery and J. J. Frohlich Lipoprotein lipase and apoE polymorphisms: relationship to hypertriglyceridemia during pregnancy J. Lipid Res., November 1, 2001; 42(11): 1905 - 1912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. J. Kim, R. A. Williamson, K. Chen, J. L. Smith, J. C. Murray, and D. C. Merrill Lipoprotein Lipase Gene Mutations and the Genetic Susceptibility of Preeclampsia Hypertension, November 1, 2001; 38(5): 992 - 996. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Hölzl, H. G. Kraft, H. Wiebusch, A. Sandhofer, J. Patsch, F. Sandhofer, and B. Paulweber wo novel mutations in the lipoprotein lipase gene in a family with marked hypertriglyceridemia in heterozygous carriers: potential interaction with the polymorphic marker D1S104 on chromosome 1q21-q23 J. Lipid Res., May 1, 2000; 41(5): 734 - 741. [Abstract] [Full Text]
|
|
|
|
|
|
S. M. Clee, N. Bissada, F. Miao, L. Miao, A. D. Marais, H. E. Henderson, P. Steures, J. McManus, B. McManus, R. C. LeBoeuf, et al. Plasma and vessel wall lipoprotein lipase have different roles in atherosclerosis J. Lipid Res., April 1, 2000; 41(4): 521 - 531. [Abstract] [Full Text]
|
|
|
|
|
|
M. E. Wittekoek, E. Moll, S. N. Pimstone, M. D. Trip, P. J. Lansberg, J. C. Defesche, J. J. van Doormaal, M. R. Hayden, and J. J. P. Kastelein A Frequent Mutation in the Lipoprotein Lipase Gene (D9N) Deteriorates the Biochemical and Clinical Phenotype of Familial Hypercholesterolemia Arterioscler Thromb Vasc Biol, November 1, 1999; 19(11): 2708 - 2713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. J. G. Sijbrands, M. J. V. Hoffer, A. E. Meinders, L. M. Havekes, R. R. Frants, A. H. M. Smelt, and P. De Knijff Severe Hyperlipidemia in Apolipoprotein E2 Homozygotes Due to a Combined Effect of Hyperinsulinemia and an SstI Polymorphism Arterioscler Thromb Vasc Biol, November 1, 1999; 19(11): 2722 - 2729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. E. Aouizerat, H. Allayee, R. M. Cantor, G. M. Dallinga-Thie, C. D. Lanning, T. W. A. de Bruin, A. J. Lusis, and J. I. Rotter Linkage of a Candidate Gene Locus to Familial Combined Hyperlipidemia : Lecithin:Cholesterol Acyltransferase on 16q Arterioscler Thromb Vasc Biol, November 1, 1999; 19(11): 2730 - 2736. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cheng, M. A. Grow, C. Pallaud, W. Klitz, H. A. Erlich, S. Visvikis, J. J. Chen, C. R. Pullinger, M. J. Malloy, G. Siest, et al. A Multilocus Genotyping Assay for Candidate Markers of Cardiovascular Disease Risk Genome Res., October 1, 1999; 9(10): 936 - 949. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. H. Wittrup, A. Tybjærg-Hansen, and B. G. Nordestgaard Lipoprotein Lipase Mutations, Plasma Lipids and Lipoproteins, and Risk of Ischemic Heart Disease : A Meta-Analysis Circulation, June 8, 1999; 99(22): 2901 - 2907. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. H. Wittrup, A. Tybjærg-Hansen, R. Steffensen, S. S. Deeb, J. D. Brunzell, G. Jensen, and B. G. Nordestgaard Mutations in the lipoprotein lipase Gene Associated With Ischemic Heart Disease in Men : The Copenhagen City Heart Study Arterioscler Thromb Vasc Biol, June 1, 1999; 19(6): 1535 - 1540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. E. Henderson, J. J. P. Kastelein, A. H. Zwinderman, E. Gagné, J. W. Jukema, P. W. A. Reymer, B. E. Groenemeyer, K. I. Lie, A. V. G. Bruschke, M. R. Hayden, et al. Lipoprotein lipase activity is decreased in a large cohort of patients with coronary artery disease and is associated with changes in lipids and lipoproteins J. Lipid Res., April 1, 1999; 40(4): 735 - 743. [Abstract] [Full Text]
|
|
|
|
|
|
