Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:468-478

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mailly, F.
Right arrow Articles by Talmud, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mailly, F.
Right arrow Articles by Talmud, P. J.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1995;15:468-478.)
© 1995 American Heart Association, Inc.

Articles

A Common Variant in the Gene for Lipoprotein Lipase (Asp9->Asn)

Functional Implications and Prevalence in Normal and Hyperlipidemic Subjects

France Mailly; Yesim Tugrul; Paul W. A. Reymer; Taco Bruin; Mary Seed; Björn F. Groenemeyer; Anette Asplund-Carlson; David Vallance; Anthony F. Winder; George J. Miller; John J. P. Kastelein; Anders Hamsten; Gunilla Olivecrona; Steve E. Humphries; Philippa J. Talmud

From the Division of Cardiovascular Genetics, Department of Medicine, UCL Medical School, Rayne Institute, London, UK (F.M., S.E.H., P.J.T.); the Department of Medical Biochemistry and Biophysics, University of Umea, Umea, Sweden (Y.T., G.O.); the Lipid Research Group, Department of Vascular Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands (P.W.A.R., T.B., B.F.G., J.J.P.K.); the Department of Medicine, Charing Cross Hospital, London, UK (M.S.); the Atherosclerosis Research Unit, King Gustaf V Research Institute, Stockholm, Sweden (A.A.-C., A.H.); the Department of Chemical Pathology and Human Metabolism, Royal Free Hospital School of Medicine, London, UK (D.V., A.F.W.); and the MRC Epidemiology and Medical Care Unit, Wolfson Institute of Preventive Medicine, The Medical College of St Bart's Hospital, London, UK (G.J.M.).

Correspondence to Dr Philippa Talmud, Department of Medicine, Division of Cardiovascular Genetics, University College London Medical School, The Rayne Institute, University St, London, WC1E 6JJ England.


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowAppendix 1
 down arrowReferences
 
Abstract Subjects with combined hyperlipidemia (CHL) were screened for mutations in the lipoprotein lipase (LPL) gene by single-strand conformational polymorphism, and a previously reported G->A DNA sequence change in exon 2, causing substitution of Asp by Asn at position 9, was identified in 2 individuals. Because this substitution destroys a recognition site for Taq I, pooling of DNA samples, amplification, and digest with Taq I allowed the rapid screening of 1563 healthy individuals and patients of Dutch, Swedish, English, and Scottish origin. In the general populations of all four countries, healthy carriers of the mutation were detected at a frequency of 1.6% to 4.4% (mean, 3.0%; 95% confidence interval, 2.0% to 4.0%). The frequency of carriers was roughly twice as high (range, 4.0% to 9.8%) in selected patients with CHL or type IV hyperlipoproteinemia or in subjects with angiographically assessed atherosclerosis; the frequency was consistently higher in each patient group compared with its matched control group. In 773 healthy men from two general practices in the United Kingdom, 25 carriers and 2 homozygotes for the mutation were identified. In these 27, plasma triglyceride but not plasma cholesterol levels were significantly higher than in noncarriers (2.25 versus 1.82 mmol/L, P<.02), and this difference was maintained in three subsequent annual measurements. Postheparin LPL activity data were available for some carriers and for 7 of 9 individuals from the patient groups, and 6 of 6 individuals from the control groups had LPL activity that was lower than the respective group mean. In vitro mutagenesis and transient expression in COS cells showed that compared with the LPL-Asp9 construct, LPL-Asn9 activity and mass were reduced by 20% to 30% in the culture media. Overall however, LPL-Asn9 had only slightly reduced specific activity (by 18%). Thus, although the precise mechanism of the effect is unclear, the data strongly suggest that the LPL-Asn9 variant is associated with and may play a direct role in predisposing carriers to develop hypertriglyceridemia.


Key Words: familial combined hyperlipidemia • genetic predisposition • lipoprotein lipase


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowAppendix 1
 down arrowReferences
 
A growing body of evidence supports the hypothesis that elevated levels of plasma triglycerides may increase the risk of coronary artery disease (CAD).1 2 A common disorder that is associated with elevated triglyceride levels and increased risk of CAD is familial combined hyperlipidemia (FCHL). This disorder is defined by elevated plasma levels of cholesterol, triglycerides, or both in the proband and in at least one relative,3 4 5 6 but often at a relatively late age of onset (third to fourth decade of life).

The common metabolic defect in FCHL appears to be overproduction of triglyceride-rich, apoB-containing particles from the liver6 7 8 ; this may be accompanied by an increased number of small, dense LDL particles in the blood,9 10 which are believed to be more atherogenic11 than larger, buoyant LDL and may be more susceptible to oxidative damage.12 However, a number of environmental and genetic factors are also thought to contribute to the development of FCHL, which is now widely believed to be a genetically heterogeneous condition (reviewed in Reference 1313 ). DNA polymorphism studies have shown associations between variation in the apoAI-CIII-AIV gene cluster and FCHL,14 15 and in a proportion of FCHL families, cosegregation with this gene cluster and hyperlipidemia has been reported,14 although this finding has not been reproduced by other workers.16 17 Of the three genes in the cluster, overproduction of apoCIII appears to be the most likely cause of hypertriglyceridemia, as apoCIII is known to inhibit lipoprotein lipase (LPL) and hepatic lipase and to interfere with clearance of remnant lipoproteins.13

One key factor that determines the metabolism of triglyceride-rich lipoproteins is the activity of LPL.18 Patients who are homozygous for a mutation in the LPL gene that causes LPL deficiency occur at a frequency of roughly 1 per million and have type I hyperlipoproteinemia with fasting chylomicronemia18 ; thus, carriers for such mutations may be as frequent as 1 in 500. Study of a large kindred with type I hyperlipoproteinemia has shown that some (but not all) relatives who are heterozygous for LPL deficiency have high plasma cholesterol and/or triglyceride concentrations and that this sign is most evident in individuals over 40 years.19 Other reports have noted the presence of hyperlipidemia in obligate heterozygotes for mutations in the LPL gene, with multiple lipoprotein phenotypes reminiscent of FCHL. Recently, studies from the United States have demonstrated that a proportion (one fifth to one third) of FCHL patients have levels of postheparin LPL activity and mass below the 10th percentile for the general population.20 21 In confirmation of these results, a study of UK patients with combined hyperlipidemia (CHL) and a family history of hyperlipidemia or CAD has recently reported that 37% have LPL levels below the 10th percentile of control values.22 These data suggest that partial LPL deficiency, either genetic or acquired, may underlie the phenotype of FCHL in some patients.

We investigated the role of LPL mutations in the development of CHL and identified a common variant in the LPL gene that is associated with low LPL activity and hypertriglyceridemia. We now report on the frequency of this mutation, its effect on LPL activity in patients and healthy carriers, and on the findings of in vitro expression studies.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowAppendix 1
 down arrowReferences
 
Study Subjects
Most groups of individuals examined in this study have been described in detail elsewhere. The initial search for mutations by single-strand conformational polymorphism (SSCP) screening was performed for 15 individuals with CHL who had been recruited at Charing Cross Hospital, London, as part of a larger study,22 and 10 Swedish individuals who were participating in a case-control study of myocardial infarction (MI) at a young age.23 LPL activity in the lower third of the each sample distribution was used as the selection criterion for this screening.

Specific screening for the Asp9->Asn substitution was undertaken in DNA samples obtained through five separate studies: (1) 93 control subjects and 100 patients who were taking part in a Swedish study of MI before age 4523 ; (2) 61 normotriglyceridemic individuals from Sweden who were matched for age with 65 hypertriglyceridemic individuals from a community-based survey in Stockholm county24 ; (3) 240 Dutch subjects with CHL who were followed up at the Lipid Research Clinic of the University of Amsterdam and 190 normolipidemic healthy control subjects of Dutch origin who were recruited from a risk factor study and matched with the CHL group for age and sex (individuals with plasma lipid levels above the 95th percentile for age and sex were excluded); (4) 360 male subjects aged 40 to 64 from a general practice in southern England and 413 male subjects from a general practice in Scotland, all of whom had been recruited as part of the Northwick Park Heart Study II project25 and were free of CAD at the time of entry into the study, as assessed by questionnaire and electrocardiography; and (5) 41 consecutive patients with CHL from the Lipid Clinic of Charing Cross Hospital, 93% of whom had a family history of hyperlipidemia.22

Biochemical Analysis
Cholesterol and triglycerides determined by standard colorimetric methods22 and biometric data previously obtained for each study were used for comparison of carriers with noncarriers. Approval was obtained from the appropriate institutional ethics review boards for measurement of LPL activity. Blood samples were collected in the fasting state 15 minutes after an intravenous heparin injection (50 or 100 U/kg body weight) was given, and separated plasma was snap-frozen in a dry ice/ethanol bath and kept at -70°C until analysis. Postheparin LPL activity in plasma was determined by one of two methods, using a stabilized, tritiated triolein emulsion as the substrate. For samples from the Charing Cross study22 and the Swedish young MI study control group,23 LPL activity was measured as described by Nilsson-Ehle and Ekman,26 whereas the method of Karpe et al27 was used for all other samples. Six subjects were recalled for reanalysis of plasma LPL by chromatography on heparin-Sepharose columns as described.28 Briefly, a blood sample was obtained before and after injection of heparin, 10 mL plasma was injected in the column, and 1-mL fractions were eluted with increasing salt concentration. Total lipase activity was measured in individual fractions, as previously described,27 whereas LPL mass was determined by an enzyme-linked immunosorbent assay with a chicken polyclonal antibody as the capture antibody and monoclonal antibody 5D2 as the detection antibody.29 The stability (resistance to denaturation) of LPL in carriers and noncarriers of FCHL was studied by preincubating samples of enzyme fractions from heparin-Sepharose columns at 37°C before performing the activity assay.

DNA Analysis
Blood was collected in 10-mL Na-EDTA tubes and kept frozen at -20°C. DNA was extracted by the salting-out method30 or as previously described.31 Polymerase chain reaction (PCR) amplification of LPL exon 2, yielding a 237-bp product, was achieved on a Cambio machine with a "touchdown" program in the plate mode, using primers on either side of exon 2 (sequence from Oka et al32 ). The sequence of these oligonucleotides (ABC Biotechnology) is as follows: left hand, 5' CTC CAG TTA ACC TCA TAT CC 3'; right hand, 5' CAC CAC CCC AAT CCA CTC 3'.

Following denaturation at 98°C (1 minute, except for 5 minutes at 97°C during the first cycle), the annealing temperature was decreased from 70°C to 55°C in five steps (70°C, 65°C, 60°C, 58°C, and 55°C) over six cycles while the extension conditions were kept constant at 72°C for 1.5 minutes. The reactions were carried out in standard buffer supplied by GIBCO-BRL (10x buffer is 500 mmol/L KCl; 100 mmol/L Tris-HCl, pH 8.3; 2 mmol/L each dNTP; and 0.01% gelatin) with 100 ng of each primer, 5% W-1 detergent, and 0.5 U Taq polymerase (GIBCO-BRL) per reaction at a final MgCl2 concentration of 1.7 mmol/L. For SSCP analysis, amplification was performed as described above, except that 0.2 µL [{alpha}-32P]dCTP at 10 µCi/µL (3000 mCi/mmol, Amersham) was added to each sample. An aliquot of the PCR product was then diluted fivefold in 0.1% SDS–10 mmol/L Na-EDTA and kept frozen until needed. DNA was separated into single strands by the method of Orita et al,33 with minor modifications. Samples were denatured by boiling and were separated by gel electrophoresis for 18 hours on a 10% glycerol/7.5% polyacrylamide gel (40 cm, 0.4 mm thick, with a 50:1 ratio of acrylamide/bisacrylamide) at a constant 15-mA current. Direct sequencing of variants detected by SSCP was carried out by using the same primers as in the amplification reaction. The PCR product was purified using the Geneclean II kit (Bio101) and then sequenced by the dideoxy method of Green et al,34 using modified T7 polymerase (Sequenase, US Biochemical Corp).

The G->A substitution destroys a site for Taq I, and for rapid screening of this substitution, DNA samples were pooled in groups of five and amplified as described above. Pooled samples were then digested with Taq I according to the manufacturer's instructions and analyzed on 10% acrylamide gels (80x70x1 mm) using a Hoefer "Mighty Small" vertical electrophoresis apparatus. Samples were run for 1 hour at 30 mA. Detection of fragments was achieved by silver staining according to the method of Merrill et al,35 but with a shorter (1 minute) nitric acid immersion time and brief (2x <20 seconds) distilled water rinses to compensate for the thinness of the gels. The bands were seen at 179 and 52 bp (G–Taq I cutting–Asp9) or 179 and 58 bp (A–Taq I not cutting–Asn9). Samples from pooled DNA showing the 58-bp band were individually reamplified and processed as described above for final identification of Asn9 carriers. Genotypes for Pvu II and HindIII were determined by PCR using the same primers and amplification conditions as described previously.36