P. J. Talmud, S. Hall, S. Holleran, R. Ramakrishnan, H. N. Ginsberg, and S. E. Humphries LPL promoter -93T/G transition influences fasting and postprandial plasma triglycerides response in African-Americans and Hispanics J. Lipid Res., June 1, 1998; 39(6): 1189 - 1196. [Abstract] [Full Text]
|
|
|
|
|
|
S. E. Humphries, V. Nicaud, J. Margalef, L. Tiret, P. J. Talmud, and f. t. EARS Lipoprotein Lipase Gene Variation Is Associated With a Paternal History of Premature Coronary Artery Disease and Fasting and Postprandial Plasma Triglycerides : The European Atherosclerosis Research Study (EARS) Arterioscler Thromb Vasc Biol, April 1, 1998; 18(4): 526 - 534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Wittekoek, S. N. Pimstone, P. W. A. Reymer, L. Feuth, G.-J. Botma, J. C. Defesche, M. Prins, M. R. Hayden, and J. J. P. Kastelein A Common Mutation in the Lipoprotein Lipase Gene (N291S) Alters the Lipoprotein Phenotype and Risk for Cardiovascular Disease in Patients With Familial Hypercholesterolemia Circulation, March 3, 1998; 97(8): 729 - 735. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ribalta, A. E. LaVille, J. Girona, J. C. Vallve, and L. Masana Low plasma vitamin A concentrations in familial combined hyperlipidemia Clin. Chem., December 1, 1997; 43(12): 2379 - 2383. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chiba, S. Miura, F. Sawamura, R. Uetsuka, I. Tomita, Y. Inoue, K. Tsutsumi, and T. Tomita Antiatherogenic Effects of a Novel Lipoprotein Lipase-Enhancing Agent in Cholesterol-Fed New Zealand White Rabbits Arterioscler Thromb Vasc Biol, November 1, 1997; 17(11): 2601 - 2608. [Abstract] [Full Text]
|
|
|
|
|
|
E. Ehrenborg, S. M. Clee, S. N. Pimstone, P. W.A. Reymer, P. Benlian, C. F. Hoogendijk, H. J. Davis, N. Bissada, L. Miao, S. E. Gagne, et al. Ethnic Variation and In Vivo Effects of the -93t->g Promoter Variant in the Lipoprotein Lipase Gene Arterioscler Thromb Vasc Biol, November 1, 1997; 17(11): 2672 - 2678. [Abstract] [Full Text]
|
|
|
|
|
|
S. Hall, G. Chu, G. Miller, K. Cruickshank, J. A. Cooper, S. E. Humphries, and P. J. Talmud A Common Mutation in the Lipoprotein Lipase Gene Promoter, -93T/G, Is Associated With Lower Plasma Triglyceride Levels and Increased Promoter Activity In Vitro Arterioscler Thromb Vasc Biol, October 1, 1997; 17(10): 1969 - 1976. [Abstract] [Full Text]
|
|
|
|
|
|
B. G. Nordestgaard, S. Abildgaard, H. H. Wittrup, R. Steffensen, G. Jensen, and A. Tybjærg-Hansen Heterozygous Lipoprotein Lipase Deficiency : Frequency in the General Population, Effect on Plasma Lipid Levels, and Risk of Ischemic Heart Disease Circulation, September 16, 1997; 96(6): 1737 - 1744. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. Levak-Frank, P. H. Weinstock, T. Hayek, R. Verdery, W. Hofmann, R. Ramakrishnan, W. Sattler, J. L. Breslow, and R. Zechner Induced Mutant Mice Expressing Lipoprotein Lipase Exclusively in Muscle Have Subnormal Triglycerides yet Reduced High Density Lipoprotein Cholesterol Levels in Plasma J. Biol. Chem., July 4, 1997; 272(27): 17182 - 17190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Jukema, A. J. van Boven, B. Groenemeijer, A. H. Zwinderman, J. H.C. Reiber, A. V.G. Bruschke, J.A. Henneman, G.P. Molhoek, T. Bruin, H. Jansen, et al. The Asp9 Asn Mutation in the Lipoprotein Lipase Gene Is Associated With Increased Progression of Coronary Atherosclerosis Circulation, October 15, 1996; 94(8): 1913 - 1918. [Abstract] [Full Text]
|
|
|
|
 |
|
 P. Benlian, J. L. De Gennes, L. Foubert, H. Zhang, S. E. Gagne, and M. Hayden Premature Atherosclerosis in Patients with Familial Chylomicronemia Caused by Mutations in the Lipoprotein Lipase Gene N. Engl. J. Med., September 19, 1996; 335(12): 848 - 854. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||