Site-Directed Mutagenesis and Transient Expression Studies
In vitro site-directed mutagenesis was used to synthesize the Asn9 mutant allele (Altered Sites mutagenesis system, Promega). A 2.4-kb fragment of the LPL cDNA containing the entire coding sequence was inserted in the antisense orientation in the pSelect phagemid vector with a defective ampicillin resistance gene. Single-stranded vector containing the full-length LPL-Asp9 cDNA was produced by coinfection of JM109 bacteria with phage R408 and isolated by precipitation with 0.25 vol 20% polyethylene glycol–3.75 mol/L ammonium acetate. The purified material was then annealed to the mutagenic oligonucleotide (5'–ACTTTCGATGTTGATAAAATCT–3') and to the ampicillin repair primer, and second-strand synthesis was performed according to the manufacturer's recommendations. Following two rounds of transformation with ampicillin selection, phagemid DNA from resistant colonies was isolated by standard methods and checked for the presence of the mutation by direct sequencing. After reamplification, a positive LPL insert was excised from pAlter by digest with Xba I/Pst I, purified by electrophoresis and elution on a Spin-Bind column (Biozym), and ligated into the linearized pcDNAI expression vector (Invitrogen Corp) in the sense orientation. The resulting pcDNAI–LPL-Asn9 construct had the LPL cDNA under control of the cytomegalovirus promoter and expressed the Tyr tRNA suppresser gene (synthetic SupF gene). When used to transform mc1061 bacteria harboring the mutant p3 plasmid (Invitrogen Corp), this construct conferred ampicillin and tetracycline resistance to mc1061/p3 cells. Large-scale purification of pcDNAI–LPL-Asn9 and pcDNAI-LPL plasmids for transfection was achieved with the Circle Prep kit (Bio101). The purity of plasmid DNA preparations was confirmed spectroscopically and electrophoretically to confirm the absence of contaminating bacterial DNA and by sequencing of the plasmid to confirm its identity and ensure that no other sequence changes had been introduced during manipulation.

The DEAE-dextran method37 was used for transfection of COS B cells. Briefly, the DNA to be transfected was diluted in 2.5 mL Dulbecco's modified Eagle's medium with 51.6 µg/mL chloroquine and then mixed 1:1 (vol/vol) with a 0.6-mg DEAE-dextran solution. Plasmid DNA (5 µg) was used for each 60-mm dish (50% to 80% confluent). The cells were washed once with medium, and the transfection mixture was added for 3.5 hours. The cells were shocked briefly (1 minute) with DMSO, washed once with PBS, and then allowed to recover with medium containing 10% fetal calf serum. Samples of medium were collected and cells harvested 3 days after transfection, with heparin (20 U/mL medium) being added to half of the dishes 2 hours prior to collection. All material was snap-frozen and kept at -70°C until assayed as described previously.26 27

Statistical Analysis
The gene-counting method with a {chi}2 test and Yates' correction was used to compare the frequencies of the Asn9 variant allele between the different groups. The estimate of relative risk (RR) of being a carrier was calculated by standard techniques. To compare RRs between samples, the estimates of logeRR were weighted by the reciprocal of the sampling variance. The estimates are combined by calculating a weighted mean and are tested for heterogeneity by a {chi}2 index (Woolf's method).38 All other tests and transformations were performed with the SPSS statistical package. The Mann-Whitney nonparametric test and t test were used to compare levels of lipid traits, LPL activity, and LPL mass between carriers and noncarriers of the Asn9 variant in healthy men from the two UK studies. To test differences in triglyceride levels, values were logarithmically transformed prior to statistical analysis. Statistical significance was considered at P<.05.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowAppendix 1
 down arrowReferences
 
Screening of LPL exons 2 through 6, 8, and 9 for mutations was undertaken using SSCP in a group of 25 hyperlipidemic subjects who were selected on the basis of low LPL activity. A number of SSCPs were detected, but data for only one of these SSCPs will be presented here. This variant pattern in exon 2 (Fig 1aDown) was detected in 3 individuals, 2 from the CHL, low-LPL group from Charing Cross Hospital and 1 from the low-LPL patient group from the Swedish young MI study. No pattern differences in any other exons were detected for these 3 individuals. Direct sequencing of exon 2 revealed a G->A transition at position 280 (sequence numbering according to Wion et al39 ) (Fig 1bDown), resulting in the substitution of Asn for Asp at amino acid residue 9. This mutation was previously reported in a patient with type I hyperlipoproteinemia, who, in addition to being homozygous for the Asn9 variant, was homozygous for the Tyr262->His substitution.40 This second base change was not present in the carrier subjects studied here.



View larger version (12K):
[in this window]
[in a new window]
  		Figure 1. a, Single-strand (ss) conformational polymorphism in a double-strand (ds) 237-bp polymerase chain reaction (PCR) product containing exon 2 of the lipoprotein lipase (LPL) gene. Arrows show a doublet in two samples. b, Direct sequencing of LPL exon 2, showing a G->A substitution (*) at nucleotide 280, creating the Asp->Asn substitution at position 9 of the polypeptide. c, Schematic of LPL exon 2 and Taq I digest of the exon 2 PCR product for the detection of carriers of the Asp9->Asn substitution, showing location of the variant (dotted vertical arrow) and constant (filled vertical arrow) Taq I sites in exon 2, and resulting 52-, 58-, and 179-bp fragments following Taq I digest and separation on 10% polyacrylamide gel. Horizontal arrows indicate positions of the primers used for amplification of LPL exon 2.

This G->A transition was predicted to abolish a Taq I restriction site, resulting in the production of a 58-bp variant fragment, larger than the wild-type 52-bp fragment, upon digest of the exon 2 PCR product with this enzyme (Fig 1cUp). To estimate the frequency of this base change in hyperlipidemic individuals and to determine whether it was present in apparently healthy individuals, a rapid screening strategy was developed on the basis of pooling the DNA samples prior to PCR amplification. Four to six DNA samples were pooled, amplified, and digested with Taq I. Individual samples from pools found to be positive were then reamplified and redigested for final identification of carriers. Mixing experiments (not shown) demonstrated that this method had the sensitivity to identify a carrier from a pool of as many as 10 samples (1 mutant allele from a total of 20), but given the frequency of this variant, pools of four to six individual samples were optimal.

Patients from England, two groups from Sweden, and one group from the Netherlands who had been selected on the basis of either being hyperlipidemic or having suffered an MI before the age of 45 were screened. Each patient group had a comparison group of control subjects from each general population; the general characteristics, lipid levels, and LPL activities (where available) of these groups are summarized in Table 1Down. A total of 37 Asn9 carriers were identified. As shown in Table 2Down, in the four control groups the frequency of carriers was between 1.6% and 2.5% (mean, 2.2%; 95% confidence interval, 1.1% to 3.2%) with no significant evidence for heterogeneity in frequency between groups ({chi}2=0.34, P=.89). One individual in the general practice control group from England was homozygous for the Asn9 mutation. In each group of patients the frequency of carriers was roughly twice as high as in the matched control group. The frequency was fourfold higher (9.8% versus 2.5%) when the CHL sample from Charing Cross Hospital was compared with control subjects in the English general population. The two study groups from Sweden had similar frequency differences, with a prevalence almost twofold higher in young MI patients compared with their healthy counterparts (4.0% versus 2.2%) and more than threefold higher in hypertriglyceridemic compared with normotriglyceridemic individuals (5.0% versus 1.6%). In the Dutch CHL group the frequency was threefold higher compared with Dutch control subjects (4.9% versus 1.6%). There was no significant difference (P=.91) between studies in the RR of being a carrier in patients compared with control subjects.


View this table:
[in this window]
[in a new window]
  		Table 1. General Description of Population Samples Screened for the Asp9->Asn Substitution


View this table:
[in this window]
[in a new window]
  		Table 2. Frequency of Asn9 Carriers in Patients With Hyperlipidemia or Premature Myocardial Infarction and Control Subjects of Dutch, English, and Swedish Origin and the Relative Risk of Being a Carrier

To examine the effect of the mutation on plasma lipid levels, an additional 413 healthy men from a general practice in Scotland were screened. Their characteristics were similar to the English control group (Table 1Up), and 18 carriers (including one homozygote) were identified. The frequency of carriers in this group was 4.4%, which is higher (but not significantly, {chi}2=1.74 by gene counting, P>.2) than the frequency in the English group. As shown in Table 3Down, after data from the two groups of healthy men from England and Scotland were combined, those with at least one allele for LPL-Asn9 had significantly higher (24%) plasma triglyceride levels than did noncarriers, with no other significant differences in measured traits between groups. The individual data for triglycerides and cholesterol are shown in Fig 2aDown, which reveals considerable scatter in triglyceride levels, with one homozygote having a relatively low and the other a relatively high level. The individual triglyceride and cholesterol levels for the Dutch and Swedish control groups are also shown in Fig 2aDown, and 5Down of 6 individuals have triglyceride values above their respective sample mean.


View this table:
[in this window]
[in a new window]
  		Table 3. Mean±SEM Plasma Lipid Levels at Baseline in Healthy Lipoprotein Lipase (LPL)–Asp9 and LPL-Asn9 Carriers From England and Scotland



View larger version (19K):
[in this window]
[in a new window]
  		Figure 2. a, Plot of triglyceride and cholesterol data in healthy carriers of the lipoprotein lipase (LPL)–Asn9 mutation from the two UK samples and from the Swedish and Dutch studies (others). Also shown are the mean±SEM of data from the UK samples for noncarriers. Filled symbols are individual data from homozygotes for the mutation. Some unfilled circles represent more than one individual. b, Plot of mean±SEM plasma triglyceride levels in carriers and noncarriers from the two UK general practices as a function of time. Mean values are shown at baseline and at three subsequent annual measurements for 22 individuals, with no missing data. Data for both noncarriers (P<.0001) and LPL-Asn9 carriers (P=.07) show a negative trend over time. The two groups do not differ in trend (P=.61).



View larger version (22K):
[in this window]
[in a new window]
  		Figure 5. Alignment of predicted amino-terminal sequences in mature lipoprotein lipase (LPL) from five species39 : human LPL (hLPL), mouse LPL (mLPL), bovine LPL (bLPL), guinea pig LPL (gpLPL), and chick LPL (cLPL). Arrow shows the Asp9 residue (boldfaced type), and upper-case letters represent conserved residues relative to human LPL. Underlined residues in human LPL indicate the position of a predicted ß-strand, according to Derewenda and Cambillau.42

In 22 male Asn9 carriers from the United Kingdom, complete lipid data were available for baseline and three subsequent annual measurements, and these are shown in Fig 2bUp. In the group of noncarriers (n=631) there was a small (but significant, P=.001) decrease in plasma triglyceride level over the 3 years, but the significantly higher plasma triglyceride level in LPL-Asn9 carriers was maintained (P=.01 overall). The slightly lower cholesterol levels in carriers at baseline were also maintained over time, but overall, this difference was still not significant (5.35±0.18 mmol versus 5.66±0.04, P=.1). To investigate the potential role of obesity in the development of elevated plasma triglyceride levels in carriers, lipid levels were determined in those men with a body mass index (BMI) in the lowest tertile (<25.0 kg/m2) and in the upper two tertiles combined. In noncarriers from the two UK general practice samples, plasma triglyceride values were, as expected, higher in those with a BMI in the upper tertiles (1.54 versus 1.94 mmol/L, 26% higher), but in carriers the effect associated with BMI was larger (1.35 versus 2.93 mmol/L, 117% higher), although this difference did not reach conventional levels of significance (BMIxgenotype interaction, P=.07).

Where available, LPL activity data were examined for the Asn9 carriers. Fig 3Down shows individual LPL activity values from the various studies plotted against each group's own mean. From the patient groups, 7 of 9 carriers and from the control groups 3 of 3 carriers had activity measurements below their group mean, and this represented a 15% to 40% decrease in LPL activity relative to their respective sample means (data not shown). Without LPL mass data, it was impossible to distinguish whether this difference between carriers and noncarriers was due to lower specific activity of the mutant enzyme or overall decreased release or secretion of LPL from the cells. To examine this question, experiments were carried out to characterize biochemically the Asn9 variant by analyzing postheparin LPL activity and mass in normolipidemic carriers. Three Asn9 carriers from the English general practice sample were recalled, and samples from three noncarrier normal laboratory control subjects were taken for comparison. In the carriers, mean total LPL activity was 30% lower (177 versus 251 mU/mL) and mass 30% lower (985 versus 1538), although these differences did not reach significance (t test, P=.12 for mass and P=.16 for activity). Separation of plasma by heparin-Sepharose did not reveal any striking differences in LPL activity or mass elution profiles between carriers and noncarriers. In particular, there was no clear variation in the ratio of the two mass peaks or the two areas under the curve, representing inactive monomeric LPL and active dimeric LPL, respectively; both forms eluted in the expected fractions (not shown). The semipurified LPL from both Asn9 carriers and noncarriers had a similar stability incubation at 37°C (not shown). Activity was then measured for 22 hours. No striking difference in substrate affinity was observed between lipase preparations from carriers and noncarriers (not shown).



View larger version (13K):
[in this window]
[in a new window]
  		Figure 3. Postheparin lipoprotein lipase (LPL) activity in patients and control subjects (Cont) from the Charing Cross (UK) and Swedish (Swd) studies. Data from the Swedish normotriglyceridemic (NTG) and hypertriglyceridemic (HTG) groups are plotted against the scale on the right. The mean±SD for each group is also shown. CHL indicates combined hyperlipidemic; YMI, young myocardial infarction (survivors).

To determine whether the mutation causing the Asn9 substitution may have occurred on more than one occasion, genotypes for the Pvu II (intron 6) and HindIII (intron 8) polymorphic sites were determined for all identified Asn9 carriers except those in the Scottish sample. In 28 individuals for whom unambiguous haplotypes could be determined, two distinct Asn9 haplotypes that differed at the Pvu II site were identified. Seven individuals were P-P-/H+H+ homozygotes (ie, noncutting for Pvu II but cutting for HindIII) and thus carried the Asn9 variant on a P-H+ haplotype; 4 individuals were homozygous for the P+H+ haplotype; and in 12 individuals who were heterozygous for the Pvu II restriction site, either haplotype could carry the Asn9 variant. Of the remaining 5 subjects for whom data on both polymorphisms were available, 1 was homozygous and 4 were heterozygous for a third, rarer carrier haplotype, P-H-. Among the healthy men from the United Kingdom, those with different Pvu II/HindIII genotypes had similar levels of plasma triglycerides (not shown), and of those with low LPL activity, 2 had the commonest P-H+ carrier haplotype and 1 had the P+H+ haplotype, but the haplotype could not be determined unambiguously in the remaining 6 individuals (P+P-/H+H-).

To confirm that these effects on LPL activity and plasma triglycerides were due to a direct effect of the Asp9->Asn substitution, the Asn9 variant was constructed by site-directed mutagenesis and expressed in vitro. Following transfection of Asn9 and Asp9 constructs in COS cells, cells and media were collected and tested for LPL activity and mass, and data from three separate experiments are summarized in Table 4Down. In all experiments, LPL activity and mass were measured in the medium in separate plates, both before and after addition of heparin to release LPL from the cell surface. In cells transfected with the Asn9 construct, both activity and mass in the medium were lower than for the Asp9 construct, and this was seen in all experiments and in all nine replicates from three experiments. There was an overall reduction of approximately 20% to 30% (range, 18% to 40% for activity and 6% to 32% for mass), with similar results for mass and activity measurement in the medium before and after addition of heparin. However, because both activity and mass were decreased, the reduction in LPL specific activity was smaller and not statistically significant (range, 12% to 22%). Levels of activity and mass within cells were measured in all plates, and these values showed a large scatter, with mass measurements being threefold to fourfold higher than in the medium. Overall, there was no clear evidence of intracellular accumulation of LPL-Asn9 (data not shown). Preheparin media from several plates were pooled in the fourth transfection experiment and passed through a heparin-Sepharose affinity column to separate the excess monomer LPL protein associated with these in vitro assays. The resulting profile still showed decreased dimer mass and activity for the Asn9 construct, with no apparent elution shift of the dimer peak for the mutant, suggesting that the affinity for heparin was not altered (Fig 4Down). There were no significant differences in the monomer to dimer mass ratio, as assessed by the areas under the curve or by peak fractions. The stabilities of LPL-Asp and LPL-Asn were compared by measuring activity in the medium from cells incubated at 37°C for 2 hours. LPL activity declined slowly over this time at a similar rate for both constructs (not shown).


View this table:
[in this window]
[in a new window]
  		Table 4. In Vitro Expression of the Asn9 Variant: Lipoprotein Lipase (LPL) Activity and Mass in Media From Transfected Cells



View larger version (20K):
[in this window]
[in a new window]
  		Figure 4. Plots of lipoprotein lipase (LPL) activity (act, open symbols) and mass (filled symbols) in pooled media from transfected cells after separation by heparin-Sepharose chromatography. Cells were transfected with either the LPL-Asn9 construct (ASN9) (lower graph, circles) or with the LPL-Asp9 construct (ASP9) (upper graph, diamonds). One milliunit (mU) corresponds to 1 nmol of fatty acid per minute.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowAppendix 1
 down arrowReferences
 
Many individuals who develop hyperlipidemia report a family history of hyperlipidemia and/or CAD,3 4 although the observed disease pattern may be incompatible with the inheritance of a single major gene. In most families, several different genes are likely to contribute, with their effects being modified by environmental factors, so that each family has a different constellation of causative genetic and environmental factors. In this model, a mutation that alters the function of a given gene would confer susceptibility but have insufficient impact on its own to cause disease. Such a mutation would therefore be present in healthy individuals in the general population but would be found more frequently in patients with hyperlipidemia, and the data we report here suggest that the common Asp9->Asn variant in the LPL gene is such a mutation. The frequency of carriers of the mutation in the healthy populations of southern England, the Netherlands, and Sweden ranged between 1.6% and 2.5%, with a slightly higher frequency observed in healthy men from Scotland. The presence of the mutation in individuals from four different European countries suggests that it may be present in other Caucasian groups, but further studies are needed for a more accurate estimate of gene frequency. The frequency of carriers of the mutation was consistently higher in Swedish MI patients and Swedish, English, and Dutch hyperlipidemic cases than in their corresponding general population control groups. Although combining data from the different patient groups is invalid because the selection criteria are different, the consistently higher frequency in the patient groups strongly suggests that the LPL-Asn9 variant is associated with and contributes to the development of hyperlipidemia.

The hypothesis that the Asn9 substitution has a direct effect on LPL function is supported by data from in vivo studies. In 34 of the carriers, three distinct two–restriction fragment length polymorphism Asn9 haplotypes were identified, suggesting that the mutation has occurred more than once, a likely possibility, considering that a mutable CpG dinucleotide is involved. All three haplotypes were associated with diminished LPL activity and increased triglyceride levels, thus making it less likely that the Asn9 variant is in linkage disequilibrium with an unidentified functional mutation elsewhere in the coding region or in the upstream promoter region of the LPL gene. In addition, as shown in Fig 5Up, the Asp9 residue for LPL is completely conserved across species from guinea pig to human and is proximal to a ß-strand motif, a highly conserved element among lipases,41 42 suggesting its importance in the maintenance of enzyme structure.

In most carriers of the LPL-Asn9 variant, LPL activity is below the mean for noncarriers, although this effect is more consistent in the healthy group (3 of 3) than in the patients (7 of 9). This is not surprising, because although a positive correlation between plasma triglyceride levels and LPL activity has been reported in normolipidemic individuals, such a correlation has not been observed in hypertriglyceridemic (HTG) patients, suggesting that in HTG other factors modify this relationship.43 44 45 In the healthy men from the United Kingdom, mean triglyceride levels of those carrying the Asn9 variant are elevated 24% above noncarriers, but Fig 3Up shows that only 23 of 33 Asn9 carriers have triglyceride values above the group mean. Thus, 10 carriers, including 1 homozygote, have plasma triglyceride levels that are not elevated, and this suggests that in some carriers, another factor, either genetic or environmental, must be interacting to cause the HTG. Factors that cause increased production of triglyceride-rich lipoproteins from the liver, such as diet or obesity, are obvious possibilities, and in the healthy carriers, an increased BMI (>25.0 kg/m2) was associated with a greater elevation of plasma triglycerides than in noncarriers. Of the 2 Asn9-variant homozygotes, only 1 was HTG. The second had a BMI that was 18% lower than the sample mean (21.9 versus 26.6 kg/m2), and this low BMI may have masked the effect of homozygosity for the LPL mutation.

In the carriers identified in the patient groups, low LPL activity was observed in 7 of 9 patients (the exceptions being 1 from the Charing Cross CHL group and 1 from the Swedish HTG group). Several explanations could account for this observation. LPL is synthesized in both skeletal muscle and adipose tissue, and LPL expression is controlled in a complex tissue-specific manner by factors such as insulin levels, obesity, diet, and alcohol intake.43 44 45 In humans, hyperinsulinemia (together with obesity) has been shown to increase adipose tissue LPL activity.45 Although insulin levels were not measured in these 2 carriers, each was markedly above ideal body weight; in fact, 1 had been on a diet at the time of sampling; and weight loss also is often associated with a long-term increase in adipose tissue LPL activity.46 Recent studies have shown that heterozygotes for the LPL-Thr183 mutation, which completely abolishes LPL activity in vitro, have LPL activity values within the normal range,47 and this raises the possibility that in some circumstances there may be a compensatory upregulation of the functional allele.

In the in vitro experiments, although there was some variation in results, lower activity and mass were consistently observed in the medium from transfected COS cells. The observed variability is not surprising, because the transient expression systems (for several reasons) are not ideal for testing relatively small differences. Although the number of cells per plate was kept constant within each experiment, there was no control for transfection efficiency. However, this issue was at least partially addressed by using multiple dishes, randomized to the two constructs; by combining data from several plates; and by the consistency of results in repeated experiments. The data for nine replicates of three experiments show that cells transfected with the LPL-Asn9 construct consistently had lower levels of LPL activity (by 18% to 40%) and mass (by 6% to 32%) than did plates of cells with the wild-type construct. This small effect on activity and mass is consistent with the in vivo data: in the three normolipidemic carriers who were recalled, mean LPL activity and mass were reduced by 25% to 30%. However, both in vivo and in vitro, specific activity was within the range for the wild-type LPL-Asp9 construct.

Our in vitro experiments suggest that LPL-Asn9 has a specific activity within the normal range, as originally reported.40 The stability of the LPL-Asn9 secreted by COS cells did not differ from that of LPL-Asp9, and binding affinity and the ability to bind heparin appear unchanged, suggesting that the lower mass and activity in the medium were not caused by impaired LPL release from the cell surface. This is not surprising, since the main heparin-binding domain has been proposed to lie between amino acids 270 and 305,48 49 which are predicted to be distant from the N-terminal sequence in the tertiary structure of LPL. The data from these two sets of experiments raise the possibility that the Asn9 substitution may impair secretion, which might lead to intracellular accumulation of LPL. This could not be accurately determined in these experiments due to the difficulty in measuring low levels of active LPL enzyme and in distinguishing inactive monomer from active dimer forms in the cell lysates. These issues could be resolved by cell fractionation and metabolic labeling experiments in permanently transfected cell lines.

One question still to be addressed is the relative proportion of LPL present as the Asn9 variant protein in the plasma of carriers and the ability of the Asn9 monomer to associate intracellularly with the Asp9 monomer. Theoretically, roughly half of plasma LPL activity should be due to Asp9-Asn9 heterodimers, with the other half divided equally between the two homodimers, although this cannot be readily assessed with current techniques. Evidence from the in vitro studies suggests that Asn9 homodimers are not produced as efficiently as their Asp9 counterparts, and it is possible that heterodimer production may be even less efficient. If this is the case, then tissue culture models would underestimate the impact of the Asn9 variant and could explain the similar decrease in mass and activity observed in both homozygous (in vitro) and heterozygous (carrier individuals) settings.

After completion of the work reported here, two small studies reported identification of the LPL-Asn9 variant in 20 patients from the United States and 31 patients from Canada with FCHL.50 51 A carrier frequency of 2% to 5% was observed in FCHL patients, but a similar frequency was also reported in 49 healthy individuals. However, neither study was large enough to have the power to detect small differences in carrier frequency, and in addition, case-control frequency comparisons are easily confounded by ethnic heterogeneity, such as is found in the United States. Further larger studies are required to more precisely estimate the frequency of the LPL-Asn9 variant in groups of patients with different hyperlipidemic phenotypes. However, neither previous study would have had the sensitivity to detect the 20% to 30% lower activity and mass that we consistently observed in the more extensive transfection experiments reported here.

The 24% higher plasma triglyceride levels observed in normal LPL-Asn9 carriers support the contention that the moderate decrease in LPL activity associated with the Asn9 substitution can directly affect lipid metabolism and that this factor, when compounded by other factors, may lead to full hyperlipidemia. These data suggest that a search for other common variants in the LPL gene that affect enzyme function or expression will be fruitful.


View this table:
[in this window]
[in a new window]
  		Table 5. Age, Body Mass Index, and Lipid Levels of Individuals With the Asp9->Asn Substitution


*    Acknowledgments
 
This work was supported by the British Heart Foundation (RG16) (Drs Humphries and Talmud), the Swedish Medical Research Council, and the Bank of Sweden Tercentenary Foundation (Dr Olivecrona). The excellent technical assistance of Ann-Sofie Jakobsson and Karla Peters is gratefully acknowledged, and we thank Jackie Cooper for assistance with the statistical analysis.


*    Appendix 1
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *Appendix 1
down arrowReferences
 

Received July 11, 1994; accepted January 20, 1995.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 up arrowAppendix 1
 *References
 

  1. Castelli WP. Epidemiology of triglycerides: a view from Framingham. Am J Cardiol. 1992;70:3H-9H. [Medline] [Order article via Infotrieve]
  2. Bengtsson C, Björkelund C, Lapidus L, Lissner L. Associations of serum lipoproteins and obesity with mortality in women: 20 year follow-up of participants in prospective population study in Gothenburg, Sweden. BMJ. 1993;307:1385-1388.
  3. Goldstein JL, Hazzard WR, Schrott HG, Bierman EL, Motulsky AG. Hyperlipidemia in coronary heart disease, II: genetic analysis of lipid levels in 176 families and delineation of a new inherited disorder, combined hyperlipidemia. J Clin Invest. 1973;52:1544-1568.
  4. Nikkilä EA, Aro A. Family study of lipids and lipoproteins in coronary heart-disease. Lancet. 1973;1:954-958. [Medline] [Order article via Infotrieve]
  5. Brunzell JD, Schrott HG, Motulsky AG, Bierman EL. Myocardial infarction in the familial forms of hypertriglyceridemia. Metabolism. 1976;25:313-320. [Medline] [Order article via Infotrieve]
  6. Grundy SM, Chait A, Brunzell JD. Familial combined hyperlipidemia workshop. Arteriosclerosis. 1987;7:203-207.
  7. Sniderman A, Shapiro S, Marpole D, Malcolm I, Skinner B, Kwiterovich PO Jr. The association of coronary atherosclerosis and hyperapolipoproteinemia (increased protein but normal cholesterol content in human plasma low density lipoprotein). Proc Natl Acad Sci U S A. 1980;97:604-608.
  8. Kwiterovich PO Jr, Coresh J, Bachorik PS. Prevalence of hyperapobetalipoproteinemia and other lipoprotein phenotypes in men (<50 years) and women (<60 years) with coronary artery disease. Am J Cardiol. 1993;71:631-639. [Medline] [Order article via Infotrieve]
  9. Austin MA, Brunzell JD, Fitch WK, Krauss RM. Inheritance of low density lipoprotein subclass patterns in familial combined hyperlipidemia. Arteriosclerosis. 1990;10:520-530. [Abstract/Free Full Text]
  10. Hokanson JE, Austin MA, Zambon MA, Brunzell JD. Plasma triglyceride and LDL heterogeneity in familial combined hyperlipidemia. Arterioscler Thromb. 1993;13:427-434. [Abstract/Free Full Text]
  11. Austin MA, King M-C. Vranizan KM, Krauss RM. Atherogenic lipoprotein phenotype: a proposed genetic marker for coronary heart disease. Circulation. 1990;82:495-506. [Abstract/Free Full Text]
  12. De Graaf J, Hak-Lemmers HLM, Hectors MPC, DeMacker PNM, Hendricks JCM, Stalenhoef AFH. Enhanced susceptibility to in vitro oxidation of the dense low density lipoprotein subfraction in healthy subjects. Arterioscler Thromb. 1991;11:298-306. [Abstract/Free Full Text]
  13. Kwiterovich PO Jr. Genetics and molecular biology of familial combined hyperlipidemia. Curr Opin Lipidol. 1993;4:133-143.
  14. Wojciechowski AP, Farrall M, Cullen P, Wilsort ME, Bayliss JD, Farren B, Griffin BA, Caslake MJ, Packard CJ, Shepherd J, Thakker R, Scott J. Familial combined hyperlipidemia linked to the apolipoprotein A-I/C-III/A-IV gene cluster on chromosome 11q23-q24. Nature. 1991;349:161-164. [Medline] [Order article via Infotrieve]
  15. Hayden MR, Kirk H, Clark C, Frohlich J, Rabkin S, McLeod R, Hewitt J. DNA polymorphisms in and around the apo AI-CIII gene and genetic hyperlipidemias. Am J Hum Genet. 1987;40:421-430. [Medline] [Order article via Infotrieve]
  16. Wijsman EM, Motulsky AG, Guo S-W, Yang M, Austin MA, Brunzell JD, Deeb S. Evidence against linkage of familial combined hyperlipidemia to the AI/CIII/AIV gene complex. Circulation. 1992;86(suppl I):I-410. Abstract.
  17. Xu C-F, Talmud P, Schuster H, Houlston R, Miller G, Humphries SE. The association between genetic variation at the apo AI-CIII-AIV gene cluster and familial combined hyperlipidemia. Clin Genet. 1994;46:385-397. [Medline] [Order article via Infotrieve]
  18. Brunzell JD. Familial lipoprotein lipase deficiency and other causes of the chylomicronemia syndrome. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The Metabolic Basis of Inherited Disease. New York, NY: McGraw-Hill Book Co Inc; 1989:1165-1180.
  19. Wilson DE, Emi M, Iverius P-H, Hata A, Wu LL, Hillas E, Williams RR, Lalouel JM. Phenotypic expression of heterozygous lipoprotein lipase deficiency in the extended pedigree of a proband homozygous for a missense mutation. J Clin Invest. 1990;86:735-750.
  20. Babirak SP, Iverius P-H, Fujimoto WY, Brunzell JD. Detection and characterization of the heterozygote state for LPL deficiency. Arteriosclerosis. 1989;9:326-334. [Abstract/Free Full Text]
  21. Babirak SP, Brown BG, Brunzell JD. Familial combined hyperlipidemia and abnormal lipoprotein lipase. Arterioscler Thromb. 1992;12:1176-1183. [Abstract]
  22. Seed M, Mailly F, Vallance D, Doherty E, Winder A, Talmud P, Humphries SE. Lipoprotein lipase activity in patients with combined hyperlipidemia. Clin Invest. 1994;72:100-106. [Medline] [Order article via Infotrieve]
  23. Hamsten AG, Walldius G, Dahlen B, Johansson D, de Faire U. Serum lipoproteins and apolipoproteins in young male survivors of myocardial infarction. Atherosclerosis. 1986;59:223-231.[Medline] [Order article via Infotrieve]
  24. Asplund-Carlson A. Studies in hypertriglyceridaemia, II: clinical characteristics linked with the hypertriglyceridaemic state in randomly selected Swedish men. Nutr Metab Cardiovasc Dis. 1994;4:88-95.
  25. Humphries SE, Lane A, Green FR, Cooper J, Miller GJ. Factor VII coagulant activity and antigen levels in healthy men are determined by interaction between factor VII genotype and plasma triglyceride concentration. Arterioscler Thromb. 1994;14:193-198. [Abstract/Free Full Text]
  26. Nilsson-Ehle P, Ekman R. Rapid, simple and specific assays for lipoprotein lipase and hepatic lipase. Artery. 1977;3:194-209.
  27. Karpe F, Olivecrona T, Walldius G, Hamsten A. Lipoprotein lipase in plasma after an oral fat load: relation to free fatty acids. J Lipid Res. 1992;33:975-984. [Abstract]
  28. Vilella EJ, Joven M, Fernández S, Vilaró S, Brunzell JD, Olivecrona T, Bengtsson-Olivecrona G. Lipoprotein lipase in human plasma is mainly inactive and associated with cholesterol-rich lipoproteins. J Lipid Res. 1993;34:1555-1564. [Abstract]
  29. Peterson J, Fujimoto WY, Brunzell JD. Human lipoprotein lipase: relationship of activity, heparin affinity, and conformation as studied with monoclonal antibodies. J Lipid Res. 1992;33:1165-1170. [Abstract]
  30. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1989;16:1215. [Free Full Text]
  31. Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel SS, Miller OJ, Breg WR, Jones HW Jr, Rary JM. Analysis of human Y-chromosome-specific reiterated DNA in chromosome variants. Proc Natl Acad Sci U S A. 1977;74:1245-1249. [Abstract/Free Full Text]
  32. Oka K, Tkalcevic GT, Nakano T, Tucker H, Ishimura-Oka K, Brown VW. Structure and polymorphic map of human lipoprotein lipase gene. Biochim Biophys Acta. 1990;1049:21-26. [Medline] [Order article via Infotrieve]
  33. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics. 1989;5:874-879. [Medline] [Order article via Infotrieve]
  34. Green P, Bentley D, Mibashan R, Nilsson I, Giannelli F. The molecular pathology of haemophilia B. EMBO J. 1989;8:1067-1072. [Medline] [Order article via Infotrieve]
  35. Merrill CR, Goldman D, Sedman SA, Ebert MH. Ultrasensitive stain for protein in polyacrylamide gels shows regional variation in cerebrospinal fluid proteins. Science. 1981;211:1437-1438. [Abstract/Free Full Text]
  36. Peacock RE, Hamsten A, Nilsson-Ehle P, Humphries SE. Associations between lipoprotein lipase gene polymorphisms and plasma correlations of lipids, lipoproteins and lipase activities in young myocardial infarction survivors and age-matched healthy individuals from Sweden. Atherosclerosis. 1992;97:171-185. [Medline] [Order article via Infotrieve]
  37. Selden RF, Burke-Howie K, Rowe MD, Goodman HM, Moore DD. Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol Cell Biol. 1986;6:3173-3179. [Abstract/Free Full Text]
  38. Armitage P, Berry G. Statistical Methods in Medical Research. London, England: Blackwell Scientific Publications; 1987:459-464.
  39. Wion KL, Kirchgessner TG, Lusis AJ, Schotz MC, Lawn RM. Human lipoprotein lipase complementary DNA sequence. Science. 1987;236:1638-1641.
  40. Lohse P, Beg O, Brunzell JD, Santamarina-Fojo S, Brewer HB Jr. Familial chylomicronemia: identification of a unique patient homozygous for two separate mutations in the LPL gene. Arterioscler Thromb. 1991;11:1415a. Abstract.
  41. Bensadoun A. Lipoprotein lipase. Annu Rev Nutr. 1991;11:217-237. [Medline] [Order article via Infotrieve]
  42. Derewenda ZS, Cambillau C. Effects of gene mutations in lipoprotein and hepatic lipase as interpreted by a molecular model of the pancreatic triglyceride lipase. J Biol Chem. 1991;266:23112-23119. [Abstract/Free Full Text]
  43. Semenkovich CF, Wims M, Noe L, Etienne J, Chan L. Insulin regulation of lipoprotein lipase activity in 3T3-L1 adipocytes is mediated at posttranscriptional and posttranslational levels. J Biol Chem. 1989;264:9030-9038. [Abstract/Free Full Text]
  44. Taskinen M-R. Lipoprotein lipase in hypertriglyceridemias. In: Borensztajn J, ed. Lipoprotein Lipase. Chicago, Ill: Evener Publishers Inc; 1987:201-225.
  45. Eckel RH. Adipose tissue lipoprotein lipase. In: Borensztajn J, ed. Lipoprotein Lipase. Chicago, Ill: Evener Publishers Inc; 1987:79-132.
  46. Schwartz RS, Brunzell JD. Increase of adipose tissue lipoprotein lipase activity and weight loss. Metabolism. 1981;67:1425-1430.
  47. Tenkanen H, Taskinen M-R, Antikainen M, Ulmanen I, Kontula K, Enholm C. A novel amino acid substitution (His183 Gln) in exon 5 of the lipoprotein lipase gene results in loss of catalytic activity: phenotypic expression of the mutant gene in a heterogenous state. J Lipid Res. 1994;35:220-228. [Abstract]
  48. Cardin AD, Weintraub HJR. Molecular modeling of protein-glycosaminoglycan interactions. Arteriosclerosis. 1989;9:21-32. [Abstract/Free Full Text]
  49. Hata A, Ridinger DN, Sutherland S, Emi M, Shuhua Z, Myers RL, Ren K, Cheng T, Inoue I, Wilson DE, Iverius P-H, Lalouel J-M. Binding of lipoprotein lipase to heparin: identification of five critical residues in two distinct segments of the amino terminal domain. J Biol Chem. 1993;268:8447-8457. [Abstract/Free Full Text]
  50. Nevin DN, Brunzell JD, Deeb SS. The LPL gene in individuals with familial combined hyperlipidemia and decreased LPL activity. Arterioscler Thromb. 1994;14:869-873. [Abstract/Free Full Text]
  51. Gagne E, Genest J Jr, Zhang H, Clarke LA, Hayden MR. Analysis of DNA changes in the LPL gene in patients with familial combined hyperlipidemia. Arterioscler Thromb. 1994;14:1250-1257.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
J. Rip, M. C. Nierman, C. J. Ross, J. W. Jukema, M. R. Hayden, J. J.P. Kastelein, E. S.G. Stroes, and J. A. Kuivenhoven
Lipoprotein Lipase S447X: A Naturally Occurring Gain-of-Function Mutation
Arterioscler. Thromb. Vasc. Biol., June 1, 2006; 26(6): 1236 - 1245.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
Y. Yang, E. Ruiz-Narvaez, T. Niu, X. Xu, and H. Campos
Genetic variants of the lipoprotein lipase gene and myocardial infarction in the Central Valley of Costa Rica
J. Lipid Res., November 1, 2004; 45(11): 2106 - 2109.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
M. E. Brousseau, A. L. Goldkamp, D. Collins, S. Demissie, A. C. Connolly, L. A. Cupples, J. M. Ordovas, H. E. Bloomfield, S. J. Robins, and E. J. Schaefer
Polymorphisms in the gene encoding lipoprotein lipase in men with low HDL-C and coronary heart disease: The Veterans Affairs HDL Intervention Trial
J. Lipid Res., October 1, 2004; 45(10): 1885 - 1891.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
J. Lopez-Miranda, G. Cruz, P. Gomez, C. MarIn, E. Paz, P. Perez-MartInez, F. J. Fuentes, J. M. Ordovas, and F. Perez-Jimenez
The Influence of Lipoprotein Lipase Gene Variation on Postprandial Lipoprotein Metabolism
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4721 - 4728.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
M. Merkel, R. H. Eckel, and I. J. Goldberg
Lipoprotein lipase: genetics, lipid uptake, and regulation
J. Lipid Res., December 1, 2002; 43(12): 1997 - 2006.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
I. L. Ruel, D. Gaudet, P. Perron, J. Bergeron, P. Julien, and B. Lamarche
Characterization of LDL Particle Size Among Carriers of a Defective or a Null Mutation in the Lipoprotein Lipase Gene: The Quebec LIPD Study
Arterioscler. Thromb. Vasc. Biol., July 1, 2002; 22(7): 1181 - 1186.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.